ID: 1124126114

View in Genome Browser
Species Human (GRCh38)
Location 15:26939304-26939326
Sequence GTGCCTTCTCTGGATTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124126114_1124126120 19 Left 1124126114 15:26939304-26939326 CCAGGCAAATCCAGAGAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124126114 Original CRISPR GTGCCTTCTCTGGATTTGCC TGG (reversed) Intronic
900708189 1:4093849-4093871 GTACCTTCCCTGTATTTGCCAGG + Intergenic
901150948 1:7100878-7100900 GTGTCTTCTTTGGATTTTACTGG + Intronic
901845767 1:11980961-11980983 GTGCCTTCTCTGTGTGTGTCAGG - Intronic
904309016 1:29613505-29613527 CTGCCTTCTCTGGGTGTACCTGG - Intergenic
905753709 1:40488957-40488979 GAGCCTTCTCTGGATCTGTTTGG - Intronic
907099930 1:51821777-51821799 GTGCCTTTTCTGACTTTACCAGG - Intronic
907552780 1:55318500-55318522 GTGCCTTCTCTGGAATCCCTTGG + Intergenic
908026057 1:59952593-59952615 TTGTCTTCTCTGGTTCTGCCTGG - Intergenic
908587670 1:65590330-65590352 GTGACTTCTGTGGTTTTTCCTGG + Intronic
909890533 1:81000628-81000650 GTCCCTTCTCTGGATGTTCCAGG - Intergenic
910278981 1:85477440-85477462 GTGACTTCTCTGAATCTGCATGG - Intronic
920287615 1:204891799-204891821 GTCCTTCCTCTGGACTTGCCAGG - Intronic
923276748 1:232403305-232403327 GTCCCTTCTCTGGATTCTTCAGG + Intronic
1063215040 10:3916853-3916875 GTCTCTTCTATGGATTTGCAGGG + Intergenic
1063535740 10:6881497-6881519 GTACCATTTCTGGATTTGACGGG + Intergenic
1067659303 10:48222433-48222455 GTGCCTTGTCAGGCTGTGCCTGG + Exonic
1067848049 10:49738522-49738544 GTGCTTTCTCTGGAATGTCCTGG + Intronic
1068974786 10:62996869-62996891 GTTCCTTCTCTGCATGGGCCAGG + Intergenic
1069011111 10:63373327-63373349 GCTCCTTCTCTGGAATTGTCTGG - Intronic
1069063262 10:63916085-63916107 GCCCCTTCTGTGGATTTTCCTGG + Intergenic
1069173575 10:65262608-65262630 GTCCCTTCTATGGCATTGCCTGG - Intergenic
1071276315 10:84058874-84058896 GTGCTTTCTCTGGCTGTGGCAGG + Intergenic
1071342496 10:84661766-84661788 TAGCCTTCTCTGTATGTGCCCGG - Intergenic
1072431081 10:95370975-95370997 CTGCCTTCTCTGAATTTTCAGGG - Intronic
1075483237 10:122800011-122800033 CTGCCTTCTCTGGATTGTCATGG - Intergenic
1076227996 10:128796325-128796347 GTTTCTTCTGTGGATTTGCTTGG - Intergenic
1076775357 10:132693213-132693235 CTGCCTTCTCTGGCTTTTACTGG - Intronic
1077524036 11:3053642-3053664 GTGACTTCTCTGGATCCCCCAGG - Intronic
1090406793 11:126480834-126480856 CTGCCTTTTGTGGTTTTGCCCGG + Intronic
1092540867 12:9419154-9419176 GAGCCTTCCCTGGGTGTGCCTGG + Intergenic
1095632115 12:44389841-44389863 GTGCCTTCTCTTAACTTGCCTGG - Intergenic
1096688005 12:53301575-53301597 GTGTCTTCTCTGGAACTGCTCGG + Intronic
1096986391 12:55761426-55761448 GAGCCTTCTATGGCTTTGCTGGG - Intronic
1102023169 12:109697977-109697999 TTGCCTTCTCTGGAATAACCTGG - Intergenic
1102941188 12:116943662-116943684 GGGCCTTCTCTGGTCTTTCCTGG + Intronic
1102980855 12:117239950-117239972 GTGCCTCCTCTGGATTGGTGGGG + Intronic
1103233366 12:119351001-119351023 GTCTGTTCTCTGGATTTTCCAGG + Intronic
1104521529 12:129480256-129480278 GTTCCTTCTCTGACTTTGCTTGG - Intronic
1108426920 13:50312042-50312064 GAGCCTTCTCTTGATTTTGCAGG + Intronic
1109787256 13:67194702-67194724 ATGCCTTCTATAGAATTGCCAGG + Intronic
1112579932 13:100669810-100669832 GTGCTTTCTTTGGATTTACCAGG + Intronic
1115345284 14:32336251-32336273 GAGCCCTTTCTGGATTTGTCAGG - Intronic
1116458388 14:45144450-45144472 ATGGCATCTCTGGACTTGCCCGG - Intronic
1120493496 14:85205250-85205272 GTCTCTTCTCTGTGTTTGCCAGG - Intergenic
1122013491 14:98773303-98773325 GTCCCTTCTCTGAATTTCCATGG + Intergenic
1122254757 14:100468648-100468670 GAGCCCTCTCAGGATTTACCCGG - Intronic
1122270338 14:100566140-100566162 GTGGCCTTTCTGGAGTTGCCAGG - Intronic
1124126114 15:26939304-26939326 GTGCCTTCTCTGGATTTGCCTGG - Intronic
1127095545 15:55508808-55508830 GTGTTTTCTCTGGATTTTCCTGG - Intergenic
1128056772 15:64705481-64705503 GTGCTTTCTCTGGATCTGCATGG + Intergenic
1134434664 16:14245140-14245162 GGGCCGTTTCTGGATTTGCTGGG + Intronic
1138689572 16:58754553-58754575 GTCCCATCTATGGATTTACCTGG + Intergenic
1139520743 16:67481373-67481395 GGGCCTTCTCTAGCTTTCCCCGG + Intergenic
1141342626 16:83217289-83217311 GTGCTTTCTCTGTGTTTTCCAGG + Intronic
1141759836 16:86020901-86020923 CTGCCTGCTCTGGATCAGCCTGG - Intergenic
1142217753 16:88838163-88838185 GTGTCTCCTCTGGGTTTTCCAGG + Intronic
1142402778 16:89869652-89869674 GTCTCTTCTCTGGATTGGCGCGG - Exonic
1143221340 17:5264644-5264666 GTGCCTTCTCGGGTCTTTCCTGG + Intergenic
1143223942 17:5284091-5284113 CTGCCTTCTCTTGAGTTGCATGG + Intronic
1143625059 17:8104955-8104977 TTCCCTTCTCTGGCTGTGCCTGG + Intronic
1146063276 17:29617994-29618016 GCTCCTTCTCTGGGTCTGCCGGG - Intronic
1147597399 17:41725757-41725779 GGGCCTTCTCCGGAGTTGCAGGG + Intronic
1149608556 17:57942157-57942179 GGCCCTTCTCTGAGTTTGCCGGG - Intronic
1151904109 17:77036402-77036424 CTGCCCTCTCTGGACGTGCCAGG + Intergenic
1152842472 17:82579259-82579281 TTGCCTTCTCTGTCTTTGTCGGG + Intronic
1153783820 18:8516830-8516852 GTGCCTTGCCTGGATTAGCTTGG - Intergenic
1156026791 18:32663971-32663993 ATGCCTGCTCTGGCTCTGCCTGG - Intergenic
1158276170 18:55770195-55770217 GTGCTTTCACTGTATTGGCCAGG + Intergenic
1161555745 19:4941687-4941709 GTCCCGTCTCTGGCTTGGCCGGG + Intronic
1162361562 19:10223682-10223704 GTGCCTTATCTGGCCTTTCCAGG + Intronic
1166444224 19:42844855-42844877 GTGCCTACCCAGGATTTCCCAGG + Intronic
1166447194 19:42868595-42868617 GTGCCTACCCAGGATTTCCCAGG + Intronic
1166451663 19:42907415-42907437 GTGCCTACCCAGGATTTCCCAGG + Intronic
1167110853 19:47460142-47460164 GTGCCTCCTTAGCATTTGCCTGG + Intronic
926799419 2:16646518-16646540 GTGGCTTCTCTGGTCTTGCAGGG - Intronic
926995529 2:18731145-18731167 CTGCCTTCTCTAGATGTTCCTGG - Intergenic
928459247 2:31455318-31455340 GTGCCTCCTCTGCTTTTTCCAGG + Intergenic
929412413 2:41711863-41711885 GTGTCTTCTCTGTACTTGCGTGG - Intergenic
929669059 2:43854797-43854819 TTGCCTTTTCTGGCATTGCCAGG + Intronic
929923889 2:46193604-46193626 CCCCCTTCTCTGGATTTCCCTGG - Intergenic
933107896 2:78356531-78356553 GTCCCTTCTCTAGCTTTGCCAGG - Intergenic
933492903 2:83010765-83010787 CTGCCTTCTCTTGTTTTCCCTGG + Intergenic
935352042 2:102159462-102159484 GTGCCTTCTATGCAATTTCCTGG + Intronic
937954899 2:127416611-127416633 GTGCCTTCTGTGGTTGTGCATGG + Intergenic
938987441 2:136591811-136591833 GTTCCTTCTCTGGAGCTGCACGG - Intergenic
940727043 2:157345844-157345866 GATCCTTCCCTGGATTTGGCAGG + Intergenic
940787891 2:158001713-158001735 GTGTCTGCTCTGGATTTTCCTGG + Intronic
943402328 2:187429785-187429807 GTGCATTCTCTTCATTAGCCTGG - Intronic
946773331 2:223111884-223111906 ATGCCTTCCCTGGATTTCTCAGG - Intronic
947229097 2:227867400-227867422 GTGACTTCACTGTATTAGCCTGG + Intergenic
947713647 2:232329465-232329487 GTGCCTTCTCTGGATTGGGTGGG + Intronic
947733088 2:232441703-232441725 GTGCCTTCTCTGGATTGGGTGGG + Intergenic
948707394 2:239803572-239803594 GTGTCTTCACTGAATTTGACAGG + Intergenic
949060159 2:241952274-241952296 TTTCCTTCTCTGGATGTGCAAGG - Intergenic
1172010200 20:31842107-31842129 GTCCCTTCTCTGGAGGTGCTGGG - Intergenic
1172323533 20:34016777-34016799 GTCCGTTCTCTGGGTCTGCCTGG + Intronic
1173833841 20:46112321-46112343 CTGCCTCCTGTGGTTTTGCCTGG + Intergenic
1174272577 20:49380454-49380476 GGGCCTTCCCTGGAGTTGTCTGG - Intronic
1174368938 20:50073361-50073383 GTGCTTTCTCTGGATTCTGCTGG + Intergenic
1175192786 20:57222706-57222728 CTGCCTTCTCAGGATGTGCCAGG - Intronic
1176367724 21:6044001-6044023 GGGCCTTCCCTGGACTCGCCTGG + Intergenic
1176554256 21:8246883-8246905 TTGCCTTGCCTGGACTTGCCTGG + Intergenic
1176573178 21:8429907-8429929 TTGCCTTGCCTGGACTTGCCTGG + Intergenic
1176892498 21:14335140-14335162 GTGTTTTCTCTGGCTTTGCAAGG - Intergenic
1178796221 21:35746714-35746736 CTCCCTTATTTGGATTTGCCTGG + Intronic
1179019740 21:37627729-37627751 GGGCCTTCTCTGGTTTTTCTTGG - Intronic
1179755795 21:43494541-43494563 GGGCCTTCCCTGGACTCGCCTGG - Intergenic
1179951172 21:44709525-44709547 GCGCCTTCTCTGGAGTTGTCAGG - Intronic
1179971616 21:44838974-44838996 GTTCCTTTGCTGGCTTTGCCTGG + Intergenic
1185225499 22:49649478-49649500 GTGCCCTCCCTGGCTGTGCCTGG - Intronic
1203259262 22_KI270733v1_random:163923-163945 TTGCCTTGCCTGGACTTGCCTGG + Intergenic
950414589 3:12861655-12861677 GAGCCTTCTTTGGTTTTGCGGGG - Intronic
954151225 3:48658176-48658198 GTGCCTTCTCAGGCAGTGCCAGG + Intronic
955194276 3:56790617-56790639 TTATCTTCTCTGTATTTGCCTGG + Intronic
956611554 3:71128835-71128857 TTGCCTTCTGAGAATTTGCCAGG - Intronic
958806726 3:98819946-98819968 GTGCCTTCTCTTTATGTGCCAGG - Intronic
960696870 3:120405127-120405149 GTACCTTCTCTGCATGTCCCAGG - Intronic
962189661 3:133297167-133297189 GTGTCTTCGCTGTAGTTGCCAGG + Intronic
962350332 3:134651408-134651430 GTGCGATTTCTGTATTTGCCAGG - Intronic
962649456 3:137473831-137473853 GTTCCTCATATGGATTTGCCTGG + Intergenic
962933793 3:140060897-140060919 CATCCTTCTCTGGATTTGCTTGG - Intronic
968184642 3:196623786-196623808 GGGGCTTCTCTGGGTTGGCCAGG - Intergenic
969655954 4:8498774-8498796 GTGCCCTGTCTGGAGATGCCAGG + Intergenic
976814438 4:89131151-89131173 GTTCCTTCTCTTGATTTAGCTGG + Intergenic
980494633 4:133575273-133575295 GTGCCTTCTCAGGCTTTGCCTGG + Intergenic
980712809 4:136591881-136591903 ATGGCATCTCTGGATCTGCCTGG + Intergenic
982286256 4:153738809-153738831 CTGCCTTCTCTGGTTTTAACTGG + Intronic
988324567 5:29746112-29746134 GTAGCATCTCTGGATTTCCCTGG - Intergenic
991154968 5:63422948-63422970 TTGCTTTCTTTGTATTTGCCTGG + Intergenic
994111659 5:96012206-96012228 GTTCCTTCTCTTTATTTCCCAGG + Intergenic
996057854 5:119000375-119000397 GTGCCTCCTCTGTTTTTCCCAGG + Intergenic
999776275 5:154815083-154815105 CCACCTTCTCTGGATGTGCCTGG + Exonic
1000187124 5:158869944-158869966 TTGCCTTCTCTGGGTTTTCTTGG - Intronic
1001187180 5:169585448-169585470 TTGGCTTCTCTGGATATGCCTGG + Intronic
1001403228 5:171458717-171458739 GTGCCTTCTCTGCAGGTTCCTGG + Intergenic
1005471376 6:26165261-26165283 CCACCTTCTCTGGATGTGCCTGG + Intronic
1007666029 6:43513504-43513526 ATGGCTTCCCAGGATTTGCCTGG + Intronic
1016544941 6:145210977-145210999 GTGCCTTCTTTCTATTTGCTTGG + Intergenic
1017413945 6:154199956-154199978 GTGTCTTCACTGTATTTTCCAGG + Exonic
1018845118 6:167550667-167550689 CTGCCTTCTCTGGGTTCCCCTGG + Intergenic
1019125061 6:169832880-169832902 GTGCCTTCTCAGGATGTGACAGG + Intergenic
1019724328 7:2592777-2592799 GGGCCTTCTCTGGCTTAGTCCGG + Intronic
1020100852 7:5393671-5393693 CTGTCTTCTCTGGCTTTGACAGG - Intronic
1021039315 7:15842007-15842029 ATGCCTTCTCTGTCTTTACCAGG - Intergenic
1023632241 7:42176330-42176352 GGGCCTTCACAGGATTTGTCAGG - Intronic
1026493619 7:70884226-70884248 CAGCCTTATCTGAATTTGCCAGG - Intergenic
1031605688 7:123764310-123764332 AAGCCTTCTCTGAATTTCCCGGG + Intergenic
1034202160 7:149289519-149289541 GTGCCTTCCCTCTCTTTGCCTGG + Intronic
1034748933 7:153550412-153550434 CTGCCTTCTCTGGGCTTGTCAGG + Intergenic
1035247030 7:157569335-157569357 GTGCCTTCTCTAGTGTTGCCGGG + Intronic
1040915156 8:52561630-52561652 GTGGTTTCTCTTGATTTTCCAGG - Intronic
1041605070 8:59772487-59772509 GTGCCTTCTCTGTTTTTCCAAGG + Intergenic
1041860544 8:62508191-62508213 GTGCTTCCTCTGCATTTGCAGGG - Intronic
1041903495 8:63007743-63007765 GTGCCTTCTGTGCCTTGGCCAGG - Intergenic
1042068967 8:64909662-64909684 TTGAATTCTCTGGTTTTGCCTGG + Intergenic
1045314177 8:101028791-101028813 GTGCCTTCGCTGGGTGGGCCTGG - Intergenic
1045746310 8:105426373-105426395 TTGTTTTCTCTGGATTTGGCTGG + Intronic
1051265546 9:15306250-15306272 GCGCTGTCTCTGGAGTTGCCAGG + Intronic
1051488930 9:17638854-17638876 GTGACTTCTCTCCATTTCCCTGG + Intronic
1053837713 9:42158743-42158765 GTTCCATAACTGGATTTGCCTGG - Intergenic
1053883317 9:42617419-42617441 GTTCCATAACTGGATTTGCCTGG + Intergenic
1053889352 9:42676880-42676902 GTTCCATAACTGGATTTGCCTGG - Intergenic
1054222340 9:62424886-62424908 GTTCCATAACTGGATTTGCCTGG + Intergenic
1054228373 9:62484286-62484308 GTTCCATAACTGGATTTGCCTGG - Intergenic
1055549255 9:77415270-77415292 TAGCCTTCTCTGGATGTTCCTGG - Intronic
1055675012 9:78649322-78649344 GTTCCTTCTCTGGAATTTGCTGG + Intergenic
1058015908 9:100031761-100031783 GTGCCTCCTCTGTTTTTCCCAGG - Intronic
1058696728 9:107565072-107565094 GGGCCATCCCTGGATCTGCCTGG - Intergenic
1059209191 9:112496062-112496084 GTTCCTCCTCTGGCTTTACCTGG - Intronic
1059455386 9:114397317-114397339 GCGCCTTCTCTGGAATTGGTGGG - Intergenic
1060655790 9:125371777-125371799 GGGCCTGCGCTGGACTTGCCAGG + Intergenic
1060797415 9:126522166-126522188 GTGCCTTCTCCGAATCTGCATGG + Intergenic
1062454160 9:136627895-136627917 GTGCCATCACTGTATCTGCCCGG + Intergenic
1203467626 Un_GL000220v1:101996-102018 TTGCCTTGCCTGGACTTGCCTGG + Intergenic
1203475451 Un_GL000220v1:145966-145988 TTGCCTTGCCTGGACTTGCCTGG + Intergenic
1186562344 X:10626081-10626103 GTGCATTCTTTTGTTTTGCCTGG - Intronic
1186808871 X:13167341-13167363 AAGCCTTCCCTGGCTTTGCCTGG + Intergenic
1188513615 X:30962121-30962143 ATGCCTTTTCTGGATTTGCTTGG + Intronic
1189126508 X:38453201-38453223 CCGTCTTATCTGGATTTGCCTGG + Intronic
1190275130 X:48894254-48894276 GTGAATTCTCAGGATTTCCCAGG - Intronic
1192587026 X:72327187-72327209 CCTCCTTCTCTGCATTTGCCAGG - Intergenic
1194059547 X:89180521-89180543 GTGCCTTTTCTGTTTTTCCCAGG + Intergenic
1194734359 X:97494697-97494719 GTGTCTTCTCTGGATTTGTGTGG + Intronic
1194878768 X:99223466-99223488 GTGCCTTTTTTGTCTTTGCCAGG - Intergenic
1195487097 X:105421672-105421694 GTGCCTTATATTGATTTTCCAGG - Intronic
1200020039 X:153195602-153195624 GTGCATTCACTGCATTTGTCAGG - Intergenic
1200709040 Y:6467476-6467498 CAGCCATGTCTGGATTTGCCTGG - Intergenic
1200765382 Y:7076543-7076565 GTGCCTTCTGTGGCTGTGGCAGG + Intronic
1201025072 Y:9697233-9697255 CAGCCATGTCTGGATTTGCCTGG + Intergenic