ID: 1124126118

View in Genome Browser
Species Human (GRCh38)
Location 15:26939314-26939336
Sequence CGATGCCCCAGTGCCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124126118_1124126120 9 Left 1124126118 15:26939314-26939336 CCAGAGAAGGCACTGGGGCATCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1124126118_1124126127 30 Left 1124126118 15:26939314-26939336 CCAGAGAAGGCACTGGGGCATCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1124126127 15:26939367-26939389 GGCGACACCTCTCTGGTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1124126118_1124126126 27 Left 1124126118 15:26939314-26939336 CCAGAGAAGGCACTGGGGCATCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1124126126 15:26939364-26939386 ACAGGCGACACCTCTCTGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1124126118_1124126125 23 Left 1124126118 15:26939314-26939336 CCAGAGAAGGCACTGGGGCATCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1124126125 15:26939360-26939382 AAGAACAGGCGACACCTCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124126118 Original CRISPR CGATGCCCCAGTGCCTTCTC TGG (reversed) Intronic
900979623 1:6039036-6039058 TGGTGCCCCAGTTCCCTCTCTGG - Intronic
902807366 1:18869385-18869407 TGAGGGCCCAGTGCCTGCTCGGG - Intronic
904865228 1:33573148-33573170 GGCTGCCCCATTGCCTACTCAGG + Intronic
915622988 1:157097567-157097589 GGAAGCCCCAGTTCCTTCTCTGG + Intronic
915731175 1:158055545-158055567 CGATGTCCAAGTGCCATGTCAGG + Intronic
917590473 1:176470929-176470951 CAAGTCCCCAGTGGCTTCTCGGG + Intronic
922558482 1:226550074-226550096 AGGCGCCCCAGTGCCCTCTCCGG + Intronic
924441334 1:244087844-244087866 CTCTGCCCGAGTGCTTTCTCTGG + Intergenic
1063922284 10:10944983-10945005 CCATGCCCTCTTGCCTTCTCAGG - Intergenic
1064819561 10:19310822-19310844 TGATCCCACAGTCCCTTCTCCGG + Intronic
1066216877 10:33296677-33296699 TGCTGGCCCAGTGCCTTCCCAGG - Intronic
1070727322 10:78801396-78801418 AGATGCCCCCTTGCCTGCTCTGG - Intergenic
1072640046 10:97205053-97205075 AGAGGCCCCAGTGGCTTCTCAGG + Intronic
1074737686 10:116453065-116453087 CCCTGCCCCTGTGGCTTCTCTGG - Intronic
1076691032 10:132223988-132224010 CTTTGCCCCAGTGCCTCCTGGGG - Intronic
1077511495 11:2966770-2966792 TGAAGTCCCAGTGCCATCTCTGG - Intronic
1078461426 11:11517980-11518002 CTATGCGCCAGTGCCTACCCTGG + Intronic
1080806481 11:35658926-35658948 CTATGAGCCAGTGACTTCTCAGG + Intergenic
1080878231 11:36296021-36296043 CGAGGCCACAGTGTCTTCCCTGG - Intergenic
1084229815 11:67743471-67743493 CAAATCCCCAGTGCCATCTCTGG + Intergenic
1084588333 11:70076341-70076363 CCAAGCCCCAGAGCCCTCTCAGG + Intergenic
1088812789 11:113402771-113402793 TGTAGCCCCAGAGCCTTCTCTGG - Intergenic
1089367455 11:117929706-117929728 AGATGCTCCAGAGCCTTCTGAGG + Intergenic
1091285361 11:134405673-134405695 GCATGCCCCAGTGCCCTCCCGGG - Intronic
1102286868 12:111664791-111664813 CCTTCCCCCACTGCCTTCTCTGG + Intronic
1104761656 12:131300585-131300607 GGAGGCCCCAGTGCCAGCTCGGG + Intergenic
1104818117 12:131660207-131660229 GGAGGCCCCAGTGCCAGCTCGGG - Intergenic
1106132315 13:26950730-26950752 AGGTGACCCAGAGCCTTCTCGGG - Intergenic
1114549509 14:23524935-23524957 GGCTCCCCCAGTGCCTCCTCCGG + Exonic
1114634040 14:24177553-24177575 CCATGCCCCAGGGGCTTTTCTGG + Intronic
1119266165 14:73264351-73264373 CCATCCACCAGTGCGTTCTCAGG + Intronic
1120036676 14:79705992-79706014 CCATCCACCAGTACCTTCTCAGG + Intronic
1121782451 14:96630610-96630632 GGAGGTCCCAGTGCCTTTTCAGG + Intergenic
1124126118 15:26939314-26939336 CGATGCCCCAGTGCCTTCTCTGG - Intronic
1126142237 15:45448185-45448207 CCATGCCCCAGAGCCCCCTCAGG - Intronic
1126425936 15:48527053-48527075 CGATTCCCCAATTCCTTCTGGGG + Intronic
1127247975 15:57198690-57198712 TGAGGCCCCAGTGCCTTGTAGGG + Intronic
1128445795 15:67759169-67759191 TCATACCCCAGTGGCTTCTCAGG - Intronic
1132021470 15:98366214-98366236 CGATCTCCCAGTGCCTTCAGAGG + Intergenic
1132115202 15:99131033-99131055 GGATGTCCCAGCGCCCTCTCTGG + Exonic
1133004997 16:2875114-2875136 CGCAGCCTCAGTCCCTTCTCAGG + Intergenic
1134290890 16:12902225-12902247 CGATGCCTCAGCGCCCTCGCTGG - Exonic
1136172128 16:28495808-28495830 CCATGCCCTAGTGCTTTCACAGG - Exonic
1136284067 16:29231037-29231059 CGATGGCGCGGCGCCTTCTCGGG - Intergenic
1136455691 16:30378559-30378581 CGATGCCCCAGGTCCCCCTCTGG - Intronic
1138131881 16:54486729-54486751 CCAATCCCCAGTGCCTACTCAGG - Intergenic
1141210286 16:81973408-81973430 TAGTGCCCCAGGGCCTTCTCTGG + Intergenic
1141498075 16:84423945-84423967 TGCTGCCCCAGTCCCTTCTGGGG + Intronic
1143196238 17:5078364-5078386 CGACGCCCCCTTGCCTTTTCCGG - Exonic
1143401183 17:6644168-6644190 CCATGCCCCAGTGCCTTATTTGG + Exonic
1149495091 17:57112567-57112589 CGCTCCCCCATTGCCTTCACTGG + Exonic
1149991526 17:61386281-61386303 CACTGCCCCTCTGCCTTCTCGGG + Intronic
1150534558 17:66022053-66022075 CAATGCCACTGTGGCTTCTCAGG + Intronic
1150999734 17:70360959-70360981 TGATTCTCCACTGCCTTCTCTGG - Intergenic
1152421619 17:80196288-80196310 CGCTGCCCCTGTGCCTTCTGTGG + Intronic
1155513097 18:26597034-26597056 CGAGACTCCAGTGCCTTCTCTGG - Intronic
1157725244 18:49958987-49959009 TGAAGCCCAAGTGCCTGCTCAGG + Intronic
1158930912 18:62324950-62324972 CGATGCCCCCATTCCTTCCCGGG + Intergenic
1160716467 19:579100-579122 CGATGCCCTGGTCCCTGCTCAGG + Intronic
1160832411 19:1109981-1110003 CGATCCCCCACAGCCTGCTCGGG - Intronic
1160832429 19:1110038-1110060 CGATCCCCCACAGCCTGCTCGGG - Intronic
1162372903 19:10289753-10289775 TGATGGCCCAGGGCCTTCTGGGG - Intergenic
1164830213 19:31314357-31314379 CGCTGCCCATGTGGCTTCTCAGG - Intronic
1165562220 19:36689586-36689608 TGCTGCCCCAGTGCTTCCTCTGG + Intronic
1165767811 19:38361889-38361911 GGCTGCCCCAGTCCCGTCTCAGG - Intronic
1168669997 19:58233783-58233805 TGGTGCCCCAGTATCTTCTCTGG + Intronic
932570018 2:72933719-72933741 TGAGGCCCCAGTGGCTGCTCTGG + Intronic
937319201 2:120950892-120950914 GGCTTCCCCAGTGCCTCCTCGGG - Intronic
938184269 2:129214665-129214687 CCTTGCCCCAGTTCCTTCACAGG + Intergenic
941807897 2:169727250-169727272 CGGTGCCTCAGGGCTTTCTCCGG - Intronic
945573728 2:211503767-211503789 CTAAGCCACAGAGCCTTCTCAGG - Intronic
947201112 2:227615457-227615479 AGCAGCCCCAGTGCCTTCACTGG - Intronic
948566530 2:238890813-238890835 AGATCCCTCAGAGCCTTCTCAGG - Intronic
1169194169 20:3674491-3674513 CGATGCCCCTGACCCTGCTCTGG + Exonic
1170812662 20:19686728-19686750 AGATGCCCCTGTGCCCACTCAGG + Intronic
1171485319 20:25481630-25481652 GGAGGCCCCAATGCATTCTCCGG + Intronic
1173669899 20:44791641-44791663 CCATGATCCAGTCCCTTCTCAGG - Intronic
1174507176 20:51024019-51024041 CGAGGCCCCAGAGCCCTCCCGGG + Intergenic
1175960925 20:62636022-62636044 CCATGCCCCAGCCCCTCCTCAGG - Intergenic
1176079388 20:63264398-63264420 CCATGCCCCTGTGCATTTTCTGG + Intronic
1176309785 21:5143337-5143359 TGAAGCCCCAGTGCCCACTCAGG + Intronic
1176681093 21:9819713-9819735 CGAGGCCCCAGCGGTTTCTCGGG - Intergenic
1179847272 21:44118696-44118718 TGAAGCCCCAGTGCCCACTCAGG - Intronic
1180801820 22:18635474-18635496 CCATGCCCCAGTGCCTCCCTGGG - Intergenic
1180853060 22:19031015-19031037 CCATGCCCCAGTGCCTCCCTGGG - Intergenic
1181049987 22:20233881-20233903 CAATTCCCCAGTGCCTGCTGAGG + Intergenic
1181219902 22:21359787-21359809 CCATGCCCCAGTGCCTCCCTGGG + Intergenic
1182401426 22:30080522-30080544 CAACGCCCGAGTGCCCTCTCTGG - Intronic
1183281605 22:36935480-36935502 GGATTCCCCAGTGCCCTCTGGGG - Intronic
1183617240 22:38953319-38953341 CGACACCCCAGTGCCATCCCCGG - Intronic
1183843245 22:40518034-40518056 TGATGCTCCCATGCCTTCTCTGG - Intronic
1184935363 22:47716746-47716768 CGCAGCTCCAGTGGCTTCTCGGG - Intergenic
1185416399 22:50712634-50712656 GGCTTCCCCAGTGTCTTCTCAGG + Intergenic
951429017 3:22584627-22584649 CGATGTCCCCGTGACTTCTCTGG - Intergenic
953905477 3:46866356-46866378 CCATGTCCCAGAGCCCTCTCAGG + Intronic
957046383 3:75378317-75378339 CAAGTCCCCAGTGCCATCTCTGG + Intergenic
959524308 3:107359356-107359378 AGATTCACCAGTGCATTCTCAGG - Intergenic
961444436 3:126972563-126972585 CCATCCCTCAGTGCCTTTTCGGG - Intergenic
967984945 3:195087556-195087578 CCAGGCCCCAGTGCCCTATCCGG - Intronic
968990670 4:3909430-3909452 CAAATCCCCAGTGCCATCTCTGG + Intergenic
969122279 4:4919322-4919344 CAATGCCCCAGGACCTCCTCAGG + Intergenic
969563343 4:7963131-7963153 CCAAGCCCCAGTGCCTTCGGTGG - Intergenic
969655952 4:8498764-8498786 CGATGCCACTGTGCCCTGTCTGG + Intergenic
969824669 4:9747912-9747934 CAAATCCCCAGTGCCATCTCTGG - Intergenic
969832358 4:9808049-9808071 GGAAGCCCCATTGCCATCTCTGG + Intronic
972394548 4:38647657-38647679 TGATTTGCCAGTGCCTTCTCTGG - Intergenic
978777151 4:112515724-112515746 GGAGGCCGCAGTCCCTTCTCGGG - Intronic
979075246 4:116262414-116262436 CAATGTCTCAGTGTCTTCTCAGG - Intergenic
981748673 4:148073438-148073460 CCATGCCCCAGAGGCTGCTCTGG + Intergenic
987040267 5:14055492-14055514 CCCTGCCCCAGGGACTTCTCTGG + Intergenic
989115964 5:37952439-37952461 CGATGCCCCGGGGTCTTCTGGGG - Intergenic
989373637 5:40736089-40736111 CCATCCCCTTGTGCCTTCTCAGG - Intronic
994732423 5:103508191-103508213 TTATGCCCCAGCGCCTTATCTGG + Intergenic
996760798 5:126984162-126984184 GGATGGCACATTGCCTTCTCAGG - Intronic
1003298884 6:4858807-4858829 CTGTGCCCCAGTTCCTCCTCTGG + Intronic
1003688424 6:8327483-8327505 CTCTGCCCCAATGGCTTCTCTGG + Intergenic
1003908800 6:10725324-10725346 CGACCCCCAAGTGCCATCTCTGG + Intronic
1010547620 6:77177236-77177258 TGATGCCCCCCTGCCTTCCCAGG + Intergenic
1017331117 6:153199098-153199120 CAGTGCTCCAGTGTCTTCTCAGG - Intergenic
1017658128 6:156649246-156649268 CGGTGCCCCACTGTCTTGTCTGG - Intergenic
1018116040 6:160586295-160586317 GGAAGCTTCAGTGCCTTCTCTGG - Intronic
1018116487 6:160590790-160590812 GGAAGCCTCAGCGCCTTCTCTGG - Intronic
1018148105 6:160912378-160912400 GGAAGCCTCAGCGCCTTCTCTGG + Intergenic
1020313502 7:6887550-6887572 CAAATCCCCAGTGCCATCTCTGG + Intergenic
1022494051 7:30842291-30842313 TCATGCCCCACTGCCTGCTCTGG + Intronic
1028657071 7:93220642-93220664 CCATGCCCCAAGGCCCTCTCAGG - Intronic
1031512556 7:122668063-122668085 TGATGTCCCAGTGTCTGCTCTGG - Intronic
1032554072 7:132813154-132813176 AGCTACCCCAGTGGCTTCTCAGG - Intronic
1035625876 8:1070117-1070139 AGATGCCCCAAAACCTTCTCAGG - Intergenic
1036492904 8:9244328-9244350 CCATGCCACAATGCCTTCTTGGG - Intergenic
1039148148 8:34473022-34473044 CTATGCCCCAGTGCTGTCTTTGG + Intergenic
1040283788 8:46089262-46089284 GGATGACCCAGCACCTTCTCAGG - Intergenic
1040803916 8:51373079-51373101 CTATGCCCCAGTACCTTCGAAGG + Intronic
1042427090 8:68661119-68661141 CCATGCCCCAGGGCAGTCTCAGG - Intronic
1047749740 8:127871291-127871313 CGATGCCCAGGAGCCCTCTCAGG + Intergenic
1048252172 8:132875875-132875897 CGCAGGCCCAGTGACTTCTCTGG + Intronic
1049378915 8:142302406-142302428 CGATGCCTCGGGGCCTTCTGTGG + Intronic
1049592959 8:143470976-143470998 CGGTGCCCCAGTGCCAGCTCTGG + Intronic
1049672260 8:143875184-143875206 GGAGGACCCAGTGCCTTCTAGGG - Intronic
1051264755 9:15299681-15299703 GGATGCCCCAGTAGCATCTCAGG - Intronic
1056754369 9:89372835-89372857 GGGTGTCCCAGGGCCTTCTCAGG + Intronic
1059177869 9:112183784-112183806 TCTGGCCCCAGTGCCTTCTCTGG + Intergenic
1060299790 9:122368563-122368585 GGAAGCCCCTGTGCCTTCCCTGG - Intergenic
1061014909 9:127975957-127975979 CCATGCCCCAGTGCCAGCCCAGG + Intronic
1203665402 Un_KI270754v1:18024-18046 CGAGGCCCCAGCGTTTTCTCGGG - Intergenic
1203665970 Un_KI270754v1:20844-20866 CGAGGCCCCAGCGGGTTCTCCGG - Intergenic
1203666549 Un_KI270754v1:23660-23682 CGAGGCCCCAGCGGTTTCTCGGG - Intergenic
1203667116 Un_KI270754v1:26483-26505 CGAGGCCCCAGCGGTTTCTCGGG - Intergenic
1203667698 Un_KI270754v1:29299-29321 CGAGGCCCCAGCGGTTTCTCGGG - Intergenic
1203668264 Un_KI270754v1:32122-32144 CGAGGCCCCAGCGGTTTCTCGGG - Intergenic
1203668842 Un_KI270754v1:34938-34960 CGAGGCCCCAGCGGTTTCTCCGG - Intergenic
1203669118 Un_KI270754v1:36348-36370 CGAGGCCCCAGCGGTTTCTCCGG - Intergenic
1203669690 Un_KI270754v1:39164-39186 CGAGGCCCCAGCGGTTTCTCCGG - Intergenic
1186486164 X:9935996-9936018 CAATGCCACAGTCCCTTGTCTGG - Intronic
1186975349 X:14896445-14896467 CTTTGCCCCAGTCCCTTCCCAGG + Intronic
1190417012 X:50190208-50190230 CAATGTCCCAGTGTCTTCTCTGG - Intergenic
1191054917 X:56231973-56231995 CGAGGTCACAGTGTCTTCTCAGG - Intergenic