ID: 1124129390

View in Genome Browser
Species Human (GRCh38)
Location 15:26971210-26971232
Sequence CTGGAGCCGCGAGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124129390_1124129405 5 Left 1124129390 15:26971210-26971232 CCCGCGCCCGCTCGCGGCTCCAG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1124129405 15:26971238-26971260 GTGGGCGGCGCCGCGCCAGGGGG 0: 1
1: 0
2: 3
3: 31
4: 191
1124129390_1124129406 12 Left 1124129390 15:26971210-26971232 CCCGCGCCCGCTCGCGGCTCCAG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1124129406 15:26971245-26971267 GCGCCGCGCCAGGGGGTCCCCGG 0: 1
1: 0
2: 2
3: 15
4: 186
1124129390_1124129402 2 Left 1124129390 15:26971210-26971232 CCCGCGCCCGCTCGCGGCTCCAG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1124129402 15:26971235-26971257 GGGGTGGGCGGCGCCGCGCCAGG 0: 1
1: 0
2: 8
3: 61
4: 768
1124129390_1124129400 -10 Left 1124129390 15:26971210-26971232 CCCGCGCCCGCTCGCGGCTCCAG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1124129400 15:26971223-26971245 GCGGCTCCAGGCGGGGTGGGCGG 0: 1
1: 0
2: 5
3: 48
4: 487
1124129390_1124129404 4 Left 1124129390 15:26971210-26971232 CCCGCGCCCGCTCGCGGCTCCAG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1124129404 15:26971237-26971259 GGTGGGCGGCGCCGCGCCAGGGG 0: 1
1: 0
2: 2
3: 23
4: 175
1124129390_1124129403 3 Left 1124129390 15:26971210-26971232 CCCGCGCCCGCTCGCGGCTCCAG 0: 1
1: 0
2: 2
3: 23
4: 225
Right 1124129403 15:26971236-26971258 GGGTGGGCGGCGCCGCGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124129390 Original CRISPR CTGGAGCCGCGAGCGGGCGC GGG (reversed) Intergenic
900100810 1:961218-961240 CTGGAGCCGCTGGGGGGCCCGGG - Intronic
900134690 1:1110927-1110949 CTGGCGCGGCAGGCGGGCGCTGG + Intronic
900207019 1:1435939-1435961 CGGGAGCCGGGCGGGGGCGCGGG + Intronic
900239235 1:1606647-1606669 CTGGAGCAGCCAGCGGGCAGGGG - Intergenic
900353588 1:2248952-2248974 CAGGAGCCGCGTCTGGGCGCTGG + Intronic
900502803 1:3014886-3014908 CTGGAGCAGCAAGCGGGGCCGGG + Intergenic
900577915 1:3393555-3393577 CTCGAGCCAGGAGCCGGCGCAGG + Intronic
900972388 1:5998730-5998752 CAGGAGCAGCGAGGGGGCGCAGG + Intronic
901125527 1:6925904-6925926 CTGGAGCCGGGAGGGGGAGGAGG - Intronic
901660310 1:10794904-10794926 CTGGGGCCGCTGGCGGGGGCTGG - Intronic
902372421 1:16014869-16014891 CTGGAGGCCCCAGCAGGCGCAGG + Exonic
903435131 1:23343907-23343929 ATGGAGCAGCGAGCGGAGGCGGG + Intronic
903528847 1:24013979-24014001 CTGGAGTCTCGAGGGGGCGGAGG + Intergenic
903875720 1:26472094-26472116 CTGGGGCCCCCAGCGGGAGCAGG + Intergenic
906319176 1:44806121-44806143 CTGGGGCCGCGCGCGGGCCAGGG - Exonic
910448896 1:87328118-87328140 CCCGAGGGGCGAGCGGGCGCGGG + Intergenic
914870967 1:151473470-151473492 CTGGAGCCGCGAAGGCGCGGGGG + Intergenic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
920920257 1:210292540-210292562 CCGGAGCCGCGCGGGGGCCCGGG + Intergenic
924289615 1:242524404-242524426 CTGGAGGAGCGAGCGGGCGCGGG + Exonic
924527149 1:244863306-244863328 GAGGAGCCGCGGGCGGGCGGCGG - Intronic
1063115124 10:3067482-3067504 CTGGGGCCGGGCGGGGGCGCGGG + Intronic
1063657774 10:8009157-8009179 ATGGGGCCGGGGGCGGGCGCGGG - Exonic
1066080907 10:31929201-31929223 CTGGAGCTGCGGCCGGGCGTGGG + Intergenic
1067572781 10:47384170-47384192 ACAGAGCCGCGAGCGGGCGCGGG - Intronic
1070103894 10:73414057-73414079 ATGGAGCCGGGGGCGGGCCCAGG + Exonic
1071568730 10:86684991-86685013 ATGGAGGAGCGAGCAGGCGCAGG - Intronic
1072283815 10:93894248-93894270 CGGGGGTCCCGAGCGGGCGCCGG + Intronic
1073288103 10:102400389-102400411 CTGGCGCTGCGGGCAGGCGCTGG + Exonic
1074088346 10:110225884-110225906 CGGCAGCCGCGGGCGGGTGCGGG + Intronic
1075259278 10:120949105-120949127 CTCGAGCCGAGAGCGCGAGCGGG - Intergenic
1075521934 10:123148412-123148434 CTGGAGACGCCACCGGCCGCCGG - Exonic
1075802623 10:125161929-125161951 GTTGGGCCGCGAGCGGCCGCTGG - Intergenic
1076657911 10:132036755-132036777 GTGGGGCCGCGACCGGGGGCCGG + Intergenic
1077206965 11:1349415-1349437 CTGGAGCCGCTAGCCTGTGCTGG + Intergenic
1078659834 11:13277877-13277899 CGGGATCCGAGTGCGGGCGCGGG + Exonic
1078987068 11:16607089-16607111 GCGGAGCCCCGAGAGGGCGCGGG - Intronic
1083430757 11:62612676-62612698 CGGGAGCCGAGAGCGGCCCCGGG - Exonic
1084184564 11:67464786-67464808 CTGGAGGTGCGAGCGGGCACCGG - Exonic
1084336444 11:68460654-68460676 CTGGAGCTGGGGGCGGGGGCAGG + Intergenic
1084336612 11:68461213-68461235 CGGGAGCGGAGACCGGGCGCGGG - Intronic
1084758378 11:71252733-71252755 CCGCAGCCGCGGGCGGGAGCGGG - Intergenic
1085423020 11:76380471-76380493 CTGGGGCGGCGCGCGGACGCGGG - Intronic
1085430769 11:76445629-76445651 CTGGTTCCCCGAGCGGGCTCCGG + Intronic
1087141442 11:94768897-94768919 CGAGACCCGCGCGCGGGCGCGGG - Intronic
1089954434 11:122556809-122556831 TGGGAGGCGCGAGCGGGAGCCGG + Intergenic
1090238383 11:125165481-125165503 CTGGAGGCGGGAGCGGTCCCAGG + Intronic
1091226010 11:133956800-133956822 CGCGAGGCGCGTGCGGGCGCGGG - Exonic
1091286706 11:134412120-134412142 GGGGAGCGGGGAGCGGGCGCGGG + Intergenic
1095986323 12:48001975-48001997 CTGGAGCCGAGAGGTGGCGGCGG + Intronic
1096738861 12:53677179-53677201 CGGGAGCCGGGAGGGGGCGGCGG - Intronic
1101680015 12:106955803-106955825 CTGGAGCCGCGGGAGGAGGCGGG + Exonic
1103593168 12:122006584-122006606 CTGGAGCAGAGAGCTGGCGCCGG - Intergenic
1103595434 12:122022224-122022246 CTGGAGCCGCGCTCGGGCTCGGG - Intronic
1103723306 12:122986037-122986059 CTGGAGCCGGGGGCAGCCGCGGG - Exonic
1103778617 12:123384371-123384393 CTGGAGCCGCAAGGGGGGGCCGG - Intronic
1104635720 12:130436960-130436982 CTGGAGCCGCCCGTGGGCCCCGG - Exonic
1105440927 13:20415119-20415141 CTGGGGCCGGGTGCGGGCGAGGG - Intronic
1105768081 13:23579920-23579942 CTGCAGCCGCGCGCTGGCTCAGG - Intronic
1107359462 13:39603140-39603162 CTGTGGGCGCGCGCGGGCGCCGG + Exonic
1107481524 13:40789607-40789629 CCGGAGCCGAGAGCGGGCGGCGG + Exonic
1110450868 13:75636345-75636367 CTGGTGCCGCGCGCTGCCGCTGG + Intronic
1113874303 13:113584912-113584934 CGGGAGCCGCGGGCGGGAGCCGG + Intronic
1113914735 13:113863601-113863623 GTGCAGCCGCGAGGAGGCGCGGG - Exonic
1115852664 14:37599864-37599886 CGGGAGACGCGCGCGGCCGCGGG - Intronic
1117913864 14:60657324-60657346 GTGGAGCGGAGAGCCGGCGCAGG + Intronic
1119500899 14:75126794-75126816 CAGGGGCCGCGAGCCGGCGGCGG - Exonic
1122162159 14:99792930-99792952 GTGGAGCTGCCCGCGGGCGCGGG + Intronic
1122470739 14:101964464-101964486 CTAAGGCCGCGAGCGAGCGCGGG + Intergenic
1122532479 14:102438222-102438244 CGGGAGCAGGGAGCGGGAGCAGG - Intronic
1122532483 14:102438235-102438257 CAGGAGCGGCGAGCGGGAGCAGG - Intronic
1122624179 14:103075712-103075734 CTCGAGCCGGGAGGGGGCGCTGG + Intergenic
1123112319 14:105878779-105878801 GTGAAGCCCGGAGCGGGCGCTGG - Intergenic
1124129390 15:26971210-26971232 CTGGAGCCGCGAGCGGGCGCGGG - Intergenic
1125300739 15:38252163-38252185 CCGGAGGCCAGAGCGGGCGCGGG - Intergenic
1128743694 15:70099378-70099400 CTGGCGGCCGGAGCGGGCGCGGG - Intergenic
1131056484 15:89378207-89378229 CTGGAGCGGAGTGCGGGTGCGGG - Intergenic
1131160678 15:90102687-90102709 CGGGACCCGCGAGCGGGATCAGG + Intergenic
1132522753 16:399000-399022 CTGGACCCGGGAGCGGACCCTGG + Exonic
1132544831 16:528206-528228 CTGGAGGCGCCAGCGGGCGGCGG - Intronic
1132603004 16:782235-782257 CAGGAGCAGGGAGCGGGAGCCGG + Intronic
1132687922 16:1170055-1170077 CTGGAGAGGCGAGCGGGGGAGGG - Intronic
1132875470 16:2135224-2135246 CTGCAGACGCCAGCGGGGGCGGG - Intronic
1132900433 16:2251315-2251337 GTGGAGCCGGACGCGGGCGCAGG - Exonic
1133259426 16:4538560-4538582 CAGGCGCCGCGGGCGGGGGCGGG + Intronic
1134290823 16:12901950-12901972 CGGGAGCTGCGAGCCGCCGCGGG - Exonic
1139403051 16:66696961-66696983 CGGGAGCCGCTGGTGGGCGCTGG + Intergenic
1141828637 16:86497623-86497645 CTGGGGCCGGGGGCGGGGGCGGG - Intergenic
1142156146 16:88533618-88533640 CTGCAGCAGGGCGCGGGCGCGGG + Exonic
1142263582 16:89053591-89053613 CTGGCGCCGCGAGGTGGAGCTGG + Intergenic
1142586860 17:979455-979477 CCGGGGCCGGGAGCGGGGGCCGG - Exonic
1142614450 17:1126402-1126424 CTGGGGCCGCCAGCGGGGGGTGG + Intronic
1142876158 17:2853237-2853259 CGGGAGCTGCGAGCCGGGGCGGG + Intronic
1143639879 17:8189846-8189868 CGGGAGCCGCAGGGGGGCGCCGG - Exonic
1144171836 17:12665785-12665807 CAGGAGCGGCGAGCGGGGTCTGG - Intergenic
1146057755 17:29589593-29589615 GAGGAGCCGCGAGCGGCGGCGGG - Intronic
1147190665 17:38736200-38736222 CTGGAGCCCCGAGCTGGCCAGGG - Intronic
1148323610 17:46771424-46771446 CTGCCGCCGCGAGAGGCCGCAGG - Intronic
1151745430 17:76009283-76009305 GTGGAGGCGCGAGCGGGCCAAGG - Exonic
1152408906 17:80112208-80112230 CTCGGGCCGCCAGCGGGCCCCGG - Intergenic
1152768907 17:82155749-82155771 CTGGAGACGAGGGCGGGCCCAGG - Intronic
1154416653 18:14179018-14179040 CTGCAGCTGCGAGAGGGGGCGGG - Intergenic
1155297303 18:24397447-24397469 CTGGAGCAGCCAGCGGCCGCCGG + Intronic
1160164041 18:76495088-76495110 CAGGGGCCGCGGGCGGGCGGTGG - Intronic
1160613844 18:80109358-80109380 GCGGAGGCGCGGGCGGGCGCAGG + Exonic
1160806940 19:996068-996090 CTGGAGCCGAGTCCGGGCCCTGG - Intronic
1160817862 19:1044563-1044585 CAGGAGCCGCTGGGGGGCGCAGG - Exonic
1160872523 19:1283658-1283680 TAGGAGCGGCCAGCGGGCGCGGG + Intergenic
1161370363 19:3907934-3907956 CTGGAGCCCCAAGGGGGCACCGG - Intronic
1161644467 19:5444565-5444587 CTGAAGCAGCAAGAGGGCGCAGG + Intergenic
1161684406 19:5695860-5695882 CAGGTGGCGCGAGTGGGCGCAGG - Intronic
1162481424 19:10929017-10929039 CCGGAGCAGCGCGCGGGCCCAGG - Exonic
1162741391 19:12775637-12775659 CTGGAGGCAAGAGCGGGCGTAGG - Intronic
1162895997 19:13764919-13764941 GTGGAGCTGCAGGCGGGCGCCGG + Exonic
1163551190 19:17967192-17967214 GGGCAGCAGCGAGCGGGCGCGGG - Intronic
1163779480 19:19239110-19239132 CAGGAGACGCCAGTGGGCGCTGG - Intronic
1164866991 19:31612681-31612703 CTGGAGCCGGGAGAGGGCAGAGG - Intergenic
1165533204 19:36421419-36421441 CTGGTGCCGGGAGCGGCCGGTGG - Intergenic
1165914154 19:39247727-39247749 CTGGAGCTGCTGGCGGCCGCGGG - Intergenic
1166064331 19:40348337-40348359 CGGGCGGCGCGAGTGGGCGCGGG - Intronic
1167037771 19:47004160-47004182 CTGCGGCAGGGAGCGGGCGCCGG + Exonic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
926122832 2:10254165-10254187 CTGGAGACCAGGGCGGGCGCTGG + Intergenic
932873291 2:75425343-75425365 CTGGAGCCATGAGCCGGAGCAGG - Intergenic
934567163 2:95347235-95347257 CCGGAGCCGGGAGGGGGCGGCGG - Intronic
934655865 2:96116607-96116629 CTGGAGGCGGGCGCGGGAGCGGG + Intergenic
934754728 2:96816996-96817018 CGGCCGCCGTGAGCGGGCGCTGG + Exonic
935112053 2:100103917-100103939 ATGCAGCCGAGACCGGGCGCAGG + Intronic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
936122919 2:109761234-109761256 ATGCAGCCGAGACCGGGCGCAGG - Intergenic
936221769 2:110610230-110610252 ATGCAGCCGAGACCGGGCGCAGG + Intergenic
938548014 2:132352842-132352864 CTGGGAGCGCGAGCGGGCTCGGG - Intergenic
946185515 2:217978604-217978626 CTGGGCCTGGGAGCGGGCGCAGG - Intronic
946339574 2:219059039-219059061 CTGGACCCGAGAGGGGGCGGTGG - Intronic
946865519 2:224038840-224038862 CGGGAGCCCCGAGCGGGACCCGG - Intronic
948420907 2:237859566-237859588 CCGGGGGCGGGAGCGGGCGCGGG - Exonic
948467383 2:238158878-238158900 CGGGAGCCGGGAGGGGGCGCGGG + Intergenic
948483254 2:238263651-238263673 GTGGAGCCGGCAGAGGGCGCTGG - Intronic
948893129 2:240916552-240916574 CTGGAGCCGGAGGGGGGCGCGGG - Intergenic
1169832453 20:9839134-9839156 CAGGAGCCGGGAGCTGGAGCAGG + Intergenic
1171179149 20:23079188-23079210 CTGGAGGCGACAGGGGGCGCTGG - Intergenic
1171346507 20:24469816-24469838 CAGGGGCCGCGAGCTGGCGGCGG + Intronic
1171876880 20:30585614-30585636 CTGGGAGCGCGAGCGGGCTCGGG - Intergenic
1172178490 20:32986694-32986716 CTGGAGCTGGGAGAGGGCCCAGG + Intronic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1174648473 20:52105096-52105118 CTGGAGCCCCGCCCGGGGGCTGG - Intronic
1175215454 20:57389901-57389923 CGGGGGCCGCAAGCGGGGGCAGG + Intergenic
1176008452 20:62879568-62879590 CTGGAGCCGAGAGCGGGACTGGG - Exonic
1176156911 20:63626704-63626726 TTGGCGCCGCGGGCGGGCGCGGG - Intronic
1176159826 20:63642381-63642403 CAGGTGAGGCGAGCGGGCGCTGG - Intronic
1176204626 20:63881586-63881608 CTGGTGCCGCCAGTGGGAGCAGG + Intronic
1176221031 20:63969525-63969547 CTGGGGCCGGGAGCGGGCGCGGG + Intronic
1176856682 21:13980242-13980264 CTGCAGCTGCGAGAGGGGGCGGG + Intergenic
1176882619 21:14216077-14216099 CCGGCGCCGGGAGCGCGCGCTGG - Intergenic
1179791091 21:43756388-43756410 GTGGAGCCTCGAGTGGGCCCTGG + Exonic
1180231064 21:46426961-46426983 CTGGAGGGGCGAGCGGAGGCGGG - Intronic
1180649991 22:17369611-17369633 CAGGAGCCGAGGGCGGGCGCCGG - Exonic
1183281158 22:36933424-36933446 GTGGAGCCAGGAGCGGGCCCTGG + Intronic
1183393752 22:37560431-37560453 CTGGATCCGGGGGCGGGGGCGGG - Exonic
1184743849 22:46444767-46444789 CTGGAGCCTCCAGAGGGAGCTGG - Intronic
1185037872 22:48489282-48489304 CTGGAGCCCCCAGCGGTGGCGGG + Intergenic
1185417970 22:50720408-50720430 CTGGAGGCGCGCCTGGGCGCGGG + Intergenic
953562118 3:43999405-43999427 CTGGGACCGCGGGCTGGCGCCGG - Intergenic
961827615 3:129606955-129606977 CTGGGGCCGCGGGCGGGTCCTGG - Intergenic
962817945 3:139019909-139019931 CGGGAGCGGCGAGCGCGCGTGGG + Exonic
963253208 3:143120519-143120541 CTGGAGCCGAGGGCGCGCCCGGG - Exonic
963833050 3:150029372-150029394 CTGGAGCCGCTTGCGGGTGAAGG + Intronic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
966911480 3:184562466-184562488 CTGGGCCCCGGAGCGGGCGCCGG - Intronic
968010524 3:195271182-195271204 CTGGAGCCAATCGCGGGCGCCGG + Intergenic
968085505 3:195872225-195872247 CTGGAGTCCCGAGCGGGGCCAGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968556585 4:1248956-1248978 CGAGAGGCGCGAGCGGCCGCGGG + Exonic
968599102 4:1500804-1500826 CTGGAGCCTTGAGCGGTCGGGGG - Intergenic
968729094 4:2261430-2261452 CGGGGGCGGGGAGCGGGCGCGGG + Intronic
968756422 4:2418462-2418484 CCGGAGCGCCGAGCGGGCGGCGG + Exonic
969138753 4:5051500-5051522 CGGGAGACGCGAGGCGGCGCGGG - Exonic
980130446 4:128811866-128811888 CTGGGGGCGGGAGCGGGAGCGGG + Intronic
982584527 4:157220828-157220850 CTGGAGCGGGGACAGGGCGCAGG + Exonic
984639291 4:182144606-182144628 AGGGAGCGGGGAGCGGGCGCCGG - Intronic
985478395 5:92305-92327 GTGGGGGCGCGAGCGGACGCGGG + Intergenic
985478450 5:92417-92439 GTGGGGGCGCGAGCGGACGCGGG + Intergenic
990376561 5:55176532-55176554 CTAGGGGCGGGAGCGGGCGCGGG - Intergenic
990557647 5:56951904-56951926 CGGGGGGCGGGAGCGGGCGCGGG - Intronic
992427408 5:76671855-76671877 CTGGAGCCAGGAGTTGGCGCAGG - Exonic
994353067 5:98769017-98769039 CTGGTGCCGCGGGTGGGCGAAGG + Intronic
994631724 5:102295878-102295900 CCCGAGCCTCAAGCGGGCGCTGG + Intronic
998251870 5:140558738-140558760 CTTGAGCCGCAGGCGGGCACGGG + Exonic
999731263 5:154478094-154478116 CTGGAGCCACTACTGGGCGCCGG + Exonic
1002204672 5:177554328-177554350 CTGGAGGCGGGAGCGGGTGCAGG - Exonic
1002418728 5:179134735-179134757 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418733 5:179134754-179134776 ATGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418776 5:179134867-179134889 CTGGAGCCGGGAGCTGGACCCGG - Intronic
1002418803 5:179134946-179134968 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418846 5:179135066-179135088 CTGGAGCCGGGAGCTGGACCCGG - Intronic
1002418880 5:179135165-179135187 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002896187 6:1381921-1381943 CGGGAGCCGCGAGCAGGTGACGG + Intergenic
1003112173 6:3259370-3259392 CGGGAGCTGCGCGCGGGCCCCGG + Intronic
1010489036 6:76452479-76452501 CTGGAGCCGCGGGCTGGAGTGGG - Intergenic
1011459690 6:87590105-87590127 CTGCAGCCGCGAGGGCGCGCGGG + Intronic
1013225729 6:108118459-108118481 CTGGGTCCTCGCGCGGGCGCAGG - Intronic
1013803283 6:113970776-113970798 CTGCCGTCGCGAGTGGGCGCCGG - Intronic
1016340997 6:143061161-143061183 CTGGAGGCGCGCACGTGCGCAGG - Intronic
1016863789 6:148747155-148747177 GTGGGGACGCTAGCGGGCGCCGG + Intergenic
1016982164 6:149863770-149863792 CTGGAGCTGCGCGCGGGCGGCGG - Exonic
1018652900 6:166006139-166006161 CAGCAGCCGCGGGCGGGCGGGGG - Intergenic
1018774212 6:166998863-166998885 CTGCAGCCCCGGGGGGGCGCCGG - Intergenic
1019165490 6:170095302-170095324 CTGGACCCCCGAGAGGGTGCTGG - Intergenic
1020178106 7:5898816-5898838 CCGGGGCCGGGAGCGGGCCCTGG + Exonic
1020304821 7:6826159-6826181 CCGGGGCCGGGAGCGGGCCCTGG - Exonic
1021716666 7:23468657-23468679 CTGGAGCCGCGTCCGGGCCTCGG - Intronic
1022008858 7:26291890-26291912 CTGGCGCTGAGCGCGGGCGCGGG + Exonic
1023614921 7:42010204-42010226 CTGGAGCCTCGTGCAGGCACAGG - Intronic
1023820334 7:43977208-43977230 CTGGGGCAGCGAGTGGGCGGGGG - Intergenic
1026968511 7:74454478-74454500 CTGCAGCAGCCTGCGGGCGCCGG - Intronic
1027202709 7:76073444-76073466 GTGCAGCCGCGAGAGAGCGCTGG + Intergenic
1028476966 7:91264331-91264353 CCGGAGCCGCGATTGGGCGACGG + Intergenic
1032402530 7:131633741-131633763 CTGGAGCCCTGAGCTGGCTCTGG - Intergenic
1034174620 7:149090811-149090833 CGGCAGCCGCGGCCGGGCGCCGG - Intergenic
1034393039 7:150800796-150800818 CGGGACCTGCGAGCGGGCGGCGG - Exonic
1034911842 7:155003460-155003482 TTGGGGCCGCGAGTGGGAGCGGG + Intergenic
1036163004 8:6406598-6406620 CTGGCGGCGCGCGCGGGCACTGG - Exonic
1038266965 8:26045326-26045348 CTGGAGCCGAGAGGAGGCGGTGG + Exonic
1044302916 8:90606456-90606478 CGGGAGGCGCGGGCGGGAGCCGG - Intergenic
1046288879 8:112132742-112132764 CTGGAGTTGCGGGCGGGCGTGGG + Intergenic
1048817126 8:138344345-138344367 CTGGAGAGGCGAGCTGGCGCCGG - Intronic
1049152768 8:141046112-141046134 CTGGAGCAGCCAGTGGGTGCCGG + Intergenic
1049584394 8:143426194-143426216 CTGGAGCCGGCAGCGGGGGAGGG - Intronic
1049651107 8:143770471-143770493 CCGGAGCAGCCAGCGGGGGCAGG - Intergenic
1049668430 8:143859076-143859098 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049668849 8:143860684-143860706 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049669264 8:143862286-143862308 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049669676 8:143863879-143863901 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049670091 8:143865487-143865509 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1056532405 9:87498520-87498542 CGGGAGCCGAGAGGTGGCGCGGG + Intronic
1059191842 9:112333855-112333877 CTGGGGGCGCGCGCGCGCGCCGG - Intergenic
1059769856 9:117414888-117414910 CCGGAGCCCCGAGCCGGGGCCGG + Exonic
1060207914 9:121693402-121693424 CTGGAGCCGAGAGAGGTGGCAGG + Intronic
1060557016 9:124513164-124513186 CTGGAGCCGAGAGCAGGGGGTGG - Intergenic
1061828489 9:133275709-133275731 GTGGGGCCGCGAGCCGGGGCCGG - Intergenic
1062591940 9:137278259-137278281 TGGGAGCCGCGGGCGGGGGCAGG + Intronic
1202800378 9_KI270719v1_random:170178-170200 CTGGCAGCGCGAGCGGGCTCGGG - Intergenic
1187391807 X:18891061-18891083 CTGGAGCCTCGAGCCGGGGGTGG - Intergenic
1190234689 X:48606408-48606430 CTGGAGCCCCAAGCTGGTGCAGG + Exonic
1190274520 X:48891548-48891570 CTGGACCCGCGCGCGGGAGAGGG + Intergenic
1190324924 X:49200373-49200395 CTGGAGCCGTGAGAGCGTGCGGG + Intergenic
1192624599 X:72714286-72714308 CGGGAGACGCGAGCGGGAGGCGG + Intronic
1198215587 X:134551143-134551165 CCAGAACCGCGTGCGGGCGCTGG + Intergenic
1200084375 X:153596223-153596245 CTGGAGCAGTGAGCCAGCGCTGG - Intronic
1201770327 Y:17612303-17612325 CTGGAGCCGCGCGAGGGCAAAGG - Intergenic
1201831227 Y:18293684-18293706 CTGGAGCCGCGCGAGGGCAAAGG + Intergenic