ID: 1124124797

View in Genome Browser
Species Human (GRCh38)
Location 15:26929544-26929566
Sequence GCCCCACAGCTCTCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 431}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124124787_1124124797 24 Left 1124124787 15:26929497-26929519 CCGCATGACTTTGGGGATCCCCT 0: 1
1: 0
2: 1
3: 14
4: 131
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431
1124124792_1124124797 -1 Left 1124124792 15:26929522-26929544 CCCTGTAGCAGCTTATGCCTGTG 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431
1124124791_1124124797 0 Left 1124124791 15:26929521-26929543 CCCCTGTAGCAGCTTATGCCTGT 0: 1
1: 0
2: 2
3: 27
4: 257
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431
1124124793_1124124797 -2 Left 1124124793 15:26929523-26929545 CCTGTAGCAGCTTATGCCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431
1124124788_1124124797 6 Left 1124124788 15:26929515-26929537 CCCCTGCCCCTGTAGCAGCTTAT 0: 1
1: 0
2: 4
3: 5
4: 186
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431
1124124789_1124124797 5 Left 1124124789 15:26929516-26929538 CCCTGCCCCTGTAGCAGCTTATG 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431
1124124790_1124124797 4 Left 1124124790 15:26929517-26929539 CCTGCCCCTGTAGCAGCTTATGC 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG 0: 1
1: 0
2: 2
3: 37
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124124797 Original CRISPR GCCCCACAGCTCTCTGGGAC TGG Intronic
900627932 1:3617980-3618002 GCCCCGCTCCTCTCTGGGCCGGG - Intergenic
900675861 1:3885799-3885821 GCCTCACAGCTGTCCGGGCCAGG - Intergenic
900792191 1:4688013-4688035 GCCTTCCAGCTCACTGGGACAGG - Intronic
901318896 1:8327412-8327434 GCCCCACTGGTCTCTGGGGCTGG + Intronic
901830942 1:11892180-11892202 GGCCCCCACCTCTCTGGGGCTGG + Intergenic
903211779 1:21822897-21822919 GCCCCACAGCTACCTGAGACGGG - Exonic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
903348646 1:22704287-22704309 GCCTCACAGCTCTAGGGGATAGG + Intergenic
903853281 1:26320925-26320947 GCCCCACAGGCATCTGGGGCTGG + Intergenic
904299340 1:29543992-29544014 GCCCCACAGCCTTCTGTGATGGG - Intergenic
904329031 1:29745905-29745927 GCCACACAGCTGGCTGTGACAGG - Intergenic
904623703 1:31790529-31790551 GTCCCACCTCTCTCTGGAACAGG + Exonic
904888793 1:33762281-33762303 CCTCCACAGCTCTCTGAGTCAGG + Intronic
906707132 1:47903096-47903118 GCCCAAGAGCTCTGAGGGACAGG - Intronic
907402645 1:54233850-54233872 GCCCAACAGCTCACTGAGAACGG + Intronic
908715659 1:67067259-67067281 GTTCCACAGATCTCTGGGGCAGG - Intergenic
909065364 1:70930176-70930198 GCAACACAGCTGTGTGGGACTGG + Intronic
909269253 1:73601558-73601580 GTTCCACAGATCTCTGGGGCAGG + Intergenic
909282238 1:73770512-73770534 GCCCCACAGTGCTCTGAGATTGG - Intergenic
909751327 1:79165279-79165301 GTTCCACAGATCTCTAGGACAGG - Intergenic
911855400 1:102869698-102869720 GTCCCACAGATCTCTAGGGCAGG + Intergenic
912319351 1:108696288-108696310 CCCCTACAGATCTGTGGGACTGG + Exonic
912420228 1:109537666-109537688 TCCCAATAGCTCTCTGGGAGGGG + Intergenic
912711562 1:111953736-111953758 GCTCCCAAGCTCTCTGGGCCTGG - Intronic
913017814 1:114757357-114757379 GCCGCACTGCGCTCTGGTACTGG + Intronic
913305733 1:117429296-117429318 GCCCAACAGCTCACTGAGAACGG - Intronic
915602679 1:156932148-156932170 CCCCCAAGGCTCTCTGGCACAGG + Intronic
915811675 1:158919934-158919956 GCTCCACAGATCTCTAGGGCAGG - Intergenic
915850211 1:159313846-159313868 GTCCCAGAGTTCCCTGGGACAGG - Exonic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916650466 1:166830261-166830283 GTTCCACAGATCTCTGGGGCAGG - Intergenic
917848186 1:179040226-179040248 GCCCAACGGCTCACTGGGAACGG - Intronic
919727138 1:200891680-200891702 GCGCCAGAGCTCCATGGGACAGG + Intronic
919791940 1:201297347-201297369 GCCCCACAGACCTCAGGGAGAGG + Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920872449 1:209805767-209805789 GCCCCAAAGCTATCTGGAAAAGG + Intronic
921258723 1:213366259-213366281 GTCTCACAGCTCTTTGGAACAGG - Intergenic
922870679 1:228899708-228899730 GCCTCACAGATCTCTGGGAGAGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924460144 1:244252014-244252036 GCCCCACAGTCCTGTGAGACTGG - Intergenic
924483011 1:244453595-244453617 GCCACCCAGTTCTCTTGGACTGG + Intergenic
1063134969 10:3208509-3208531 GCCCCACACTGCTCTGTGACAGG + Intergenic
1063965803 10:11344806-11344828 GGCGCACAACTCTCTGGGACCGG + Intergenic
1067145133 10:43689057-43689079 TCCCAAGAGCTCTCTGGGCCAGG - Intergenic
1067690059 10:48496093-48496115 ATCCCACAGCTCTGTGGGTCGGG - Intronic
1070560628 10:77563939-77563961 GCATAACAGCTCTCTGGGACAGG - Intronic
1071616746 10:87081447-87081469 GCCCAACAGCTCACTGAGAACGG + Intronic
1073481399 10:103788212-103788234 CCACAACAGCTCTATGGGACAGG + Intronic
1073485911 10:103819182-103819204 ACACCAGAGCTCCCTGGGACTGG - Intronic
1074069066 10:110048633-110048655 GTTCCACAGATCTCTGGGGCAGG - Intronic
1074406824 10:113187225-113187247 GCTTCAGAGCTCTCTGGGACTGG - Intergenic
1074526603 10:114268457-114268479 TCACCACAGCTCTCTGGAATAGG - Intronic
1074962733 10:118462836-118462858 CCTCCACTGCTCTCTGGGTCGGG + Intergenic
1076066525 10:127452769-127452791 GCCCCACAGCCCTCTGGCTTTGG - Intergenic
1077111245 11:863151-863173 GTCTCTCAGCTCCCTGGGACCGG + Intronic
1078515975 11:12022896-12022918 GTCCCACAGATCTCTAGGGCAGG - Intergenic
1078699487 11:13668018-13668040 GGCCCACAGTCCCCTGGGACTGG + Intergenic
1079163052 11:18012577-18012599 GCCCCACGGAGCTCTGGGACCGG + Intronic
1079957303 11:26881387-26881409 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1080393811 11:31871860-31871882 GCCCCACACCTTTCTGGGCTAGG + Intronic
1081590306 11:44418225-44418247 GCCCTATGGGTCTCTGGGACAGG + Intergenic
1081690376 11:45073994-45074016 GCCCCAGAGCTCCCTGGGTTGGG + Intergenic
1081696251 11:45111052-45111074 TCTCACCAGCTCTCTGGGACAGG + Intronic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1085055722 11:73402479-73402501 GACCCCCAGATCTCTGGGAACGG + Intronic
1087480369 11:98692793-98692815 GTTCCACAGATCTCTAGGACAGG - Intergenic
1087668888 11:101082630-101082652 GCTTCACAGATCTCTAGGACAGG - Intronic
1088022040 11:105131225-105131247 GTTCCACAGATCTCTAGGACAGG + Intergenic
1090506235 11:127318414-127318436 ACCCCACAGTTTTCTGGGAAAGG + Intergenic
1090557871 11:127896847-127896869 GACCTACAGCTCTCTGAGAATGG + Intergenic
1090727458 11:129540565-129540587 GCTCCACAAATCTCTAGGACAGG + Intergenic
1090922437 11:131218162-131218184 GTCCCAGAGCTCTGTGGGGCAGG - Intergenic
1091316105 11:134615161-134615183 GCCCCTCAGCTCTCAGGGCAGGG + Intergenic
1092944392 12:13439478-13439500 GCTCCACAGATCTCTAGGGCAGG + Intergenic
1093014863 12:14145495-14145517 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1094807564 12:34107647-34107669 GCCCATCAGTCCTCTGGGACGGG + Intergenic
1096346163 12:50848737-50848759 TGACCACAGCTCTCTGGGAAAGG - Intronic
1096566020 12:52479974-52479996 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1096803893 12:54128462-54128484 GTCCCATAGATCTGTGGGACTGG - Intergenic
1096808070 12:54152438-54152460 GCACCACTGCTCTCTGCCACTGG - Intergenic
1097474316 12:60034614-60034636 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1098003031 12:65965514-65965536 GCCACATACCTCTCTGAGACTGG + Exonic
1099672971 12:85718214-85718236 ATCCCACAAATCTCTGGGACAGG + Intergenic
1099858869 12:88204522-88204544 GTTCCACAGATCTCTAGGACAGG - Intergenic
1100929200 12:99586263-99586285 GCTCCACAGATCTCTAGGGCAGG + Intronic
1102551867 12:113697216-113697238 TCCCAACAGCGCTCTGAGACGGG + Intergenic
1103607537 12:122098294-122098316 GCCCCAGGGCCCTCTAGGACAGG - Intronic
1103875873 12:124126851-124126873 ACCGCAAAGTTCTCTGGGACAGG + Intronic
1104056541 12:125235073-125235095 GCAGCACAGCTCCCTGGAACTGG - Intronic
1104655106 12:130568466-130568488 TGCTCACGGCTCTCTGGGACTGG - Intronic
1104945908 12:132414826-132414848 GCTCCACAGCTCCCTGGGGTGGG - Intergenic
1104979638 12:132568073-132568095 GCCCCACAGCTCACAGCCACAGG - Intronic
1105251051 13:18698472-18698494 GCCCCACAGAGCACTGGGATGGG - Intergenic
1106614639 13:31315419-31315441 GCTCCACAGATCTCTAGGGCAGG - Intronic
1106864363 13:33947825-33947847 GTTCCACAGATCTCTAGGACAGG - Intronic
1107262752 13:38514753-38514775 ACCTCACAACTCTCAGGGACAGG - Intergenic
1108065474 13:46573020-46573042 TCCCCAAAGCCCTCTGTGACAGG - Intronic
1108419388 13:50233381-50233403 GCTCCACAGATCTCTAGGGCAGG - Intronic
1108724402 13:53164161-53164183 GTCCCACAGATCTCTAGGGCAGG + Intergenic
1109241764 13:59898257-59898279 TCACCACAGCTCTGTGAGACAGG + Intronic
1109485313 13:63010684-63010706 GTTCCACAGATCTCTAGGACAGG + Intergenic
1109905122 13:68830441-68830463 GTTCCACAGATCTCTAGGACAGG - Intergenic
1110062829 13:71063899-71063921 GTTCCACAGATCTCTAGGACAGG + Intergenic
1110166616 13:72449959-72449981 GCCCCACAGCCCTCAGCCACAGG + Intergenic
1110703721 13:78580177-78580199 CGCCCTCAGCTCTCTGGAACTGG + Intergenic
1111020079 13:82437834-82437856 GTTCCACAGATCTCTAGGACAGG - Intergenic
1111222222 13:85220093-85220115 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1111769923 13:92584394-92584416 GCTCCACAGATCTCTAGGGCAGG - Intronic
1112789603 13:102988383-102988405 GTTCCACAGATCTCTAGGACAGG + Intergenic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1116670100 14:47829531-47829553 GTTCCACAGATCTCTAGGACAGG + Intergenic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1118524360 14:66622671-66622693 GTTCCACAGATCTCTGGGGCAGG + Intronic
1119322127 14:73738583-73738605 GCTCCACAGCCTTCTGGGCCAGG + Exonic
1120104736 14:80480796-80480818 GTTCCACAGATCTCTAGGACAGG + Intronic
1120326630 14:83037679-83037701 GTTCCACAGATCTCTAGGACAGG + Intergenic
1120620199 14:86753518-86753540 GTTCCACAGATCTCTAGGACAGG + Intergenic
1120696288 14:87649224-87649246 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1121313098 14:92945734-92945756 GCCCCTCAGCTCTCAGTGAGGGG - Intronic
1122802435 14:104238379-104238401 GCCCCACCGGTCTGTGGTACTGG - Intergenic
1123045507 14:105511534-105511556 GCACCACTGCACTCTGGGTCTGG + Intergenic
1124090166 15:26591903-26591925 GCTCAACAGCCCTCTGTGACTGG + Intronic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1124603184 15:31151486-31151508 GCCACACAGCTCCTTGGCACAGG + Intronic
1124638792 15:31382217-31382239 GCCCGGCAGGCCTCTGGGACAGG - Intronic
1125578176 15:40768924-40768946 GCCCCACAGCTCTCTGCTACGGG - Intronic
1125862881 15:43014863-43014885 CCCCCACCTCCCTCTGGGACGGG - Intronic
1127385972 15:58467467-58467489 GCTGCAAAGCTCTCTGGGAAAGG - Intronic
1127563064 15:60159664-60159686 GCCACACAGATATCTGGGAGAGG + Intergenic
1127849517 15:62900928-62900950 ACCCCACAGCAGTCTGGGGCTGG + Intergenic
1129628849 15:77235461-77235483 GTTCCACAGATCTCTAGGACAGG - Intronic
1130021949 15:80239204-80239226 GCCCCACAGTCCTCTGTGCCTGG + Intergenic
1130080010 15:80724680-80724702 GCCCCCAAGCTCTGTGGGTCTGG + Intronic
1130991480 15:88878407-88878429 GGGACAGAGCTCTCTGGGACAGG - Intronic
1131227546 15:90637806-90637828 TCCCCACAGGGCTCTGGGACTGG - Intronic
1131581316 15:93646482-93646504 GCCCCACACTTCTCTGGGGTAGG - Intergenic
1132321543 15:100929274-100929296 CCCCCCCAGCTCTCTGTGAGTGG + Intronic
1132388101 15:101416283-101416305 GTTCCACAGATCTCTGGGGCAGG - Intronic
1132692778 16:1188989-1189011 GCCCCTCAGCTCTCAGGACCTGG - Intronic
1132763750 16:1524240-1524262 GCCCAACAGCTATCTAGGAAGGG + Intronic
1133006049 16:2882543-2882565 GCCCCACAGCTCCCTGTGCCCGG + Intergenic
1133412620 16:5580793-5580815 GCCCTACAGCTTCCTGGGTCTGG - Intergenic
1133842096 16:9419209-9419231 ACCACACAGCACTCTGGGAGAGG + Intergenic
1135828619 16:25753421-25753443 GCCTCACAGCTCCCTGGTGCTGG + Intronic
1136043102 16:27595868-27595890 GCCACGCAGATCTCTGGGAAAGG + Intronic
1136280822 16:29210166-29210188 ACCCCCCAGCCCTCTGGGAGTGG - Intergenic
1136338939 16:29629324-29629346 GCCCCACACCTCGGTGGGAAGGG - Intergenic
1137723598 16:50642129-50642151 GCCCCCCAGCTCTCTTGGAGGGG + Intergenic
1138347374 16:56328360-56328382 GCCCCAGAGTTTTCTGGGGCAGG - Intronic
1139083972 16:63561772-63561794 GTTCCACAGATCTCTAGGACAGG + Intergenic
1139166009 16:64566124-64566146 GTCCCACAAATCTCTAGGACAGG - Intergenic
1139545828 16:67649122-67649144 GCGCCACATGTCTCAGGGACCGG - Exonic
1141719289 16:85746730-85746752 CCCCTTCAGCTCTCTGGGCCTGG + Intronic
1141975283 16:87511751-87511773 GTTCCACAGATCTCTAGGACAGG + Intergenic
1142029124 16:87829704-87829726 CCCCTGCAGCTCCCTGGGACTGG + Intergenic
1142085178 16:88176088-88176110 ACCCCCCAGCCCTCTGGGAGTGG - Intergenic
1142428954 16:90016135-90016157 GCCCCAGAGCAGGCTGGGACTGG + Intronic
1142715746 17:1745929-1745951 GCCTCCCAGCTCTCTTGGTCTGG - Intronic
1143491251 17:7286416-7286438 GCCCCATAGCCTCCTGGGACAGG - Exonic
1147262058 17:39214492-39214514 ACCCCAAAGCGCACTGGGACGGG + Intronic
1147785215 17:42973494-42973516 GCCCAACAGCTCACTGAGAACGG + Intronic
1149113417 17:53062431-53062453 GTTCCACAGCTCTCTAGGGCAGG - Intergenic
1150215603 17:63467279-63467301 CCCCCGCAGATCTCTGGGACTGG - Intergenic
1150675667 17:67244808-67244830 GGCCCAGAGCACTCTGGGAGGGG - Intronic
1151404620 17:73878368-73878390 CTCCCACAGCTCTGTGGAACAGG + Intergenic
1151556263 17:74848189-74848211 GCCCCCCACTTCCCTGGGACAGG + Intronic
1154181421 18:12142774-12142796 GCTCCATACCTCCCTGGGACAGG - Intergenic
1154182483 18:12148810-12148832 GCTCCATACCTCCCTGGGACAGG + Intergenic
1154506650 18:15046650-15046672 GCTCCACAGATCTCTAGGGCAGG + Intergenic
1155364525 18:25036518-25036540 GCCCCATCGCTTTCTGGGTCCGG - Intergenic
1156904540 18:42337503-42337525 GTCCCACAGATCTCTAGGGCAGG + Intergenic
1156991967 18:43419805-43419827 GCCCTGCAGCTCTCTGTGGCAGG - Intergenic
1157300433 18:46474985-46475007 GCCACTCACCTCTCTGTGACCGG - Intergenic
1157693649 18:49703505-49703527 GCCCCACAAATTGCTGGGACTGG - Intergenic
1158299312 18:56033862-56033884 GCTCCACAGATCTCTAGGGCAGG + Intergenic
1159204481 18:65232545-65232567 GTTCCACAGATCTCTAGGACAGG - Intergenic
1159555435 18:69940610-69940632 GTTCCACAGATCTCTGGGGCAGG - Intronic
1160861502 19:1238964-1238986 GCCCCACAGCACACAGGAACAGG - Intergenic
1161043411 19:2121940-2121962 GGCCCACGGCTCTCCGGGCCGGG + Intronic
1162488136 19:10974747-10974769 GCACCACAGCTCTCTAGCCCAGG - Intronic
1162489827 19:10985532-10985554 GCCAGACAGCTCTCTGTGGCGGG - Intronic
1162935478 19:13979530-13979552 GGACCACAGATCTCTGGGAGGGG + Exonic
1162977516 19:14217168-14217190 CCCCCCCACATCTCTGGGACTGG - Intergenic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1164881421 19:31735545-31735567 GCCCAACAGCTCACAGGGCCAGG - Intergenic
1165110509 19:33499487-33499509 GCCCTACATGTCCCTGGGACTGG + Intronic
1165446995 19:35861871-35861893 CCCCCGCGGCTCTCTGGGGCAGG - Exonic
1165849443 19:38840670-38840692 GCCCCACAGCCCTCGAGGAAGGG - Intronic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1167450783 19:49567520-49567542 GCCCCAGGGCTTCCTGGGACTGG + Intronic
925317032 2:2934346-2934368 TCCCCGCATCTGTCTGGGACTGG + Intergenic
926840853 2:17079085-17079107 GTTCCACAGATCTCTAGGACAGG - Intergenic
928475106 2:31617649-31617671 GTTCCACAGATCTCTAGGACAGG + Intergenic
928939349 2:36712049-36712071 GCCCCACAGCTCTGTGACATTGG + Intronic
929089150 2:38197614-38197636 TCCACAGAGCTCTCTGAGACAGG - Intergenic
929576204 2:43054462-43054484 TGGCCACAGCTCTCTGGGCCAGG + Intergenic
930521249 2:52470353-52470375 GTTCCACAGATCTCTAGGACAGG - Intergenic
930939878 2:56999917-56999939 GTTCCACAGATCTCTAGGACAGG + Intergenic
931494186 2:62784014-62784036 GTTCCACAGATCTCTGGGGCAGG + Intronic
931703315 2:64926137-64926159 GTCCCACAGATCTCTAGGGCAGG - Intergenic
933247026 2:79987041-79987063 ACCACACAGCACTCTGGGCCCGG - Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
935175101 2:100642447-100642469 GCCTCACAGCCCTCTGGGGGAGG - Intergenic
935436898 2:103045155-103045177 GTCCCACAGATCTCTAGGGCAGG - Intergenic
936146204 2:109981957-109981979 GCCCCTCCTCTCTCTGGGCCTGG + Intergenic
936161731 2:110088496-110088518 GTGCCACAGATCTCTAGGACAGG - Intronic
936182932 2:110282858-110282880 GTGCCACAGATCTCTAGGACAGG + Intergenic
936198487 2:110389522-110389544 GCCCCTCCTCTCTCTGGGCCTGG - Intergenic
936709992 2:115121189-115121211 GCCCCACACCCCTTTGGGATGGG - Intronic
937157259 2:119729998-119730020 ACCCCACTGCCCTCTGGGGCAGG + Intergenic
937437760 2:121893273-121893295 GCCCAACAGCTCACTGAGAACGG + Intergenic
938137305 2:128769996-128770018 GTCCCACAGCCCTTTGGGCCTGG - Intergenic
939052840 2:137329300-137329322 GCTCCACAGATCTCTAGGGCAGG - Intronic
939092790 2:137798883-137798905 GTCCCACAGATCTCTAGGGCAGG - Intergenic
940288847 2:152058560-152058582 GTTCCACAGATCTCTAGGACAGG - Intronic
942041021 2:172062869-172062891 GCTCCACAGCAGTTTGGGACAGG - Intronic
942644627 2:178096605-178096627 GTCCCATAGATCTCTAGGACAGG + Intronic
943297035 2:186153824-186153846 GCCCAACAGCTCACTGAGAACGG - Intergenic
944458246 2:199917502-199917524 GTTCCACAGATCTCTGGGGCAGG + Intronic
945040293 2:205738488-205738510 GCTCCACAGCTCTCAGGAAAGGG - Intronic
945109638 2:206349959-206349981 GTCCCACAGATCTCTAGGGCAGG + Intergenic
945333351 2:208563649-208563671 GTCCTACAGATCTCTAGGACAGG + Intronic
945920913 2:215753828-215753850 GTTCCAAAGCTCTGTGGGACTGG - Intergenic
946941721 2:224776222-224776244 GTCCCTCAAATCTCTGGGACTGG - Intronic
948099179 2:235359881-235359903 TCCCCACAGCCCTCTGGAAGGGG + Intergenic
1169580825 20:7021904-7021926 GTTCCACAGATCTCTAGGACAGG - Intergenic
1170309995 20:14982139-14982161 GTCCCACAGATCTCTAGGGCAGG - Intronic
1170572618 20:17641044-17641066 GCCCCCTGGCCCTCTGGGACTGG - Intronic
1170628701 20:18049793-18049815 GGCCCACAGGTCTGTGGGGCAGG + Intronic
1170886523 20:20344220-20344242 CCCCCACAGCTCTCTGAGGTGGG - Intronic
1171473382 20:25390051-25390073 GCCCCAGCGCTCTCAGGGTCTGG + Intronic
1171542902 20:25978182-25978204 TCAGCACAGCTCTCTGGGAAAGG - Intergenic
1172775031 20:37402359-37402381 GCCACAGAGCACTCTGGGGCTGG - Intronic
1174044088 20:47721039-47721061 GCTCCACAGCTCTCAGGGCTGGG + Intronic
1174065185 20:47859718-47859740 GAGCCACAGCACACTGGGACCGG - Intergenic
1174285970 20:49473839-49473861 GCGCCTCACCTCTCTGAGACTGG - Intronic
1174379426 20:50147061-50147083 GCCCCACAGCATGCAGGGACAGG + Intronic
1174553160 20:51375828-51375850 CACCCTCAGCTCTCTGGGCCTGG - Intergenic
1175926521 20:62474167-62474189 GCCTCACAGCCCCCTGGGGCCGG + Intronic
1176072855 20:63235903-63235925 GGCCCACAGCTTTCTGGAAGTGG - Exonic
1176200537 20:63858381-63858403 GCCCCTCCGGCCTCTGGGACTGG + Intergenic
1176457879 21:6929029-6929051 GCCCCACAGAGCACTGGGACGGG - Intergenic
1176514725 21:7775385-7775407 GTCCCATCCCTCTCTGGGACAGG + Intergenic
1176791216 21:13322451-13322473 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1176836051 21:13794113-13794135 GCCCCACAGAGCACTGGGACGGG - Intergenic
1177085322 21:16695661-16695683 GCTCCACAGATCTCCAGGACAGG + Intergenic
1177367236 21:20153916-20153938 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1177367285 21:20154356-20154378 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1177640071 21:23834393-23834415 GCCCCAGAGCCCTCTGAGACAGG - Intergenic
1177903419 21:26946000-26946022 GCCTGTCAGCTCTCTGGGAGAGG + Intronic
1178114702 21:29405276-29405298 GTTCCACAGATCTCTAGGACAGG - Intronic
1178634304 21:34288803-34288825 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1178648838 21:34405909-34405931 GTCCCATCCCTCTCTGGGACAGG + Intronic
1178682072 21:34680660-34680682 GTTCCACAGATCTCTAGGACAGG + Intronic
1179126989 21:38599354-38599376 GCCCCACAGCTCTCCATGGCAGG - Intronic
1179641808 21:42752635-42752657 GCTTCACGGCTCCCTGGGACAGG - Intronic
1180091173 21:45534485-45534507 ACCCCACGGCTCTCTGGAAAAGG + Intronic
1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG + Intergenic
1181058696 22:20271801-20271823 ACCCCCCAGCTCCCTGGCACTGG - Intronic
1182364220 22:29767048-29767070 TTCCCAAAGCTCTCTGGGAAGGG - Intergenic
1182477434 22:30583845-30583867 GCCCCACAGGACTCGGGGACTGG - Intronic
1182835101 22:33335412-33335434 GCGCCCCTGCTCTCTGTGACTGG - Intronic
1183403443 22:37618283-37618305 GTCACACAGGCCTCTGGGACTGG - Intronic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184478240 22:44733172-44733194 GCCCCACTCCTTTCTGGGGCAGG - Intronic
1185068572 22:48644202-48644224 GCCCCACAGCCTTCGGGGAGGGG + Intronic
949611779 3:5710245-5710267 GTTCCACAGATCTCTGGGGCAGG + Intergenic
950205831 3:11079792-11079814 GGCCCACACCTTTCTGGTACTGG - Intergenic
950806181 3:15604744-15604766 GTTCCACAGATCTCTAGGACAGG + Intronic
950913142 3:16615879-16615901 GTTCCACAGATCTCTAGGACAGG - Intronic
951669754 3:25167520-25167542 GTGCCTCTGCTCTCTGGGACTGG - Intergenic
952414781 3:33080967-33080989 GGCCCTCAACTCTGTGGGACCGG + Intronic
952589282 3:34931799-34931821 GTTCCACAGATCTCTAGGACAGG - Intergenic
953672645 3:44975954-44975976 GCCCCACCGGGGTCTGGGACTGG - Exonic
953744899 3:45566890-45566912 GCCCCACATCTCTCAGGAATAGG + Intronic
953768666 3:45762625-45762647 CCCCCACAGCTTACTGGGGCAGG - Intronic
954060457 3:48062000-48062022 ACCCAACAGCTCACTGGGAACGG + Intronic
956023423 3:64956756-64956778 ACCCAACAGCTGTCTTGGACTGG - Intergenic
957557591 3:81781299-81781321 GCTCCACAGATCTCTGGGGCAGG + Intergenic
957609816 3:82452354-82452376 GTTCCACAGATCTCTAGGACAGG - Intergenic
958672254 3:97220015-97220037 GTTCCACAGATCTCTAGGACAGG + Intronic
958688131 3:97425853-97425875 GCTCCACAGATCTCTAGGGCAGG + Intronic
959788898 3:110333207-110333229 GTTCCACAGATCTCTAGGACGGG + Intergenic
960488400 3:118280632-118280654 GCCTCAGAGCTATCTGGGAGAGG - Intergenic
960492286 3:118332514-118332536 GTTCCACAGATCTCTAGGACAGG - Intergenic
962947134 3:140182478-140182500 GCCCCACAGCTCTCTGAGCTCGG + Intronic
965025152 3:163292246-163292268 GTCCCACAAATCTCTAGGACAGG + Intergenic
965275587 3:166677905-166677927 GCTCCACAGATCTCTAGGGCAGG + Intergenic
965869550 3:173249661-173249683 GCCACATAGTTCTCTTGGACTGG - Intergenic
966423596 3:179758046-179758068 GTCCCAGATCTCACTGGGACAGG + Intronic
966739729 3:183221511-183221533 GCCCCACAGCCCTCTGCGTCTGG + Intronic
967020387 3:185517336-185517358 GCCCTTCAGCTCTTAGGGACAGG - Intronic
967777093 3:193395852-193395874 GCTCCACAGATCTCTAGGGCAGG + Intergenic
969366251 4:6696106-6696128 GACACACAGCTCTCTGGCCCAGG + Intronic
969684723 4:8664820-8664842 GCCCCCCACCTCTTTGGGGCTGG - Intergenic
971051016 4:22862657-22862679 CAACCACAGCTCTCTGGGAGTGG - Intergenic
971857170 4:32058624-32058646 GCTCCACAGATCTCTAGAACAGG + Intergenic
972012774 4:34205589-34205611 GTTCCACAGGTCTCTGGGGCAGG - Intergenic
972140235 4:35950332-35950354 GTTCCACAGATCTCTGGGGCAGG + Intronic
974588812 4:63918439-63918461 GCCCAACAGCTCACTGAGAACGG - Intergenic
975942068 4:79659960-79659982 GTTCCACAGATCTCTGGGGCAGG - Intergenic
977832181 4:101607643-101607665 GCTCCACAGATCTCTAGGGCAGG - Intronic
978492530 4:109323954-109323976 GCTCCACAGATCTCTAGGGCAGG + Intergenic
978991169 4:115084227-115084249 GTTCCACAGCTCTCTAGGGCAGG - Intronic
979362795 4:119784153-119784175 GTTCCACAGATCTCTAGGACAGG + Intergenic
981191821 4:141872996-141873018 GTTCCACAGATCTCTAGGACAGG + Intergenic
982191929 4:152866362-152866384 ACCCAACAGCTCACTGGGAACGG - Intronic
983260258 4:165448535-165448557 GCCCCACTTCTCTCTGGGCATGG + Intronic
983698636 4:170564320-170564342 GCAGCACAGCTCTCTTGGAGTGG + Intergenic
983847336 4:172536557-172536579 GTTCCACAGATCTCTAGGACAGG - Intronic
985076705 4:186223538-186223560 GCTCCACAGATCTCTAGGGCAGG - Intronic
985638538 5:1052328-1052350 GCATCACGGCACTCTGGGACAGG - Exonic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986464285 5:8005955-8005977 GCCACCCAGCTCTCTCAGACTGG - Intergenic
987744019 5:21947523-21947545 GTTCCACAGATCTCTAGGACAGG - Intronic
988130017 5:27092011-27092033 GGCCCACAGCACTCTGGGTGGGG - Intronic
988628360 5:32901275-32901297 GTTCCACAGATCTCTAGGACAGG + Intergenic
988858615 5:35253433-35253455 GTCCCACAGATCTCTAGGGCAGG + Intergenic
989523711 5:42428669-42428691 GTTCCACAGATCTCTAGGACAGG + Intronic
989802946 5:45566758-45566780 GCCCTTCTGCACTCTGGGACGGG + Intronic
990193373 5:53286872-53286894 GTTCCACAGCTCTCTAGGGCAGG + Intergenic
991764221 5:69957659-69957681 GTTCCACAGATCTCTAGGACAGG - Intergenic
991783105 5:70160488-70160510 GTTCCACAGATCTCTAGGACAGG + Intergenic
991843453 5:70832731-70832753 GTTCCACAGATCTCTAGGACAGG - Intergenic
991875547 5:71160815-71160837 GTTCCACAGATCTCTAGGACAGG + Intergenic
992290166 5:75271657-75271679 GCCCAACAGCTCACTGAGAACGG + Intergenic
992448424 5:76854473-76854495 GCTCCACAGATCTCTAGGGCAGG - Intronic
993776920 5:92011702-92011724 GTTCCACAGATCTCTAGGACAGG - Intergenic
993796036 5:92268506-92268528 GCCGCACAGCTTGCAGGGACAGG - Intergenic
996400408 5:123055823-123055845 GCCCCACAATTCTCCTGGACAGG - Intergenic
996839969 5:127837073-127837095 GTTCCACAGATCTCTAGGACAGG + Intergenic
997109392 5:131058338-131058360 GCCCCACAGCTCTCCTGGTCTGG + Intergenic
997779399 5:136641576-136641598 GCCACATAGCTCTTTGGAACAGG + Intergenic
997824860 5:137097390-137097412 GGCTCACATCTCTCTGAGACAGG - Intronic
998094332 5:139388744-139388766 CCCCCAAAGCTCTCTGGGATGGG + Intronic
999247406 5:150162455-150162477 CCCCCTGTGCTCTCTGGGACTGG - Intergenic
999571480 5:152924834-152924856 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1000609553 5:163359409-163359431 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1000659426 5:163919891-163919913 GTTCCACAGATCTCTAGGACAGG - Intergenic
1001373041 5:171225790-171225812 GCCTCACTGCTCTGTGAGACTGG + Intronic
1001924529 5:175626763-175626785 GCACCTCAGCTCCCTGGGCCTGG - Intergenic
1002569547 5:180132361-180132383 GCCTCCAAGCTCTCTTGGACTGG + Intronic
1002800373 6:516430-516452 GCCACACAGCTCTGTTGGGCCGG - Intronic
1003227871 6:4222899-4222921 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1003604201 6:7544009-7544031 GTCTCACATCTCTCTGGGAAGGG + Intronic
1004076939 6:12352205-12352227 GTTCCACAGATCTCTAGGACAGG + Intergenic
1006376535 6:33674425-33674447 GCCCCCCAGATCTCTGGGACTGG - Intronic
1006642072 6:35494722-35494744 CCCCCACAGGTGTCTGGGAGTGG + Intronic
1006809493 6:36810733-36810755 GCCCCATCTCTCTCTGGGCCTGG - Intronic
1006837318 6:37006863-37006885 GCTCCAGAGCTCCCTGGGACAGG - Intronic
1007013607 6:38441154-38441176 GCCCCACAACACTTTGGGCCTGG - Intronic
1007493804 6:42245086-42245108 AACCCAGGGCTCTCTGGGACGGG - Intronic
1007621442 6:43217492-43217514 GCCTCACAGCTCTTTAGAACTGG + Intronic
1010344914 6:74800061-74800083 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1010605884 6:77889432-77889454 GTTCCACAGATCTCTAGGACAGG - Intronic
1010984172 6:82403187-82403209 CCCCTTCAGCTCTGTGGGACAGG + Intergenic
1011032858 6:82942250-82942272 GTTCCACAGATCTCTAGGACAGG - Intronic
1011036187 6:82978051-82978073 GCCCCACATCTCGGTGGGAAAGG + Intronic
1011219427 6:85038177-85038199 GACCCTCAGCTTTCTGGAACTGG + Intergenic
1011738334 6:90334448-90334470 GTTCCACAGATCTCTAGGACAGG + Intergenic
1012751322 6:103167545-103167567 GTCCCACAGATATCTAGGACAGG - Intergenic
1013204881 6:107935291-107935313 GCCCAACAGCTCACTGAGAACGG + Intronic
1014895131 6:126892309-126892331 GTTCCACAGATCTCTGGGACAGG - Intergenic
1015705571 6:136084177-136084199 GCCCCACAACCCTCTGAGATAGG + Intronic
1016537552 6:145125829-145125851 GTTCCACAAATCTCTGGGACAGG - Intergenic
1016721486 6:147303879-147303901 GTTCCACAGATCTCTAGGACAGG - Intronic
1016790301 6:148060616-148060638 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1017971786 6:159318133-159318155 GCCCCATACCTCTCTAGGACTGG + Intergenic
1018197679 6:161369018-161369040 GCCCCCCAGGTCCCTGGGGCTGG - Intronic
1018229399 6:161661403-161661425 GCCACACAGATATCTGGGAGGGG - Intronic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019186860 6:170225512-170225534 GCCCCACTGTGCTGTGGGACGGG + Intergenic
1019388302 7:770851-770873 CCCCCACAGCACTCTGGGTGAGG + Intronic
1020942734 7:14561680-14561702 GCCCCACAGATCTCTAGGGCAGG - Intronic
1022393198 7:29961563-29961585 GCCCAACAGCTCACTGAGAACGG - Intronic
1022888761 7:34674503-34674525 GCCACACAAGTCTCAGGGACAGG + Intronic
1023811441 7:43915388-43915410 ACCCCATTGCTCTCAGGGACTGG + Intronic
1024710160 7:52006369-52006391 GTCTCACAGCTCTCCAGGACTGG + Intergenic
1024996766 7:55278326-55278348 GGCCAACACCTCTCTGGCACCGG - Intergenic
1025038486 7:55618783-55618805 GTCCCACAGATCTCTAGGGCAGG - Intergenic
1029939524 7:104465057-104465079 GTTCCACAGATCTCTGGGGCAGG + Intronic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1030109349 7:106013362-106013384 ACCTCACAGCTCTATGGGCCGGG - Intronic
1030670415 7:112329635-112329657 GTCCCACAGCTAGCTGGCACTGG + Intronic
1030722464 7:112885490-112885512 GTTCCACAGATCTCTGGGGCAGG + Intronic
1031172559 7:118309730-118309752 GCTCCACAGATCTCTAGGGCAGG + Intergenic
1031645513 7:124221087-124221109 GTTCCACAGCTCTCTAGGGCAGG - Intergenic
1032164660 7:129536053-129536075 GCCCCACAGCCCCTTGTGACAGG - Intergenic
1032366680 7:131306569-131306591 GCTTCACAGCTCTCTAGGGCAGG - Intronic
1033372399 7:140721841-140721863 CCCCCACAGCGCTTTGGGACAGG + Exonic
1037952394 8:23027805-23027827 GCCCCACTGTCCTCTGGGAGGGG - Intronic
1038880530 8:31605943-31605965 GCTCCACAGATCTCTAGGGCAGG + Intergenic
1039082415 8:33745885-33745907 GTTCCACAGCTCTCTAGGCCAGG + Intergenic
1039475824 8:37838966-37838988 GCCCCCCACCTCCCTGGGAAAGG - Exonic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1039979159 8:42391956-42391978 GGCCCACCGCTCTCCGGGACTGG - Intronic
1040284486 8:46092937-46092959 GCCCCAGAGGTTTCTGGGAAGGG - Intergenic
1040302362 8:46194692-46194714 GCCCCAGGGCTGTCTCGGACTGG + Intergenic
1041901653 8:62988964-62988986 GTTCCACAGATCTCTAGGACAGG + Intronic
1041927491 8:63251721-63251743 GTTCCACAGATCTCTAGGACAGG - Intergenic
1042058061 8:64787370-64787392 GTTCCACAGATCTCTGGGGCCGG + Intronic
1042072404 8:64950154-64950176 GTCCCACAGATCTCTATGACAGG + Intergenic
1042622125 8:70717925-70717947 GTCCCACAGATCTCTAGGACAGG + Intronic
1044193141 8:89343058-89343080 GCCCCACAGTGCTCTGGCTCTGG + Intergenic
1044365673 8:91342365-91342387 CCACCACAGCTCTATGGGGCAGG + Intronic
1045207331 8:100056190-100056212 GTTCCACAGATCTCTGGGGCAGG - Intronic
1045239995 8:100391787-100391809 ACCCCACAGCACTCAGGAACTGG - Intronic
1045379597 8:101610194-101610216 TCCCCACAGCACTTTGGGAGGGG - Intronic
1045422227 8:102027367-102027389 GTTCCACAGATCTCTGGGACGGG + Intronic
1045894882 8:107202889-107202911 GCTCCACAGATCTCTGGCAGAGG + Intergenic
1046244341 8:111539070-111539092 GTCCCACAGATCTCTAGGGCAGG - Intergenic
1047186440 8:122637348-122637370 GACCCAGAGCTCTCTGGGGCTGG - Intergenic
1048265599 8:132982859-132982881 GACTCTCTGCTCTCTGGGACGGG + Intronic
1048658508 8:136570906-136570928 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1048705941 8:137154064-137154086 GTTCCACAGATCTCTAGGACAGG - Intergenic
1048915772 8:139181615-139181637 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1048967784 8:139626668-139626690 AGCCCACAGTTCCCTGGGACAGG + Intronic
1049288245 8:141788169-141788191 GCCCCACAGACCTCAGGGCCAGG + Intergenic
1050935121 9:11386484-11386506 GTTCCACAGATCTCTAGGACAGG - Intergenic
1050940454 9:11451346-11451368 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1051632199 9:19150571-19150593 GCCCCACTGCACTCTGGCATGGG + Intergenic
1053470589 9:38343524-38343546 TCCCCAGAGCACTCTGGGGCTGG + Intergenic
1053882732 9:42612011-42612033 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1053889937 9:42682291-42682313 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1054221759 9:62419479-62419501 GTTCCACAGCTCTCCGGGTCAGG + Intergenic
1054228955 9:62489694-62489716 GTTCCACAGCTCTCCGGGTCAGG - Intergenic
1055366125 9:75546922-75546944 GCCCCTCAGCTCTGTGGGAGAGG + Intergenic
1055518817 9:77060647-77060669 GCCCCACAGCTCATTGAGAACGG - Intergenic
1056092140 9:83216016-83216038 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1057211320 9:93202541-93202563 GAGCCACAGCTCTCAGGGAGGGG + Intronic
1057572834 9:96217507-96217529 GCCCCCCAGCTCGCTGAGAGGGG + Intergenic
1057643888 9:96854546-96854568 GCCGCGCAGCACTCTGGGATGGG - Intronic
1058561320 9:106232161-106232183 GACCCTCAGATCTCTGAGACTGG - Intergenic
1059436716 9:114281574-114281596 GCCCCTCCTCTCTCAGGGACTGG - Intronic
1059461267 9:114431925-114431947 CCACCAGAGCTCACTGGGACAGG + Intronic
1059565643 9:115380913-115380935 GTTCCACAGATCTCTAGGACAGG + Intronic
1060174358 9:121486498-121486520 GCCCCACAACCCTCTGGGCCAGG + Intergenic
1060488135 9:124062554-124062576 GACCCACTGCCCTCTGGGAAAGG + Intergenic
1061154115 9:128846799-128846821 GCCCACCAGCCATCTGGGACTGG - Intronic
1061538956 9:131267037-131267059 GCACCACACCTCCCTGGGGCCGG + Intronic
1061940648 9:133882082-133882104 GCCACACAGCTATCTGGGGATGG - Intronic
1062436537 9:136548891-136548913 GGACCACATCTCTCTGGGGCCGG - Intergenic
1062439646 9:136564046-136564068 GCCCCACAGCTTTCTGGGCAGGG - Intergenic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1186488654 X:9953734-9953756 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1186620522 X:11235688-11235710 GTCCCACAGATCTCTAGGGCAGG + Intronic
1186704695 X:12128837-12128859 GTTCCACAGATCTCTAGGACAGG + Intergenic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1187663285 X:21574030-21574052 GCTCCACAGATCTCTAGGGCAGG + Intronic
1188134814 X:26482994-26483016 GTTCCACAGATCTCTGGGATAGG - Intergenic
1190532835 X:51396609-51396631 GCCACACAGCTGTCTGACACCGG + Intergenic
1190756928 X:53409319-53409341 CCCCCAGAGCTCTCTGAGCCAGG - Intronic
1191052366 X:56207514-56207536 GTTCCACAGATCTCTAGGACAGG + Intergenic
1193316592 X:80072180-80072202 GCCCCACCTATCTCTGGGGCAGG + Intergenic
1194339889 X:92694684-92694706 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1194395024 X:93372857-93372879 CCCCCACAGCGTTCTGAGACAGG + Intergenic
1194850144 X:98859411-98859433 GTTCCACAGATCTCTAGGACAGG - Intergenic
1194881252 X:99254299-99254321 GTTCCACAGATCTCTAGGACAGG + Intergenic
1195465052 X:105171274-105171296 GCCCCAGAGGTCTCTGTCACAGG - Intronic
1196278474 X:113796226-113796248 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1197536116 X:127691031-127691053 GTCCCACAGATCTCTAGGTCAGG - Intergenic
1198803891 X:140474935-140474957 GCTCCACAGATCTCTAGGACAGG - Intergenic
1199185543 X:144911150-144911172 GTTCCACAGATCTCTAGGACAGG + Intergenic
1199220403 X:145310080-145310102 GTTCCACAGGTCTCTGGGACCGG + Intergenic
1199309522 X:146306961-146306983 GTTCCACAGATCTCTAGGACAGG - Intergenic
1199357102 X:146875300-146875322 GTCCCACAGATCTCTAGGGCAGG - Intergenic
1199619345 X:149685619-149685641 GTTCCACAGATCTCTGGGGCAGG - Intergenic
1199928169 X:152491391-152491413 GCTCCACAGATCTCTAGGGCAGG - Intergenic
1200648276 Y:5811467-5811489 GTTCCACAGATCTCTGGGGCAGG + Intergenic
1200778112 Y:7188115-7188137 GCCTCACAGCTCTATGTGGCTGG - Intergenic