ID: 1124126111

View in Genome Browser
Species Human (GRCh38)
Location 15:26939295-26939317
Sequence CTGGATTTGCCTGGCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124126111_1124126117 -9 Left 1124126111 15:26939295-26939317 CCCACACAGCCAGGCAAATCCAG 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1124126117 15:26939309-26939331 CAAATCCAGAGAAGGCACTGGGG 0: 1
1: 0
2: 5
3: 25
4: 274
1124126111_1124126120 28 Left 1124126111 15:26939295-26939317 CCCACACAGCCAGGCAAATCCAG 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1124126111_1124126116 -10 Left 1124126111 15:26939295-26939317 CCCACACAGCCAGGCAAATCCAG 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1124126116 15:26939308-26939330 GCAAATCCAGAGAAGGCACTGGG 0: 1
1: 0
2: 1
3: 26
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124126111 Original CRISPR CTGGATTTGCCTGGCTGTGT GGG (reversed) Intronic
900682504 1:3924649-3924671 CTGGCCTTGCCTGCCAGTGTGGG + Intergenic
901880876 1:12192983-12193005 CTGGAGTTGGCTGCGTGTGTTGG - Exonic
902161662 1:14535377-14535399 CTGGACTTGGCTGGGTGTGGTGG + Intergenic
902258681 1:15207517-15207539 CCAGATGTGCCTGGCTGTGATGG + Intronic
904559653 1:31387872-31387894 GTGGATGTGTCTGGATGTGTGGG - Intergenic
905238800 1:36569205-36569227 CTGTATATGCGTGTCTGTGTTGG - Intergenic
905867866 1:41386065-41386087 CTGGGCTTGCCTGCCTGTCTTGG + Intergenic
906258591 1:44368963-44368985 CTGCAGTGGTCTGGCTGTGTAGG + Intergenic
906724048 1:48030728-48030750 CAGGATTTGTCTGGATGGGTAGG + Intergenic
907268092 1:53274945-53274967 CTGGATTTACCTGTCTGTCCTGG - Intronic
907800640 1:57761866-57761888 CTGCATCTCCCTGGCTGTCTGGG - Intronic
910772205 1:90841836-90841858 CAGGTTATGCCTGGCTGTGTCGG + Intergenic
913334650 1:117698125-117698147 GAGGATGTACCTGGCTGTGTGGG + Intergenic
913551241 1:119918953-119918975 ATGGATTGGCCTGACTGTATGGG - Intronic
914810538 1:151024512-151024534 CTGCATTTTCCTTGATGTGTGGG + Intronic
915537176 1:156543912-156543934 CTAGACCTGCCTGGCTCTGTGGG + Intronic
916016382 1:160753610-160753632 CTGGACTTGTCTGTCTGTTTTGG - Exonic
921300203 1:213744760-213744782 ATGGATTTGTCTGTCTTTGTAGG + Intergenic
922784157 1:228274859-228274881 CAGGATTTGCCTGGCTGGCCAGG + Intronic
1063193640 10:3719752-3719774 GTGTACTTGCCTGTCTGTGTTGG - Intergenic
1064970699 10:21063604-21063626 CTGGAGTTGGCTGGATGTGGTGG + Intronic
1065296099 10:24276893-24276915 CTGGACTTGGCTGGGTGTGGTGG - Intronic
1066050694 10:31632477-31632499 AAGGATTTGGCTGGGTGTGTGGG + Intergenic
1066173156 10:32873749-32873771 GTGGAATTGCCGGGTTGTGTAGG + Intronic
1066550234 10:36547809-36547831 GTAGGATTGCCTGGCTGTGTGGG - Intergenic
1067686909 10:48471200-48471222 CTGCCCTGGCCTGGCTGTGTGGG - Intronic
1068284661 10:54918935-54918957 TTGGATTAGACTGGCTGGGTGGG + Intronic
1068777145 10:60880110-60880132 ATGGATTTGGCTGTCTGAGTTGG + Intronic
1068792874 10:61046489-61046511 CAGGCTTTGCCTGTCTGTTTTGG + Intergenic
1068946061 10:62729934-62729956 CTGGATTTGAAAGGCTGAGTAGG - Intergenic
1070045510 10:72830839-72830861 CTGTGTTTGGCTGGCTTTGTTGG - Intronic
1071397112 10:85235074-85235096 CTGGATTTTCCTGGAAATGTTGG + Intergenic
1076386692 10:130062206-130062228 CTGGATTTTCCAGACTGTGAAGG - Intergenic
1076548692 10:131263427-131263449 GTTGTTTGGCCTGGCTGTGTTGG + Intronic
1077853807 11:6101808-6101830 CTGAATTTGGCAGGGTGTGTTGG + Intergenic
1081344346 11:41964575-41964597 CTGTATATGCTTTGCTGTGTAGG - Intergenic
1081552950 11:44130993-44131015 GCGCATCTGCCTGGCTGTGTGGG + Intronic
1081900575 11:46624288-46624310 CTGAATTTGGCTGGTTGTGGTGG - Intronic
1082135618 11:48546115-48546137 CAGGATTTGCCTGTCTGTAAAGG + Intergenic
1084006665 11:66326846-66326868 CTGGGTCCGCCTGGCTGGGTTGG - Intergenic
1085340795 11:75730226-75730248 CTGGTTCTGCCTGGCTGGGAAGG - Intronic
1085461528 11:76696803-76696825 CTGGATATCCTTGGCTCTGTGGG - Intergenic
1086305777 11:85480978-85481000 CTGGTTTTGCCTCGCTGGCTGGG + Intronic
1087367878 11:97244523-97244545 CTGGATTTGTGTGTGTGTGTTGG + Intergenic
1087763672 11:102127533-102127555 ATGGAAATGCCTGGATGTGTGGG + Intronic
1089198583 11:116710035-116710057 ATGCATTAGCCTGGCTGGGTGGG - Intergenic
1092144600 12:6205791-6205813 CTGGGTGAGCCTGGCTGTGAGGG + Intronic
1096593941 12:52682213-52682235 CTGAATCGGGCTGGCTGTGTCGG + Intergenic
1098780183 12:74676789-74676811 GTGGATTTGCAGGGCTGTGGTGG - Intergenic
1099643802 12:85324696-85324718 GTTGATTTGCATGGCTGTTTGGG + Intergenic
1100293268 12:93236990-93237012 CTGGAATTGGCTGGGTGTGGTGG - Intergenic
1100613979 12:96216519-96216541 CTGGATTTCAGTGCCTGTGTGGG + Intronic
1101597258 12:106178242-106178264 CTGGATTTCCCAGGCTGCCTCGG + Intergenic
1102232568 12:111273733-111273755 CAGGATTGGCCTGGCTCTGCAGG - Intronic
1102449108 12:113027328-113027350 CTGGTTTTGGCTGGGTGTGGTGG - Intergenic
1103706311 12:122875360-122875382 CTGTATTTGTCTGGGTGTGGTGG - Intronic
1103840173 12:123857235-123857257 CTGGCTTTACCTGGATGGGTAGG - Exonic
1104026291 12:125029128-125029150 CTGGAATTGTATGGATGTGTTGG + Exonic
1104435612 12:128754098-128754120 CTGGATTTGCATGTCTTTGGCGG - Intergenic
1105037338 12:132935378-132935400 CTGGATTTATATGGGTGTGTGGG + Intronic
1105566087 13:21549565-21549587 CTGAATTTGGCTGTCTGGGTTGG + Intronic
1107856315 13:44618651-44618673 CTGGATTGCCCAGCCTGTGTGGG + Intergenic
1111704407 13:91730602-91730624 CTGAAGTTTCATGGCTGTGTGGG - Intronic
1112106738 13:96248636-96248658 CTGGATTTGGATGGCTATGCAGG + Intronic
1113259824 13:108549317-108549339 CTGGATGTGCCTGCATTTGTTGG - Intergenic
1113864041 13:113509388-113509410 CTGGAGCTGCCTGTCTATGTTGG + Intronic
1118113756 14:62751473-62751495 TTGGACTTGCCTGGCTATTTCGG + Intronic
1119526040 14:75323317-75323339 CTGGTCTTGCAGGGCTGTGTTGG - Intergenic
1121402034 14:93688461-93688483 CTGGATCTTTCTGGCTTTGTAGG + Intronic
1122892697 14:104740334-104740356 GTGCATTTGCGTGGGTGTGTGGG - Intronic
1123004299 14:105314216-105314238 CTGGGTTGGCCCGGCTGTGCGGG - Exonic
1123448096 15:20344086-20344108 CTGGATCTGGCTGGCTGGCTTGG - Intergenic
1123783043 15:23645757-23645779 CTGGATTTGCACGGCTTTTTGGG + Exonic
1124063048 15:26313141-26313163 CTGGATTAGGCTGGGTGTGGTGG - Intergenic
1124126111 15:26939295-26939317 CTGGATTTGCCTGGCTGTGTGGG - Intronic
1126384844 15:48083612-48083634 CTGGAGTTGCCTCACTGTGAAGG + Intergenic
1127095925 15:55512306-55512328 CTGGATTATACTGGCTATGTGGG - Intergenic
1129735435 15:77958881-77958903 TTGGATTTCCCCTGCTGTGTTGG - Intergenic
1130107919 15:80942923-80942945 CTGGATTGCTCTGGCTCTGTAGG + Exonic
1131893893 15:97004853-97004875 GTTGATTTGCCTCTCTGTGTAGG + Intergenic
1132141610 15:99401634-99401656 CTGGTTTTGCCGGTCTGGGTGGG - Intergenic
1132574047 16:656628-656650 CTGGACTTTCCAGCCTGTGTCGG + Intronic
1132659432 16:1054889-1054911 CAGGACTTGCCTGGCTGGGCCGG - Intergenic
1132660068 16:1057385-1057407 CTGGAAATGCCTGGCAGAGTGGG + Intergenic
1133424452 16:5675675-5675697 ATGGATTTGCAAGGCTGTGCTGG + Intergenic
1134322506 16:13176562-13176584 CTGGGTCTGTCTGGCTGTTTTGG - Intronic
1134388294 16:13794746-13794768 TTGGATTCTCCTGGCTGTTTTGG + Intergenic
1135526181 16:23215280-23215302 CTGGATTGTCCTGGCCCTGTGGG - Exonic
1136287539 16:29253310-29253332 CTGGACCTTCCTGGCTGTCTCGG + Intergenic
1137253765 16:46758782-46758804 CTGGAACTCCCTGGCTCTGTGGG + Intronic
1138405319 16:56788250-56788272 CAGGATGTGCCAGGCTGTGGTGG - Intronic
1138423304 16:56913888-56913910 ATGTATTTGCCTGGCTGTGGAGG - Exonic
1139041323 16:63002199-63002221 CTGGAAGTGCCTGGCTGTCCAGG + Intergenic
1139251656 16:65502303-65502325 CTGGTTTTGGGTGTCTGTGTGGG - Intergenic
1140065591 16:71608730-71608752 CTGCATATGCCTGGCTTTGCAGG + Intergenic
1140550162 16:75856630-75856652 CAGGATCTGGCTGGCTGTTTTGG - Intergenic
1142176833 16:88649316-88649338 CTGGGTTTGTCTGTCTGCGTCGG + Intronic
1142193970 16:88731070-88731092 CTGGATTTGCGTGGCTGTCCTGG - Intronic
1142227953 16:88886551-88886573 CTGCATTTCCCCAGCTGTGTTGG - Intronic
1142402584 16:89868270-89868292 CTGGCTTTGATTGGATGTGTTGG + Intronic
1142779201 17:2167669-2167691 CTGGATCTCCCAGGCTGTGTTGG + Intronic
1144783069 17:17817448-17817470 CTGGCTTTGCCTGGTGGGGTTGG + Exonic
1145018084 17:19411790-19411812 CTGGATCCGCCAGGCTGTGGAGG + Intronic
1145411264 17:22668295-22668317 CTGGATTTGCCTGGTCATCTAGG + Intergenic
1145998492 17:29117826-29117848 CTGGACTTAGCTGGCTGTGCTGG - Intronic
1146676275 17:34775668-34775690 GGGGATTTGCCTTGCTGCGTGGG + Intergenic
1147839432 17:43360619-43360641 TTGGATTTACGTGGCTTTGTGGG - Intergenic
1147839758 17:43362838-43362860 TTGGATTTACGTGGCTTTGTGGG - Intergenic
1150487917 17:65556742-65556764 CTGGATTTCCCTTTCTCTGTAGG - Intronic
1153334154 18:3904927-3904949 CTGAATATGCATGGCTTTGTAGG + Intronic
1156575814 18:38313775-38313797 ATGGCTTGCCCTGGCTGTGTGGG + Intergenic
1157191435 18:45585599-45585621 CTGGATCTGCCTTGCAGGGTGGG - Intronic
1157485034 18:48080767-48080789 CTGGGGTTGCCTGGCCTTGTGGG - Intronic
1158593432 18:58796251-58796273 CTGTCTTTGCCTGCCTTTGTTGG - Intergenic
1159025280 18:63177846-63177868 CTGGATCTGCCTCCCTGTGGTGG + Intronic
1159788773 18:72750206-72750228 AGGGGTTTTCCTGGCTGTGTGGG + Exonic
1160298006 18:77655330-77655352 GTGGATTTAACTGGCTGTGGAGG - Intergenic
1161007693 19:1944678-1944700 CTTGACTGGCCTGGCTGGGTGGG + Intronic
1162149672 19:8636122-8636144 CTGGTTTTGGCTGGGTGTGGTGG - Intergenic
1162710559 19:12590743-12590765 CTATATTTGTGTGGCTGTGTAGG - Intronic
1162812033 19:13170071-13170093 TGGGGTGTGCCTGGCTGTGTGGG - Intergenic
1163682197 19:18689308-18689330 CAGGATTCGCCTCACTGTGTAGG - Intronic
1164413636 19:28026911-28026933 CTGAGTTTTCCTGGCTGTGATGG - Intergenic
1165831285 19:38731740-38731762 CTGGGTTTGTCTGGCCGTGTGGG - Intronic
1166002732 19:39887641-39887663 GTGGATTTACCAGGCTTTGTTGG - Intronic
1166005519 19:39903893-39903915 GTGGATTTACCAGGCTTTGTTGG - Intronic
1166701892 19:44886894-44886916 CTGAATTTACCTGGATGTGGTGG + Intronic
1168137401 19:54360636-54360658 CTGGCTCTGCTTGGCTGGGTGGG - Intronic
1168160676 19:54508446-54508468 CTGGCTCTGCTTGGCTGGGTGGG + Intronic
927807947 2:26164800-26164822 CTGGCTGTGCCCTGCTGTGTAGG + Intergenic
928329870 2:30349428-30349450 CTGGCATTACCTGGCTGTGGTGG + Intergenic
932336945 2:70937056-70937078 CTGGCTTTGCATAGCTGTGGCGG - Intronic
932569448 2:72930718-72930740 CCAGAGTTGCCTGGCTGGGTTGG + Intronic
933299414 2:80525378-80525400 CTGGATTTCCCCTTCTGTGTTGG + Intronic
933567556 2:83969372-83969394 GAGGATTTGCCTTGCTGGGTTGG + Intergenic
933802685 2:85975749-85975771 CTGGATTTGTCTGCCAGTGCTGG - Intergenic
936593148 2:113822631-113822653 CTCAATTTGCCTGGCACTGTGGG - Intergenic
938256877 2:129866085-129866107 TTTCATTTTCCTGGCTGTGTGGG - Intergenic
938421945 2:131153354-131153376 CTGGCTTTGCATGGCTCTCTGGG + Intronic
939762025 2:146194326-146194348 CTTGATTTGCATGACTTTGTGGG - Intergenic
940817686 2:158313845-158313867 CTGGATTTACCAGGCTATTTTGG - Exonic
943230474 2:185244352-185244374 CTGTAGATGCCTGGCTGTTTAGG - Intergenic
943352889 2:186816495-186816517 TAGGATTTTCTTGGCTGTGTGGG - Intergenic
943380837 2:187144755-187144777 ATGGGCTTTCCTGGCTGTGTAGG - Intergenic
944889090 2:204098458-204098480 CTTGATTTCCCTGACTGCGTGGG + Intergenic
945634158 2:212326033-212326055 CAAGATTTGGCTGGCTGTTTGGG - Intronic
946043382 2:216801681-216801703 CTGGTTTGGCCTGGCCTTGTTGG + Intergenic
946414585 2:219533476-219533498 CAGGAGTTGACGGGCTGTGTGGG - Intronic
948662380 2:239515384-239515406 CTGGATGGGGCTGGCTGGGTGGG - Intergenic
948827273 2:240578765-240578787 CTGCATCTTCCTGGCTGTGTAGG + Exonic
1168804779 20:665961-665983 CTGAATCAGCCAGGCTGTGTGGG - Intronic
1169282224 20:4277673-4277695 ATGGATTTGACTGGTTGTTTTGG + Intergenic
1170022080 20:11847561-11847583 CTGGATTTGTCTGATTGTGGAGG - Intergenic
1170463489 20:16601135-16601157 CTGCATGTGCCTGGGTGTGTGGG - Intergenic
1171071153 20:22069832-22069854 CTGGACTCTCCTGGCAGTGTGGG + Intergenic
1171986297 20:31663827-31663849 CTGGACTGGCCTTGCTGGGTTGG + Intergenic
1172268008 20:33633690-33633712 CTGGTTTCCTCTGGCTGTGTGGG + Intronic
1172522177 20:35574993-35575015 CTGGATGTGGCTGGGTGTGGTGG - Intergenic
1173326307 20:42036821-42036843 CTGGATGTGCCTGGAGGTATAGG - Intergenic
1173393313 20:42654585-42654607 CTGGTATTGTCTGGATGTGTTGG - Intronic
1173496848 20:43525647-43525669 CTGAATTTGGCTGGGGGTGTTGG + Intronic
1175463950 20:59176976-59176998 CAGTATGGGCCTGGCTGTGTTGG - Intergenic
1175789522 20:61732648-61732670 CTGGACGTGCCTGGCTAGGTAGG - Intronic
1175904888 20:62374915-62374937 CTGGTGTTGGCAGGCTGTGTGGG - Intergenic
1177140235 21:17350608-17350630 GTAAATTTTCCTGGCTGTGTCGG - Intergenic
1178616940 21:34143101-34143123 CTGGCAGTGCCTGGCAGTGTCGG + Intergenic
1179489717 21:41733470-41733492 CTGGATATGCCTGGAGTTGTGGG + Intergenic
1179825877 21:43966262-43966284 CTGTGTCTGGCTGGCTGTGTGGG + Intronic
1181629592 22:24143606-24143628 CTGGCTGTGCCTGGCCTTGTTGG + Intronic
1183358000 22:37369709-37369731 CTGGGCTTGCCTGCCTCTGTTGG - Exonic
949138380 3:600428-600450 CAGGATTTCTCTGGCTTTGTGGG + Intergenic
950502296 3:13372239-13372261 CAGGCTTTGCCTGGCTGCCTTGG - Intronic
952172914 3:30829127-30829149 CGGGATTTGCGTGGCTGTTTTGG - Intronic
952416175 3:33093193-33093215 CTGGATCTGCTTGGCTGGGGTGG - Exonic
954973324 3:54670251-54670273 CAGGATTTTCCAGGCTGTGTCGG + Intronic
956815945 3:72908415-72908437 CTGGATCCACCTGGCTGTGGTGG + Exonic
962500502 3:135986391-135986413 CTGGATTTAACTGGCTCTGTGGG - Intronic
962642339 3:137400557-137400579 CTGGCTTTGCCTAGCTGCGGTGG + Intergenic
963008484 3:140748449-140748471 CTGACCTTGCCTGGCTTTGTTGG - Intergenic
963801409 3:149679667-149679689 CTGGTTTTACCTTTCTGTGTTGG - Intronic
964013432 3:151917956-151917978 GTGGATTTGCAGGGCTGTGATGG + Intergenic
964392516 3:156212526-156212548 CTGGATGTTACTGGCTATGTGGG + Intronic
964408328 3:156373212-156373234 GTGGATTTGCCCTGTTGTGTTGG - Intronic
966234716 3:177687694-177687716 TTGGATTTGCCTGGATCTGAGGG - Intergenic
967118476 3:186362250-186362272 CTGGACTTGCCAGGCTGCGAGGG - Intergenic
968490556 4:888651-888673 AGGGATCTGCCTGGCTCTGTGGG + Intronic
968954704 4:3712279-3712301 CTGGATTTTGATGTCTGTGTAGG - Intergenic
969670793 4:8589156-8589178 CTGGTTTTGGCTGGGTGTGGTGG - Intronic
970463844 4:16303899-16303921 CTGGACTTGCCTGGGTCTATGGG - Intergenic
971342830 4:25786483-25786505 CTGGATTTGCCTCTCCCTGTAGG + Intronic
973577474 4:52304967-52304989 CTGGAGTTGGCTGGCTGGATAGG + Intergenic
974196373 4:58581073-58581095 TAGGATTTGCTTGGCTATGTGGG + Intergenic
977345596 4:95812287-95812309 GTGTGTTTGCGTGGCTGTGTAGG + Intergenic
979529177 4:121750679-121750701 CTGCCTTTGTCTGGCTGAGTTGG - Intergenic
981271119 4:142847376-142847398 CTGGTTATTCCGGGCTGTGTAGG + Intronic
981297477 4:143148647-143148669 CTGAATTTGACTGTCTGTCTGGG + Intergenic
982125503 4:152180620-152180642 CTGGAATTGTCAGGCTGTGAGGG - Intergenic
982728982 4:158935281-158935303 CTGCATTTTCAAGGCTGTGTGGG - Intronic
984153386 4:176163187-176163209 CTGGAGTTGGCAGTCTGTGTGGG + Exonic
985699805 5:1363833-1363855 CTGATTTTGAATGGCTGTGTGGG + Intergenic
985805013 5:2037200-2037222 CTGGTTTTCCCTGGCAGTGAAGG + Intergenic
986869040 5:12025729-12025751 CTGGATGTGAGTGACTGTGTAGG - Intergenic
987002029 5:13669348-13669370 CTCTATTTCCCTGGCAGTGTAGG - Intergenic
990796059 5:59542231-59542253 CAGGATTTGGGTGGCTGTGAGGG - Intronic
992307480 5:75457738-75457760 CTGGTTTTTCTTGGGTGTGTGGG + Intronic
993757900 5:91754010-91754032 CAGGAGTTGAATGGCTGTGTCGG - Intergenic
993801794 5:92351620-92351642 ATGGAATTGCCTGGATGTCTAGG + Intergenic
995588302 5:113672054-113672076 CTGTATTTGCCTGACAGTGGAGG + Intergenic
995607158 5:113869336-113869358 ATGGATTTGGCTGGGTGTGGTGG - Intergenic
997173292 5:131747412-131747434 CTGGTTTAGCCTGGATGTCTAGG - Intronic
997623814 5:135318386-135318408 GTGGACTTGCCTGGGTGTGGTGG + Intronic
997857005 5:137381481-137381503 ATGGACTTGCCTGGATGTTTAGG - Intronic
1000979997 5:167806613-167806635 GTGGATTTCCCTGACTCTGTAGG - Intronic
1001155520 5:169269442-169269464 GAGGATCTGCCTGGCTGTTTGGG - Intronic
1001710287 5:173772898-173772920 CTGTTGTTGGCTGGCTGTGTGGG - Intergenic
1001754919 5:174160910-174160932 CTGATTGTGGCTGGCTGTGTGGG + Intronic
1009346105 6:62614380-62614402 ATGGATATGCCTGGCTGTACAGG + Intergenic
1011565094 6:88665302-88665324 CTGGTTTTGCCTGACTGGCTGGG - Intronic
1012064878 6:94537512-94537534 ATGGAATTGCCTGGATGTCTAGG - Intergenic
1012182878 6:96176805-96176827 GTGGAGCTGCCTGGCTGTCTTGG + Intronic
1013733634 6:113200846-113200868 CTGGTTTTGCCTGACTCTGGAGG - Intergenic
1013936391 6:115600586-115600608 ATGCATATGCCTGGATGTGTGGG + Intergenic
1015785221 6:136916319-136916341 CTGGATCTCCCTGGGTGTGATGG - Intergenic
1018338927 6:162829075-162829097 ATGGATTTGCTTGGCTATTTAGG - Intronic
1018999188 6:168734072-168734094 CAGGATGTGCATGGCAGTGTTGG - Intergenic
1019438185 7:1032455-1032477 CTGGGGGTGCCTGGCGGTGTGGG - Intronic
1019438203 7:1032511-1032533 CTGGGGGTGCCTGGCGGTGTGGG - Intronic
1019438221 7:1032567-1032589 CTGGGGGTGCCTGGCGGTGTGGG - Intronic
1023291085 7:38669780-38669802 ATGCATTTGCCTGGCTGAATGGG - Intergenic
1023512768 7:40970749-40970771 GAGCATTTGCCTGGCTGGGTGGG + Intergenic
1024853729 7:53752292-53752314 CTGGATTTGCCTGCCTCCTTTGG - Intergenic
1025293908 7:57760689-57760711 CTGGATTTGCCTGGTCATCTAGG + Intergenic
1030600336 7:111584692-111584714 GTGGCTTTGCCTGGCTGAGCAGG - Intergenic
1030651208 7:112117996-112118018 ATGGATTTTCCTGGCTCTGGAGG - Intronic
1030746824 7:113175823-113175845 CTGGATTTTCCTGGGGGTGGGGG - Intergenic
1030873574 7:114786625-114786647 CTGGATTGACCTGGCTCTGTAGG + Intergenic
1033585613 7:142772381-142772403 ATGGATTTGCCTGGGTGTGAGGG - Intergenic
1035916513 8:3630531-3630553 TTGGCTTTGCCTGGGTCTGTAGG - Intronic
1036994220 8:13636066-13636088 CTGGGTTTGCCTTCCTGTCTAGG - Intergenic
1037099833 8:15031621-15031643 CTGGAGTTGACTGCCAGTGTGGG - Intronic
1037405365 8:18536957-18536979 CAGAATTTGCCTGCCTTTGTTGG - Intronic
1038455903 8:27671861-27671883 CTGGGTTTCCCTGGCTGGGCAGG + Exonic
1038469427 8:27800881-27800903 CTGGATTTGCCTGCCTCTTATGG - Intronic
1038517396 8:28199149-28199171 CTGGATTCTCCTGACTGAGTGGG - Intergenic
1039456061 8:37707695-37707717 CTGGCTGTGCCTGTGTGTGTTGG + Intergenic
1040705864 8:50126281-50126303 TTGGTTGTGCCAGGCTGTGTAGG + Intronic
1040753304 8:50738588-50738610 TAGGATTGTCCTGGCTGTGTGGG - Intronic
1041043576 8:53870679-53870701 CTGGCTAAGCTTGGCTGTGTCGG + Intronic
1044368691 8:91382350-91382372 ATGGATTTGTCTGGCTGGGATGG - Intronic
1046464098 8:114580234-114580256 CTGTTTTTGCCTGGCTGTCTTGG - Intergenic
1047491918 8:125382162-125382184 CTTGATCTGCCTGGCTCAGTGGG - Intergenic
1047638663 8:126794840-126794862 CTGCATTTGCCTGTGTTTGTTGG - Intergenic
1047729449 8:127714847-127714869 TTGGATTTGGCTGGGTGTGGTGG - Intergenic
1047729480 8:127715046-127715068 TTGGATTTGGCTGGGTGTGGTGG - Intergenic
1048214590 8:132482384-132482406 CTGGATTTGCCTGGAGAAGTTGG + Intergenic
1048549767 8:135423670-135423692 ATGGATTTCTCTGGCTGAGTGGG - Intergenic
1049688602 8:143949195-143949217 CAGGATTTGCCAGGGTGTGGGGG - Intronic
1049959808 9:727601-727623 CTGGATTAGCCTGGGCGTGGTGG - Intronic
1056034001 9:82584562-82584584 CTGGCTGTGCCTGGCAGTGGTGG - Intergenic
1056911711 9:90707017-90707039 CTGGATATGGCAGCCTGTGTTGG + Intergenic
1057158836 9:92870464-92870486 CTGTATTTGCCTGGCTGCCTGGG + Intronic
1057777698 9:98024315-98024337 CTGAATTTGGCTGGGTGTGGTGG - Intergenic
1058907556 9:109494182-109494204 CTGGATTTGGCTGGGTGCGGTGG + Intronic
1059446952 9:114344106-114344128 CTGACTTAGCCTGGGTGTGTTGG - Intronic
1062713849 9:137992881-137992903 CTGTATTTGCCTGGTTTTGTGGG - Intronic
1203618947 Un_KI270749v1:99921-99943 CAGGATTTCTCTGGCTTTGTGGG - Intergenic
1186290636 X:8093961-8093983 CGGCACTTGCCTGGCTGTGGCGG - Intergenic
1187676276 X:21719672-21719694 CTGGATTTGCCTCCCTGTAGAGG + Intronic
1188201709 X:27299927-27299949 GTGGCTTTGCCAAGCTGTGTTGG - Intergenic
1190281530 X:48934255-48934277 CTTGGTTTGCCTGTCTGAGTTGG - Intronic
1190314571 X:49142199-49142221 CAGGTTTTACCTGGCTGTGTTGG + Intergenic
1190425483 X:50331265-50331287 CTGGATTTTACTGGATATGTGGG - Intronic
1190525299 X:51323522-51323544 CTGGCTTTGCTTGTCTGTTTTGG - Intergenic
1194527013 X:94989501-94989523 ATGGAAATGCCTGGATGTGTAGG - Intergenic
1194798374 X:98240573-98240595 GAGGCTTTGCCTGGCTGTGGTGG + Intergenic
1197181819 X:123544781-123544803 CTGGAGTTGGCTGGGTGTGGTGG + Intergenic
1199292523 X:146120789-146120811 CAGAATTTGCTTGTCTGTGTAGG - Intergenic
1199616945 X:149663683-149663705 CTGGATATGCCTGGGTGAATGGG + Intergenic
1199625696 X:149739565-149739587 CTGGATATGCCTGGGTGAATGGG - Intergenic
1200015905 X:153163706-153163728 CTGCTTTTGTCTAGCTGTGTTGG + Intergenic
1200037340 X:153340413-153340435 CTGCACTTGCCTTGCTGTGTAGG + Intronic
1200212458 X:154352807-154352829 ATGTAGTTGCCTGGCTCTGTGGG + Exonic
1201051051 Y:9935784-9935806 CTGAAGTTGTCTGCCTGTGTTGG - Intergenic