ID: 1124126120

View in Genome Browser
Species Human (GRCh38)
Location 15:26939346-26939368
Sequence TGCCCCCGATTTCAAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124126111_1124126120 28 Left 1124126111 15:26939295-26939317 CCCACACAGCCAGGCAAATCCAG 0: 1
1: 0
2: 0
3: 17
4: 265
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1124126114_1124126120 19 Left 1124126114 15:26939304-26939326 CCAGGCAAATCCAGAGAAGGCAC 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1124126112_1124126120 27 Left 1124126112 15:26939296-26939318 CCACACAGCCAGGCAAATCCAGA 0: 1
1: 1
2: 0
3: 29
4: 290
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60
1124126118_1124126120 9 Left 1124126118 15:26939314-26939336 CCAGAGAAGGCACTGGGGCATCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124126120 Original CRISPR TGCCCCCGATTTCAAAGAAC AGG Intronic
906662040 1:47589908-47589930 TGCCCCCCATTTCACATACCAGG - Intergenic
912175702 1:107153715-107153737 TGCACCCAAATTCAAAAAACAGG - Intronic
912503933 1:110142542-110142564 TGTCCCCGATCTCACAGACCTGG - Intergenic
914203352 1:145505783-145505805 TGGCCCCGATTTCCCGGAACTGG - Intergenic
914237279 1:145823705-145823727 TGGCCCCGATTTCCCGGAACTGG - Intronic
914482474 1:148078937-148078959 TGGCCCCGATTTCCCGGAACTGG - Intergenic
916826694 1:168448727-168448749 TGCCCAGGATTTCAGAGAATTGG - Intergenic
917655635 1:177122771-177122793 TCCTCCTTATTTCAAAGAACTGG + Intronic
920318630 1:205099067-205099089 TGCACCAGACTTCAAAGAATTGG - Exonic
1065413371 10:25456152-25456174 TGCCCCCTATTTGCAAGAAGAGG - Intronic
1068786973 10:60987383-60987405 TGCCACTGATTTTAAGGAACAGG - Intronic
1070529727 10:77326006-77326028 TCCCCCCCATTTCTAAGGACAGG + Intronic
1070797804 10:79227137-79227159 TGCCCCTGCTTTCTATGAACAGG + Intronic
1073447146 10:103588520-103588542 AGCCCCTGACTTCAAAGAGCTGG - Intronic
1074752134 10:116596694-116596716 TGCCCTTGATTTCAAAGAGAAGG - Intronic
1083623515 11:64060322-64060344 TGCCCCCGATTTTACAGATGAGG - Intronic
1097159458 12:57036119-57036141 TGCCCCCGAGTCCAAGGCACTGG + Intronic
1102530568 12:113543491-113543513 ATCCCCCGATTTCAGAGAGCTGG - Intergenic
1103074837 12:117973710-117973732 TGTCATCAATTTCAAAGAACGGG + Intergenic
1114531091 14:23396927-23396949 TGCCCCAGAGCTCATAGAACAGG - Intronic
1114696633 14:24632416-24632438 GGCCCACAATATCAAAGAACAGG - Exonic
1118694331 14:68369612-68369634 TGGCACCTATTTGAAAGAACAGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1126062131 15:44792879-44792901 TGCCCCAGTTATCAATGAACAGG + Intergenic
1137353126 16:47731944-47731966 TGGCCACATTTTCAAAGAACTGG + Intergenic
1143504675 17:7356992-7357014 TGCCCCCGCTTTCCCGGAACAGG - Exonic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1148161506 17:45453015-45453037 TGCCCCTGCTCTGAAAGAACAGG + Intronic
1149308031 17:55368224-55368246 TACCCCAGATTTCAAACATCTGG - Intergenic
1150392743 17:64799660-64799682 TGCCCCTGCTCTGAAAGAACAGG + Intergenic
1153794714 18:8610783-8610805 TGCCCTTTATTTTAAAGAACGGG - Intronic
1158036471 18:53037706-53037728 TCCACCTGATTTCAAAGACCGGG - Intronic
1158568632 18:58577231-58577253 TGCCCCAAATTTCAAAGAGCTGG - Intronic
1159451020 18:68601842-68601864 TGCCACCCTTTTCAAAGATCAGG + Intergenic
1163284046 19:16335289-16335311 TTACCCCCATTTCAAAGAAGAGG - Intergenic
931058297 2:58497738-58497760 TCTCCCCGCTTTTAAAGAACAGG + Intergenic
933708236 2:85307106-85307128 TGCCCTCGATTTCATAACACAGG + Intronic
939280298 2:140055409-140055431 TGCCCACCATTTCAAACAAAGGG - Intergenic
940959220 2:159764393-159764415 TGCTCCCAATTTTAAAAAACTGG + Intronic
946731333 2:222712340-222712362 TGCCTCCGATTTACAAGCACGGG - Intergenic
1175345472 20:58270177-58270199 TGCCCCCGATTTGATATAGCAGG + Intergenic
1182106037 22:27690249-27690271 TCTCCCCCATTTCAAAGAAATGG - Intergenic
1182590905 22:31379003-31379025 TGTCTCCGATTGTAAAGAACAGG - Intergenic
956893199 3:73633201-73633223 AGGACACGATTTCAAAGAACAGG - Intergenic
959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG + Intronic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG + Intronic
986979017 5:13424880-13424902 AGTCCCTGCTTTCAAAGAACCGG - Intergenic
1002098774 5:176847131-176847153 GGCGCCCGACTTCAACGAACGGG - Intronic
1002327595 5:178420214-178420236 TTCCCCCCATTTCATAGAAGAGG - Intronic
1007911598 6:45520573-45520595 TGCCCCCCAGTGCAAAGAAATGG - Intronic
1012731564 6:102888447-102888469 TGCCCCGGAAGTCAAAGAAGGGG + Intergenic
1015618332 6:135103105-135103127 TGACACCCACTTCAAAGAACAGG - Intergenic
1046991833 8:120466552-120466574 AGCACTAGATTTCAAAGAACTGG - Intronic
1048287905 8:133156372-133156394 TCTCCCCCATTTCATAGAACAGG + Intergenic
1056762560 9:89425622-89425644 TGCCCCTGATGTCAAAGCAGCGG - Intronic
1188263221 X:28041380-28041402 TGGCCCCGATTTCACAGAGTTGG - Intergenic
1189960622 X:46321517-46321539 TGCCCAAGATTTCAAACATCTGG + Intergenic
1190119553 X:47649417-47649439 TTCCCCCAATTACAAAGCACTGG + Intronic
1193665764 X:84314418-84314440 TGCCCCAGATCTCAGAGAAAAGG - Intergenic
1201927506 Y:19304346-19304368 TGCCTGCTATTTCAAAAAACAGG - Intergenic