ID: 1124126112

View in Genome Browser
Species Human (GRCh38)
Location 15:26939296-26939318
Sequence TCTGGATTTGCCTGGCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124126112_1124126120 27 Left 1124126112 15:26939296-26939318 CCACACAGCCAGGCAAATCCAGA 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1124126112_1124126117 -10 Left 1124126112 15:26939296-26939318 CCACACAGCCAGGCAAATCCAGA 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1124126117 15:26939309-26939331 CAAATCCAGAGAAGGCACTGGGG 0: 1
1: 0
2: 5
3: 25
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124126112 Original CRISPR TCTGGATTTGCCTGGCTGTG TGG (reversed) Intronic
900353453 1:2248209-2248231 TCTGCTTTGGCCTGGCTGGGTGG + Intronic
900465575 1:2823782-2823804 TCTGGCTGTGTCTGTCTGTGAGG + Intergenic
901193126 1:7424476-7424498 TAGGGATTTGCCTGCCTGAGAGG + Intronic
901221921 1:7588189-7588211 TAGGGATTTTCCTGGCTGAGAGG - Intronic
902778083 1:18687318-18687340 TCTGTCTTTCCCTAGCTGTGTGG - Intronic
902797689 1:18810052-18810074 TATGGATGTCCATGGCTGTGGGG - Intergenic
902871433 1:19315856-19315878 TCTGTAGTTTCCTGGCTGGGTGG + Intronic
903356574 1:22751794-22751816 TCTGGAGTTGCCTCGCTGCAGGG + Intronic
904559654 1:31387873-31387895 TGTGGATGTGTCTGGATGTGTGG - Intergenic
906522328 1:46474891-46474913 TCTTGCTGTGCCTGGCTGAGCGG - Intergenic
906789382 1:48645278-48645300 TCTGGCTTTATCTGACTGTGTGG + Intronic
907800641 1:57761867-57761889 TCTGCATCTCCCTGGCTGTCTGG - Intronic
908870049 1:68600000-68600022 TTTGGATGTGCTGGGCTGTGGGG + Intergenic
909671850 1:78198313-78198335 ACTGGAGCTGCCTGGATGTGGGG + Intergenic
909950655 1:81716193-81716215 TCTGGATATGGCAGGCAGTGTGG + Intronic
910006320 1:82401324-82401346 TCTGAGTTTGCCTTCCTGTGAGG - Intergenic
910401009 1:86838187-86838209 TATTAATTTCCCTGGCTGTGTGG - Intergenic
913253813 1:116936320-116936342 TCTTGATTTGCATGGATGAGGGG + Intronic
913551242 1:119918954-119918976 TATGGATTGGCCTGACTGTATGG - Intronic
914810537 1:151024511-151024533 TCTGCATTTTCCTTGATGTGTGG + Intronic
915537175 1:156543911-156543933 TCTAGACCTGCCTGGCTCTGTGG + Intronic
916098563 1:161373429-161373451 TCTGGCTTTGCCTAAATGTGTGG + Exonic
916365017 1:164016815-164016837 TCAGGATTTCCCTGGTTTTGTGG - Intergenic
916477205 1:165181357-165181379 TCTGTATTTGCATGGAGGTGGGG + Intergenic
916935425 1:169623281-169623303 TAGGGATTTCCCTGGCTTTGGGG + Intronic
917077518 1:171220693-171220715 TCTTGGTGTGCCTGGCTGTCTGG - Intergenic
918263708 1:182820348-182820370 TCTTGGTGAGCCTGGCTGTGAGG + Intronic
919810260 1:201404941-201404963 TATGGCTTTGCCTGGCAGTCAGG - Exonic
921499242 1:215880522-215880544 AGAGGATTTGCCTGGATGTGGGG + Intronic
924476604 1:244387559-244387581 TCTGCCATTTCCTGGCTGTGTGG + Intronic
924613967 1:245597341-245597363 TCAGCATTTGCCTGTCTGTAAGG + Intronic
1063134182 10:3201998-3202020 TCTAGTGTTGCCCGGCTGTGGGG - Intergenic
1063768811 10:9174549-9174571 TCTGCATTTCACTGGCTGTGTGG + Intergenic
1065102712 10:22346183-22346205 ACTGGAATTGCTTTGCTGTGAGG - Intronic
1065418317 10:25513810-25513832 TATGTATTTGCATGGCTTTGGGG + Intronic
1065468852 10:26055403-26055425 TCTGTATTTTCCTACCTGTGGGG - Intronic
1066291762 10:34020864-34020886 TCTGGGTGTGTCTGGGTGTGAGG + Intergenic
1066550235 10:36547810-36547832 TGTAGGATTGCCTGGCTGTGTGG - Intergenic
1066646945 10:37619688-37619710 TGTGGAGTTGCATGGCAGTGTGG + Intergenic
1067225466 10:44373386-44373408 TCTGGAGCTGGCTGGGTGTGGGG - Intronic
1067840054 10:49668573-49668595 TGTGGATTTTCATGGCTATGAGG - Intergenic
1068284660 10:54918934-54918956 TTTGGATTAGACTGGCTGGGTGG + Intronic
1068302314 10:55160348-55160370 TCTGGATTTGTCTTGGTGGGAGG + Intronic
1068911150 10:62379719-62379741 ACTGCATCTGCCTGGCTGGGTGG + Intronic
1070801012 10:79244325-79244347 TCAGGAGATGCCTGGTTGTGAGG + Intronic
1072051006 10:91702832-91702854 TCTGGTTTCCCCTGGCTGTGTGG - Intergenic
1073101191 10:101007530-101007552 TCTGGCTTTCTCTGGCTTTGGGG - Exonic
1073694404 10:105849066-105849088 TCTGAAATTTCCAGGCTGTGGGG - Intergenic
1073871707 10:107872049-107872071 TGTGGACTTACCTGGCTGTGAGG - Intergenic
1074780521 10:116798928-116798950 TGTGGATGGGTCTGGCTGTGCGG - Intergenic
1076348859 10:129800969-129800991 TGTGGAGTTGCCTGGGTATGTGG + Intergenic
1076563286 10:131381415-131381437 TCCGCCTTTGCCTAGCTGTGTGG + Intergenic
1076568460 10:131414743-131414765 TCTGGCTTTGCCTGCCTCGGAGG - Intergenic
1076694505 10:132240655-132240677 TCCGCATTTCCCAGGCTGTGGGG - Intronic
1077739957 11:4834691-4834713 TCTGCCATTTCCTGGCTGTGTGG + Intronic
1080623417 11:34006911-34006933 TATGGAGGTGCCTGGCTTTGGGG + Intergenic
1080772865 11:35358518-35358540 TCTGTATTTGCTTGGCAGTGTGG - Intronic
1081613357 11:44576641-44576663 TCTGCTGCTGCCTGGCTGTGTGG + Intronic
1081637869 11:44732774-44732796 TCTGCAATTTACTGGCTGTGTGG + Intronic
1082563066 11:54642218-54642240 TGGGGACTTGCCTGGCTCTGGGG + Intergenic
1084783666 11:71429116-71429138 TCTTGATGATCCTGGCTGTGGGG + Intronic
1084979902 11:72823476-72823498 TCTTGATTTGCCTGTCATTGAGG + Intronic
1085240301 11:75047738-75047760 TATGTATTTGCCTGGTTTTGAGG + Intergenic
1085265523 11:75235835-75235857 TCTGCTGTTGGCTGGCTGTGTGG - Intergenic
1085461529 11:76696804-76696826 TCTGGATATCCTTGGCTCTGTGG - Intergenic
1086586169 11:88455091-88455113 TCTGGATTTTGCTGGCCATGTGG - Intergenic
1086670198 11:89537077-89537099 TCTGGATATGCCTTGCTTTTTGG - Intergenic
1088453686 11:110010790-110010812 GCTGATTTTTCCTGGCTGTGTGG - Intergenic
1089150208 11:116358343-116358365 TCTGGCCTTGCTTGCCTGTGGGG - Intergenic
1089749752 11:120642600-120642622 TCTTGACTTTCCAGGCTGTGAGG + Intronic
1090357091 11:126147315-126147337 TCTAGAGTTGCGTGGCAGTGTGG - Intergenic
1090743032 11:129683529-129683551 TGTAGAATTGCCTGGTTGTGGGG + Intergenic
1090923116 11:131224768-131224790 TCCAGCCTTGCCTGGCTGTGCGG - Intergenic
1091423588 12:365474-365496 TCAGGAATTGCCTGTGTGTGGGG + Intronic
1092004457 12:5057393-5057415 TCTGCATTTCCCCAGCTGTGCGG - Intergenic
1092144599 12:6205790-6205812 CCTGGGTGAGCCTGGCTGTGAGG + Intronic
1092182072 12:6452826-6452848 CCTGGATTTGCCTTGCTCAGAGG - Intronic
1095612538 12:44147026-44147048 TCTGACTTTTCCTGGCTCTGTGG + Intronic
1096255131 12:50057986-50058008 TCTGGATTTCCCTTGCTGCTGGG + Intronic
1097958221 12:65507806-65507828 TCTGATTTTGTCTGGCTCTGGGG + Intergenic
1099643801 12:85324695-85324717 TGTTGATTTGCATGGCTGTTTGG + Intergenic
1099800788 12:87454156-87454178 TCTGTATTTGGCTTTCTGTGGGG - Intergenic
1100967399 12:100027760-100027782 TCTGGATTTGCTTTGGTGTGAGG + Intergenic
1101606288 12:106249000-106249022 TCTGGTATTGCCAGGCTGTGTGG + Intronic
1102783357 12:115584498-115584520 TCCTGATTTGCCTGGCTGTACGG + Intergenic
1102863301 12:116354960-116354982 TCTGACTTTGCCTTGCTGGGAGG - Intergenic
1103027432 12:117584893-117584915 TCTGCAGGTGCCTGGCTGTGTGG - Intronic
1104782750 12:131432415-131432437 TCTGCCTTAGCCTCGCTGTGTGG - Intergenic
1104918249 12:132277614-132277636 CCTGGAGCTGCCAGGCTGTGAGG - Intronic
1106588085 13:31074404-31074426 TCTTCATTTGCCAGGCAGTGGGG - Intergenic
1106704064 13:32261780-32261802 CCAGGATCTGGCTGGCTGTGAGG - Exonic
1108411609 13:50154158-50154180 TCTGGAATTCTGTGGCTGTGTGG + Intronic
1110324194 13:74195312-74195334 TCAATATTTTCCTGGCTGTGAGG - Intergenic
1111704408 13:91730603-91730625 TCTGAAGTTTCATGGCTGTGTGG - Intronic
1112531987 13:100213696-100213718 TGTTGATTTCCTTGGCTGTGTGG + Intronic
1113542776 13:111122018-111122040 CCTGGATTTGGATGGCTCTGAGG - Intronic
1114892128 14:26937887-26937909 TCTGGCTTTACATGTCTGTGGGG + Intergenic
1115758813 14:36557374-36557396 TCTGCAGTTGCCTGGCTTCGCGG - Intergenic
1116271903 14:42781030-42781052 TTAGGATTTTCCTGGCTATGCGG + Intergenic
1116369328 14:44109721-44109743 GCTGGAATAGCCTGGATGTGAGG - Intergenic
1118441615 14:65817045-65817067 TCAGGATTTACCTGTCTGGGTGG - Intergenic
1119075295 14:71632237-71632259 TCTGGAATGGCATAGCTGTGAGG + Intronic
1119467856 14:74873488-74873510 TCTGGAGTTCTATGGCTGTGGGG - Intergenic
1119652058 14:76391012-76391034 TCTGGAAATGCTGGGCTGTGCGG + Intronic
1119892230 14:78191577-78191599 TCTAGAGTTGCTTGGCTGTGTGG + Intergenic
1120148097 14:81001745-81001767 TCTTGATTTGCCTGATTTTGAGG + Intronic
1120148279 14:81003592-81003614 TCTTGATTTGCCTGATTTTGAGG + Intronic
1120725724 14:87938135-87938157 TCTTGCTCTGCCTGGCTGTCAGG + Intronic
1121239062 14:92414941-92414963 TCTGGAATTGTGTCGCTGTGAGG + Intronic
1121569695 14:94937671-94937693 TCTGTATGTGCGTGTCTGTGTGG + Intergenic
1122060505 14:99133894-99133916 TCTGGATGGGTCTGGCTGGGAGG - Intergenic
1122575139 14:102737298-102737320 TCTTGATGGGACTGGCTGTGGGG + Intergenic
1122771640 14:104100296-104100318 TCTGGGCATGTCTGGCTGTGGGG + Intronic
1122892698 14:104740335-104740357 TGTGCATTTGCGTGGGTGTGTGG - Intronic
1123004300 14:105314217-105314239 GCTGGGTTGGCCCGGCTGTGCGG - Exonic
1123585451 15:21756369-21756391 TTTAGATGAGCCTGGCTGTGTGG - Intergenic
1123622092 15:22198957-22198979 TTTAGATGAGCCTGGCTGTGTGG - Intergenic
1124126112 15:26939296-26939318 TCTGGATTTGCCTGGCTGTGTGG - Intronic
1125294877 15:38191633-38191655 TCTGTATCTGCCTGGCTGGCTGG + Intergenic
1125768837 15:42152058-42152080 TCTGGACTTCCCTGCCTGGGTGG + Intronic
1128426295 15:67544922-67544944 TCTGTATGTGCATGACTGTGTGG - Intronic
1128532193 15:68462026-68462048 TCTGAGTGTGCCTGGCTGAGAGG - Intergenic
1129256933 15:74339014-74339036 TCATGATTTGCCTGGGTCTGAGG - Intronic
1130887410 15:88105480-88105502 TCTGGGACTGCATGGCTGTGTGG - Intronic
1132720128 16:1311658-1311680 CCTGGCCTTGCCTGGCTGTGAGG + Intronic
1132986458 16:2770044-2770066 GCTGGATGTGCGTGGCTCTGGGG - Intronic
1135415564 16:22265946-22265968 TCTGGATTTGGTTGGGGGTGGGG - Intronic
1135477995 16:22794557-22794579 TCTGGATTTCCCTAGCTGCAAGG + Intergenic
1135645227 16:24155826-24155848 TCTGGATTTCACTGACTGTACGG + Intronic
1135971104 16:27072608-27072630 TGTTTATGTGCCTGGCTGTGTGG + Intergenic
1136684165 16:31984323-31984345 TCTGCATGTGCATGCCTGTGAGG + Intergenic
1136693683 16:32056581-32056603 TTTAGATGAGCCTGGCTGTGTGG + Intergenic
1136784793 16:32927875-32927897 TCTGCATGTGCATGCCTGTGAGG + Intergenic
1136794173 16:32999816-32999838 TTTAGATGAGCCTGGCTGTGTGG + Intergenic
1136834444 16:33491653-33491675 GCTTGGTTTGCCTGGCTGTCTGG + Intergenic
1136875736 16:33854563-33854585 TTTAGATGGGCCTGGCTGTGTGG - Intergenic
1136884990 16:33925931-33925953 TCTGCATGTGCATGCCTGTGAGG - Intergenic
1139251657 16:65502304-65502326 TCTGGTTTTGGGTGTCTGTGTGG - Intergenic
1140035531 16:71368593-71368615 TCTGGTCCTCCCTGGCTGTGTGG + Intronic
1203010359 16_KI270728v1_random:232384-232406 GCTTGGTTTGCCTGGCTGTCTGG - Intergenic
1203096437 16_KI270728v1_random:1261497-1261519 TTTAGATGAGCCTGGCTGTGTGG + Intergenic
1142923561 17:3212735-3212757 CCTTGATTTCCTTGGCTGTGAGG - Intergenic
1143967139 17:10763831-10763853 TCTGGCTCTGTCTGACTGTGGGG + Intergenic
1144031205 17:11324988-11325010 TCAGGGTTTGCTTGGTTGTGAGG - Intronic
1145724903 17:27110294-27110316 TCTGGATTTGTCTTGGTGGGAGG - Intergenic
1146683358 17:34824322-34824344 TCTGCCTCTTCCTGGCTGTGTGG - Intergenic
1147530334 17:41270546-41270568 TCTTGATTTGTCTGGGAGTGAGG - Intergenic
1147839433 17:43360620-43360642 TTTGGATTTACGTGGCTTTGTGG - Intergenic
1147839759 17:43362839-43362861 TTTGGATTTACGTGGCTTTGTGG - Intergenic
1147841763 17:43376884-43376906 AGTGGATTTGCCTGGCACTGAGG - Intergenic
1148230511 17:45930589-45930611 TCTGTAATTTACTGGCTGTGTGG - Intronic
1150163240 17:62916901-62916923 TCTGGATTTCCATGCCTGTGAGG - Intergenic
1150220670 17:63494115-63494137 TCTGCATGTGCCTGGGTGTCTGG + Intronic
1150333359 17:64312187-64312209 TCTGCAATTCCATGGCTGTGTGG - Intergenic
1152285922 17:79413399-79413421 TCTGAATTTCCATGGATGTGGGG + Intronic
1152398984 17:80052649-80052671 GCTGGGTTTGCCTGTCTGTCCGG - Intronic
1154169949 18:12044192-12044214 TGTGGATGTGACTGGCTGTCAGG + Intergenic
1156306353 18:35881223-35881245 CCTTGATTTCCTTGGCTGTGAGG + Intergenic
1156438457 18:37158879-37158901 ACTGGATTTGCCTGGGTTTGGGG + Intronic
1157485035 18:48080768-48080790 TCTGGGGTTGCCTGGCCTTGTGG - Intronic
1157688522 18:49662298-49662320 CCTGGGCTTGACTGGCTGTGTGG - Intergenic
1158853198 18:61516308-61516330 TCTGGTTTTGCTAGGCAGTGGGG + Intronic
1158945875 18:62446629-62446651 TCTGGATTCTCTTGCCTGTGTGG + Intergenic
1159107775 18:64023490-64023512 GCTGTTTTTCCCTGGCTGTGAGG + Intergenic
1160491512 18:79340890-79340912 TCAGGGTTTGCCAGGCTGGGAGG - Intronic
1161497603 19:4596187-4596209 TCTGGCCTTGCCCGGCTGTGTGG - Intergenic
1163148782 19:15399257-15399279 TCTGCCTCTGCCTCGCTGTGGGG - Intronic
1164082391 19:21870192-21870214 TCTGGCTTGTCCTAGCTGTGTGG - Intergenic
1165101174 19:33439499-33439521 TCTGGTGTGGGCTGGCTGTGAGG + Intronic
1165831286 19:38731741-38731763 ACTGGGTTTGTCTGGCCGTGTGG - Intronic
1166562225 19:43740508-43740530 TCTGCCTCTTCCTGGCTGTGTGG + Intronic
1167478374 19:49713696-49713718 TCTTTATTGGCCTGGATGTGGGG - Exonic
928130407 2:28644926-28644948 TCTGGATTACTCTGGCAGTGTGG - Intergenic
928418061 2:31113301-31113323 TCAGGATCTGCCGGGCTGGGTGG + Intronic
931917067 2:66967891-66967913 TCTGCTTTCGTCTGGCTGTGAGG + Intergenic
932834922 2:75027313-75027335 TCTTGATTTGAGTGGCTGTGTGG + Intergenic
933094456 2:78161032-78161054 TCAGCATTTGCCTGTCTGTAAGG + Intergenic
934042521 2:88139977-88139999 TCTGCTGTTTCCTGGCTGTGTGG - Intergenic
934678164 2:96264918-96264940 TCCGGATTAACATGGCTGTGAGG + Intronic
936593149 2:113822632-113822654 TCTCAATTTGCCTGGCACTGTGG - Intergenic
938256878 2:129866086-129866108 TTTTCATTTTCCTGGCTGTGTGG - Intergenic
938585026 2:132682057-132682079 TCTGAATTGTCCTGGCTGTCAGG - Intronic
939062498 2:137439882-137439904 TTTCTATTTGCCTGACTGTGCGG - Intronic
939762026 2:146194327-146194349 TCTTGATTTGCATGACTTTGTGG - Intergenic
940660695 2:156541609-156541631 TCTTGAAATGCCTGGCTTTGAGG - Intronic
940925366 2:159357895-159357917 TCAGCATTTGCCTGTCTGTAAGG - Intronic
941165866 2:162082408-162082430 TATGGAGTTGCCTGGTTATGTGG - Intergenic
941997182 2:171611790-171611812 TCTGGCTTTCCTTGGCTGGGTGG - Intergenic
943352890 2:186816496-186816518 TTAGGATTTTCTTGGCTGTGTGG - Intergenic
943598902 2:189891124-189891146 TCAGCATTTGCTTGTCTGTGAGG + Intronic
943769483 2:191701023-191701045 TTTGTATTTGCCTGACTCTGCGG - Intergenic
944272677 2:197801390-197801412 TCTGGACTTCCCTGGCTGGAAGG + Intergenic
948051310 2:234981444-234981466 TGTGCACTGGCCTGGCTGTGAGG - Intronic
948120488 2:235526276-235526298 TCTGGATTCATCTGGCTGAGTGG - Intronic
948622820 2:239247174-239247196 TTTTGGTTTGCCCGGCTGTGCGG - Intronic
948662381 2:239515385-239515407 TCTGGATGGGGCTGGCTGGGTGG - Intergenic
948671870 2:239574121-239574143 TCTGGAATTTCCTAGCTGTGTGG + Intergenic
1168827417 20:823130-823152 TCTGGACCCGCCTGCCTGTGGGG + Intergenic
1168994461 20:2122564-2122586 TCTGCGTTTTCCTGACTGTGTGG + Intronic
1169706832 20:8515645-8515667 TCTGGTTGTGCATGGCTTTGAGG + Intronic
1169910997 20:10647320-10647342 TGTGGGTTTTCCTGGTTGTGTGG - Intronic
1170463490 20:16601136-16601158 ACTGCATGTGCCTGGGTGTGTGG - Intergenic
1171988564 20:31677971-31677993 TCTAGTTTTGCCAGGCAGTGAGG - Intronic
1172371456 20:34395625-34395647 TCAGGAGTTGCCTGGGTTTGTGG - Intronic
1174595376 20:51679352-51679374 TCTGGCTTTTCCTGGAAGTGTGG + Intronic
1175800012 20:61796246-61796268 TCTGGAGATTCCTGGCTGTGTGG - Intronic
1176952309 21:15063277-15063299 TCTGGTTTTGCCCGGCAGTTCGG - Intronic
1179489716 21:41733469-41733491 TCTGGATATGCCTGGAGTTGTGG + Intergenic
1181689396 22:24550052-24550074 TCTGTCTTTGCCAGGCTGTGAGG + Intronic
1182112430 22:27733009-27733031 TCTGCCCTTGACTGGCTGTGTGG + Intergenic
1183003233 22:34879156-34879178 TCTGGCTTTGCCTGCCTGTCTGG - Intergenic
1184097983 22:42326843-42326865 TCTGGAATCAGCTGGCTGTGTGG - Intronic
1184099946 22:42336715-42336737 TCTGAGTTTGTCTGGGTGTGGGG - Intronic
1184802032 22:46767172-46767194 TCTGGATGAGCCAGGATGTGTGG + Intronic
950688587 3:14637198-14637220 TCTGGGTTTGCCTCAGTGTGGGG - Intergenic
952750200 3:36818649-36818671 TCTGGAGTTGCTGGGCTGTCAGG - Intergenic
960163261 3:114373228-114373250 TCTTACTTTGACTGGCTGTGTGG + Intronic
961058601 3:123809842-123809864 TCTGGAATTTCCTTGCTGAGAGG - Intronic
961679724 3:128591279-128591301 TCTTGATTTTCCAGGATGTGTGG - Intergenic
961979548 3:131062590-131062612 TCAGTATTTGCCTGGGTTTGGGG - Intronic
962270962 3:133977861-133977883 ACTGGGTCTGCCTGACTGTGTGG - Intronic
962500503 3:135986392-135986414 ACTGGATTTAACTGGCTCTGTGG - Intronic
962665031 3:137645995-137646017 TTTGGTTTTGCTTGGTTGTGAGG + Intergenic
965536546 3:169829387-169829409 CCTGGATCTGCAGGGCTGTGAGG + Intronic
966123572 3:176549565-176549587 TCTGCAGTTGCCTGGCTGTTAGG + Intergenic
966234717 3:177687695-177687717 TTTGGATTTGCCTGGATCTGAGG - Intergenic
967118477 3:186362251-186362273 GCTGGACTTGCCAGGCTGCGAGG - Intergenic
969281939 4:6176688-6176710 CCAGGATTTGCCAGCCTGTGTGG + Intronic
969695649 4:8732799-8732821 TCTGGGGTTGCCTGACTCTGGGG + Intergenic
969997045 4:11324022-11324044 GCTGGATGTGCATGGCAGTGGGG - Intergenic
970445128 4:16116959-16116981 TCTGGATGTCTCTGGCAGTGTGG + Intergenic
971147616 4:23995959-23995981 TCTGGATTTGGCTTACTGTCAGG - Intergenic
972244093 4:37226293-37226315 TTTGGATTAGCCTGGCTCTTGGG - Intergenic
973734933 4:53862290-53862312 TCTGGATTTTCATGCCTGGGAGG + Intronic
974196372 4:58581072-58581094 TTAGGATTTGCTTGGCTATGTGG + Intergenic
977077505 4:92474727-92474749 TTTGGATTTGCTTTTCTGTGAGG + Intronic
980712812 4:136591889-136591911 TCTGGATCTGCCTGGGGCTGAGG + Intergenic
981864145 4:149394594-149394616 TCTCGATTTCCCTGGGGGTGAGG + Intergenic
982125504 4:152180621-152180643 TCTGGAATTGTCAGGCTGTGAGG - Intergenic
983889491 4:173016139-173016161 TATGGAAATGCCTGGCTGTCCGG + Intronic
986310344 5:6546558-6546580 AGTGGATGTCCCTGGCTGTGAGG - Intergenic
987219946 5:15780882-15780904 ACAGAATTTTCCTGGCTGTGTGG - Intronic
988430265 5:31111075-31111097 TCTGTATTTGCCTGGCATGGTGG + Intergenic
990796060 5:59542232-59542254 CCAGGATTTGGGTGGCTGTGAGG - Intronic
991570148 5:68045164-68045186 GCTGGATGTGCCTGGCTCTTAGG + Intergenic
992516880 5:77502796-77502818 TCAGCATTTGCCTGTCTGTAAGG - Intronic
995311320 5:110715672-110715694 TCTGGAGTGCCCTGGCTGAGAGG - Intronic
996710597 5:126539411-126539433 CCTGGAATTGCCAGGCTGTAAGG + Intergenic
996776176 5:127135028-127135050 TCTGGATGGGCCTGGTTCTGTGG - Intergenic
997206143 5:132051346-132051368 ACTGGCTGTGTCTGGCTGTGAGG + Intergenic
999314364 5:150574540-150574562 TCTGCCTCTCCCTGGCTGTGTGG + Intergenic
1000546527 5:162610292-162610314 GCAGGAGTTGCCTGGATGTGGGG - Intergenic
1001710288 5:173772899-173772921 TCTGTTGTTGGCTGGCTGTGTGG - Intergenic
1001754918 5:174160909-174160931 TCTGATTGTGGCTGGCTGTGTGG + Intronic
1001980791 5:176035874-176035896 TCTGGCATTGCATTGCTGTGGGG - Intergenic
1002236669 5:177808191-177808213 TCTGGCATTGCATTGCTGTGGGG + Intergenic
1002644492 5:180646457-180646479 TCTGGACTTGCCTGTCTCTGGGG + Intronic
1003238048 6:4316370-4316392 GTTGGATTGGCCTGGGTGTGGGG - Intergenic
1003965473 6:11248680-11248702 TCTGGATGGGCCTGGCCTTGGGG - Intronic
1005874692 6:30002042-30002064 GCTGGATCTGCCTTGGTGTGGGG - Intergenic
1005930846 6:30482444-30482466 TCTGGAGCTGCCTGTCTCTGAGG + Intergenic
1007931791 6:45698358-45698380 TCTGGATTTGGCTGACTGTTAGG + Intergenic
1008132363 6:47733344-47733366 TTAGGATTCTCCTGGCTGTGGGG - Intergenic
1012103586 6:95123883-95123905 TCTAGATTTGCCTGGTAGTATGG - Intergenic
1015404404 6:132820978-132821000 TCTGAAAATGCCTGGCTGGGAGG - Intergenic
1016809380 6:148244815-148244837 TCTTGCTTTGCCTGGCTGTAAGG + Intergenic
1017480169 6:154845570-154845592 TCTTGATTTGCATGGTTTTGTGG + Intronic
1017770155 6:157638526-157638548 TTTGAACATGCCTGGCTGTGTGG - Intronic
1017799005 6:157875196-157875218 TCTGGATGTGGCTGGCTTTACGG + Intronic
1018945429 6:168344594-168344616 TCTGGCACTGCCTGGCTGTGGGG + Intergenic
1019342203 7:513566-513588 TCTGGAGCATCCTGGCTGTGAGG - Intronic
1019840230 7:3434696-3434718 TCTCGATTTGCCTCCCTGTGAGG + Intronic
1022220520 7:28309413-28309435 AGTGGATTTGCCTGGCTTTCTGG + Intronic
1022530026 7:31061289-31061311 TCCTGACTTGCCTGGCTGCGAGG - Intronic
1022637973 7:32155100-32155122 TGTGGATTTGCCTTTCAGTGAGG - Intronic
1023512767 7:40970748-40970770 TGAGCATTTGCCTGGCTGGGTGG + Intergenic
1023657402 7:42438510-42438532 TATGTATTTGCCTGGTTTTGAGG + Intergenic
1023659668 7:42459191-42459213 CCTGGAATCTCCTGGCTGTGGGG - Intergenic
1023882604 7:44328892-44328914 TCTGGATCTGCCTGACTTTGTGG + Intronic
1024018319 7:45339773-45339795 TCTGGATGTACCTGTCTGTCTGG - Intergenic
1026028921 7:66772028-66772050 TCTGCTTCTGCCTGGCTTTGTGG - Exonic
1027694829 7:81397669-81397691 TCTGGACTGGCCTGGTTGTGGGG + Intergenic
1027946142 7:84748689-84748711 TCTGGACCTGCCTTGATGTGGGG + Intergenic
1030746825 7:113175824-113175846 CCTGGATTTTCCTGGGGGTGGGG - Intergenic
1031888264 7:127263241-127263263 TTTGGCCTTGCCTGGCAGTGGGG - Intergenic
1032441922 7:131948565-131948587 TCTGGATTAGCCAGGTGGTGTGG + Intergenic
1032795393 7:135272083-135272105 TCTTTATTAGCCTGGCTGTTTGG - Intergenic
1033585614 7:142772382-142772404 CATGGATTTGCCTGGGTGTGAGG - Intergenic
1034958962 7:155352458-155352480 TCTGCCTTTTCCTGCCTGTGCGG - Intergenic
1038183492 8:25250543-25250565 TCTGGAGATGCCCGGCCGTGAGG + Intronic
1038494565 8:27992374-27992396 TCTGGATTTGGCTGGCTGTGGGG - Exonic
1038499137 8:28028910-28028932 TGTGCATCTCCCTGGCTGTGTGG + Intronic
1039311510 8:36322174-36322196 TCTGGATGGGCCCCGCTGTGGGG + Intergenic
1039340464 8:36643876-36643898 TCTTGATTTGGCTGGCTGCTGGG - Intergenic
1040753305 8:50738589-50738611 TTAGGATTGTCCTGGCTGTGTGG - Intronic
1043912260 8:85876690-85876712 TCTTGATTTGCCTGGAACTGAGG + Intergenic
1045786583 8:105928274-105928296 TCTGAAGTTGCCATGCTGTGAGG + Intergenic
1049688603 8:143949196-143949218 GCAGGATTTGCCAGGGTGTGGGG - Intronic
1050311003 9:4353228-4353250 TGTGGTTTTGCCTGGCTGGTAGG - Intergenic
1050364850 9:4864501-4864523 TCAGGGTTTGCCCGGGTGTGGGG + Intronic
1050907844 9:11027474-11027496 GCTGGAGTGGCCTGGATGTGGGG + Intergenic
1052762082 9:32602861-32602883 TCTGAATTCGCCTTGATGTGAGG - Intergenic
1056227623 9:84511456-84511478 TCAGAATTTGCCCTGCTGTGTGG + Intergenic
1057158835 9:92870463-92870485 CCTGTATTTGCCTGGCTGCCTGG + Intronic
1057317679 9:93980139-93980161 ACTGCACTTGGCTGGCTGTGGGG + Intergenic
1057546932 9:96026080-96026102 TCTGCACTTGCCTGGCCCTGGGG + Intergenic
1058524127 9:105840198-105840220 TCTGGATCTGACTGGGTTTGGGG - Intergenic
1059486376 9:114630199-114630221 TCTGCTGTTTCCTGGCTGTGCGG - Intronic
1061079705 9:128362462-128362484 CCTGGATTTGGTTGGCAGTGCGG + Intergenic
1061083493 9:128386034-128386056 TCTGGATAGGCCTGGGGGTGGGG - Intronic
1061782945 9:133006524-133006546 ACTGGCTTTGCCTGCCTCTGAGG + Intergenic
1061839132 9:133347656-133347678 GCTGGAGTTGCCTGGCCCTGGGG + Exonic
1062616529 9:137399114-137399136 CCTGGCTGTGCGTGGCTGTGGGG + Intronic
1062713850 9:137992882-137992904 CCTGTATTTGCCTGGTTTTGTGG - Intronic
1186729703 X:12396114-12396136 TCTTGATTTGCACGGCTTTGTGG + Intronic
1188575492 X:31644908-31644930 TCTGGAATTGCCTACCTGTCAGG + Intronic
1190581633 X:51896567-51896589 TCTGGTTTTGCCAGCCTGAGGGG - Exonic
1192320818 X:70089203-70089225 TCTGGTGATGCTTGGCTGTGAGG - Intergenic
1196818946 X:119687638-119687660 TCTGGACTTGCCTGGGTTTTTGG - Intronic
1198947482 X:142030923-142030945 TCTGGACTTGCCTGGGCCTGTGG - Intergenic
1202241457 Y:22774748-22774770 TTAGGATTGGCCTGGCAGTGCGG + Intergenic