ID: 1124121722

View in Genome Browser
Species Human (GRCh38)
Location 15:26894007-26894029
Sequence TGTTAGGTCGAGGACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124121709_1124121722 29 Left 1124121709 15:26893955-26893977 CCAAGGACCCTTGCTTGAAGGCT 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1124121712_1124121722 21 Left 1124121712 15:26893963-26893985 CCTTGCTTGAAGGCTGGTCACTG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1124121716_1124121722 -5 Left 1124121716 15:26893989-26894011 CCTTTGGGCCTCCAGGAGTGTTA 0: 1
1: 0
2: 1
3: 3
4: 122
Right 1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1124121711_1124121722 22 Left 1124121711 15:26893962-26893984 CCCTTGCTTGAAGGCTGGTCACT 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124121722 Original CRISPR TGTTAGGTCGAGGACTGGAG AGG Intronic
900371928 1:2336066-2336088 TGTGAGCTGGAGGACAGGAGTGG - Intronic
900458928 1:2790887-2790909 TCTCAGGTCTAGGACTGGAGGGG + Intronic
901025864 1:6278436-6278458 TGTTCGGGAGAGGAGTGGAGCGG + Intronic
903385664 1:22924562-22924584 GGTTTGGTGGAGGAGTGGAGGGG - Intergenic
904334909 1:29790550-29790572 TCTTAGGTCTAGGACTGCAATGG + Intergenic
909153573 1:72040944-72040966 TATTAGGTTGATGTCTGGAGAGG - Intronic
910374467 1:86553319-86553341 TGTTTGCACGAGGACTGAAGGGG - Intronic
910884373 1:91949894-91949916 TCTTAGGTCTTGGACTGGTGTGG + Exonic
915727025 1:158025281-158025303 TGTTAGGCCCAGGAATGAAGAGG + Intronic
920764987 1:208823700-208823722 TGTTAATTTGAGGACTGGGGAGG + Intergenic
1064348483 10:14554777-14554799 TTTTTGGTAGAGGATTGGAGGGG - Intronic
1079551990 11:21711209-21711231 TGTTAGGAAGAGCAGTGGAGAGG + Intergenic
1085270842 11:75269030-75269052 TGTCAGTCCGAGGACTGCAGAGG + Intronic
1086152281 11:83625203-83625225 TGTTGGGTCCAAGATTGGAGGGG + Intronic
1091661449 12:2386882-2386904 GGTCAGGTGGAGGACTGGGGTGG - Intronic
1095880503 12:47131282-47131304 TCTGAGGTCAAGGATTGGAGTGG - Intronic
1102529136 12:113533173-113533195 TGTTGGGTGGAGGAAGGGAGAGG + Intergenic
1108186494 13:47893148-47893170 TACTAAGTCAAGGACTGGAGTGG - Intergenic
1110686002 13:78374663-78374685 ATATAGGTCGAGGTCTGGAGGGG + Intergenic
1111976080 13:94968247-94968269 TGTTAGGGCGAGGACAGAAGGGG - Intergenic
1119383921 14:74245561-74245583 TGAGAGGTGGAGTACTGGAGGGG + Intronic
1119439739 14:74620098-74620120 TGTTAGGCGGAGGACCAGAGGGG - Intergenic
1122135655 14:99631466-99631488 TGTTGGGGCCAGGACTGTAGGGG - Intergenic
1122946315 14:105011906-105011928 TGTTTGCACGAGGACTGAAGAGG - Exonic
1124121722 15:26894007-26894029 TGTTAGGTCGAGGACTGGAGAGG + Intronic
1125605530 15:40937882-40937904 TGTTGGGCCGAAGACTGGGGAGG + Intronic
1127698024 15:61470753-61470775 TGCAAGGTCTAGGAGTGGAGTGG + Intergenic
1130418109 15:83713487-83713509 TGGCAGGTGGAGGACTGGATGGG + Intronic
1130541081 15:84821256-84821278 TGTAAGGGCGAGGCCTAGAGAGG + Intronic
1137757333 16:50913085-50913107 TGTAAGGGAGAGGAATGGAGGGG - Intergenic
1141413260 16:83850851-83850873 GGTGAGGTAGAGGACTTGAGGGG - Intergenic
1142640952 17:1285739-1285761 GGTAAGGTCGAGGAGGGGAGGGG + Intronic
1143504645 17:7356885-7356907 TGATTGGTTGAGGGCTGGAGGGG - Exonic
1144996914 17:19276085-19276107 TTTTAGGGCTAGGGCTGGAGTGG + Intronic
1149531686 17:57400717-57400739 AGTTAGGTTCAGGAGTGGAGAGG + Intronic
1152636475 17:81432582-81432604 GGTTGGGTCCAGGGCTGGAGGGG - Intronic
1159131864 18:64288757-64288779 TGTTAGGGTGAGGTCTGGAAGGG - Intergenic
1160822903 19:1066709-1066731 GGTCAGGTCGAGGACAGGTGGGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1165768479 19:38364971-38364993 TGTGAGGTCCAAGCCTGGAGGGG + Exonic
1165822495 19:38685459-38685481 TGTGAGGTGCAGGCCTGGAGAGG + Intronic
926124816 2:10265516-10265538 TGTTAGATCTGAGACTGGAGGGG + Intergenic
926536925 2:14124514-14124536 TCTGAGGTCTAGGATTGGAGTGG - Intergenic
933277272 2:80297228-80297250 TGTTAGGTGTAGGAGTGGAGGGG + Intronic
941010741 2:160297002-160297024 TGTTGGGTACAGGTCTGGAGAGG - Intronic
941377229 2:164746752-164746774 TGTTAGATAGGGGACTGGAGAGG - Intronic
947751691 2:232535857-232535879 TGGGAAGTTGAGGACTGGAGTGG + Intronic
948852350 2:240714609-240714631 TGTGAGGTGGAGGGCTGGTGTGG - Exonic
1170448042 20:16450559-16450581 TGGGACGTGGAGGACTGGAGCGG - Intronic
1173316740 20:41951325-41951347 TGTGGGGTGGAGGACTGCAGGGG + Intergenic
1176530903 21:7957141-7957163 TGTAATGTAAAGGACTGGAGTGG - Intergenic
1184176502 22:42792306-42792328 TGTCAGGACCAGGACAGGAGTGG + Intergenic
1203303525 22_KI270736v1_random:93614-93636 TGTAAGGTAGAAGAGTGGAGTGG + Intergenic
950155733 3:10720232-10720254 TGTAAGTTCTAGGGCTGGAGAGG + Intergenic
951933723 3:27998658-27998680 TGATAGGCCTAGGACTGGAAGGG + Intergenic
952952990 3:38539176-38539198 TGGGAGGTAGAGGGCTGGAGTGG + Intronic
967140436 3:186553778-186553800 TGTTAGGTTGGGGATGGGAGTGG - Intronic
970353516 4:15229699-15229721 TGGTATCTCAAGGACTGGAGGGG - Intergenic
974468835 4:62292942-62292964 TTTTAGGGAGAGGGCTGGAGGGG - Intergenic
988117259 5:26911493-26911515 TGTTAGGAAGAGGACTGGATAGG + Intronic
997557398 5:134812544-134812566 TGTTAGGTCCAGGACCACAGTGG + Intronic
1005841507 6:29747570-29747592 GGTTAGGGTGAGGACAGGAGGGG + Intergenic
1006603829 6:35242797-35242819 TGTTGGGAAGAGGACTGGAAGGG + Intronic
1007718997 6:43874394-43874416 TGTTGGGCCCAGGACTGGTGGGG - Intergenic
1017951296 6:159137289-159137311 GGTCAGGTTGAGGACTGGATGGG + Intergenic
1021636240 7:22696847-22696869 TGTTAGGTGAGGGACTGGGGAGG - Intergenic
1025243692 7:57299269-57299291 GGATAGGTCGATAACTGGAGAGG + Intergenic
1032974333 7:137204903-137204925 TGTTAGATCAAGGAATTGAGTGG - Intergenic
1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG + Intronic
1034979799 7:155468272-155468294 TGTGGGGTCGAGGAATGGTGAGG + Intergenic
1038642195 8:29337520-29337542 TGCTAGACCAAGGACTGGAGAGG + Intronic
1042832972 8:73051537-73051559 TGATAGGACCAGGACTGGAAGGG + Intergenic
1043640297 8:82442251-82442273 GGCTAGGTCAAGGACTGGAAAGG + Intergenic
1049983447 9:925812-925834 TGTTAGGTAGGGGAAAGGAGGGG + Intronic
1050243428 9:3661489-3661511 TGGCAGGCAGAGGACTGGAGAGG - Intergenic
1058186728 9:101864034-101864056 TGTTAGATGGGGGACTGGTGGGG + Intergenic
1061461594 9:130743912-130743934 TGTTAGGCAGATGTCTGGAGTGG + Intronic
1061914410 9:133741885-133741907 TGTTAGGCCATGGAGTGGAGAGG - Intergenic
1062530143 9:136996139-136996161 TCTCAGGTCGGGGACTGGGGTGG - Intronic
1187975746 X:24703245-24703267 TGGTAGGTCGAGGACTTCACAGG + Exonic
1193725301 X:85031646-85031668 TGTTAGGTACAGGAGAGGAGAGG + Intronic
1194011307 X:88566048-88566070 TGTTAGGTCAAGGACTGAGTAGG - Intergenic
1201099358 Y:10659763-10659785 TGTAATGTAGAGGAGTGGAGAGG - Intergenic
1201099445 Y:10660397-10660419 TGTAATGTAGAGGAGTGGAGAGG - Intergenic