ID: 1124129932

View in Genome Browser
Species Human (GRCh38)
Location 15:26974445-26974467
Sequence GGGCCATAGACAATAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124129932 Original CRISPR GGGCCATAGACAATAACACA GGG Intronic
903471747 1:23592149-23592171 GGCCCAGAGACAGGAACACAAGG - Intronic
906014371 1:42561339-42561361 GAACCAAAGACAAAAACACATGG + Intronic
907977433 1:59445589-59445611 GTGCCATAGGCAAGGACACAGGG - Intronic
909498779 1:76310242-76310264 GGGACATAGACCAGAACAGATGG - Intronic
920876970 1:209845440-209845462 TTGCCATAGACAATCACACTGGG - Intronic
923715975 1:236425108-236425130 GGGCCACAGACAAAACCACCTGG - Intronic
1063016977 10:2088016-2088038 GGGACATAAACATTAACAAAAGG - Intergenic
1068541976 10:58304964-58304986 AGGCCATAGAGAGCAACACATGG + Intergenic
1071688166 10:87784652-87784674 GGCCCATAGAGAAGAACACCTGG + Exonic
1075213034 10:120507885-120507907 GGGGCACAGACATGAACACAAGG + Intronic
1078167576 11:8901698-8901720 GGGTCATAGACTAAATCACAAGG - Intronic
1080335517 11:31191473-31191495 GGTCCACAGACAATATCAAAAGG + Intronic
1087340246 11:96896837-96896859 AGGCCATAGACAGTGGCACAAGG + Intergenic
1090513214 11:127397469-127397491 AGGCAATAGACAATTAGACACGG + Intergenic
1101754725 12:107612707-107612729 GGTCAATCGACAATAACAAATGG - Intronic
1104874502 12:132024630-132024652 GAGCCCTAAACAAAAACACAGGG - Intronic
1109306555 13:60647953-60647975 GGGCTATAAATAATAACACCTGG + Intergenic
1109723773 13:66312914-66312936 AGTCCAAATACAATAACACATGG + Intronic
1114192080 14:20447364-20447386 GGGACATAGACAAAAACAGCAGG - Intronic
1116611792 14:47083828-47083850 GGGACATATACAATGACAAAAGG + Intronic
1121000791 14:90450989-90451011 GGGCATGAGACAATATCACAGGG - Intergenic
1121218859 14:92270404-92270426 AGGCAATATACAAGAACACATGG - Intergenic
1121501552 14:94442257-94442279 GGGTCATAGTGAAAAACACAGGG - Intergenic
1122244318 14:100391170-100391192 GAGCCATGGACAATTACAAAGGG - Intronic
1124129932 15:26974445-26974467 GGGCCATAGACAATAACACAGGG + Intronic
1124893067 15:33750569-33750591 GGGCCTTAGCCCATAGCACAAGG - Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1133560541 16:6946268-6946290 TAGCCATAGACAATAACATATGG + Intronic
1134235597 16:12463053-12463075 GGGCCACAGAGAAAATCACAAGG - Intronic
1137037400 16:35578296-35578318 GGGCCTCAGACAAGAACAGAGGG - Intergenic
1137286029 16:47016607-47016629 GGGGCTTAGACAATACCCCAGGG - Intergenic
1139913543 16:70413968-70413990 GAGAAATAGACAAGAACACAAGG - Intronic
1141023779 16:80523771-80523793 GGCCCAAAGATAATTACACAAGG + Intergenic
1144307284 17:13980126-13980148 GGACCATAGACAAGAACTGAAGG + Intergenic
1147185259 17:38709937-38709959 GGACCACACAAAATAACACATGG - Intronic
1149630749 17:58120389-58120411 GGACCATGGACAGTAGCACATGG - Intergenic
1155950594 18:31907788-31907810 GGGCTATAAATAATAAAACAAGG - Intronic
1158950654 18:62491696-62491718 GGAACAGAGACAATTACACAGGG + Intergenic
1160901719 19:1432223-1432245 GGGCCTCAGACAAGAACTCAAGG - Intronic
1161082566 19:2318664-2318686 GGCCCACAGACAAAAACAGAAGG - Intronic
1161588392 19:5117727-5117749 GGGCCAGAGTCACTAACACAGGG - Intronic
1164787749 19:30947651-30947673 GGGCTAAAGACAATAACAGCTGG - Intergenic
1168387844 19:55980770-55980792 GGACCATGGCCAATAAAACAAGG - Intronic
930112103 2:47687453-47687475 TGGCCAAAGACAATAAGACATGG - Intergenic
931314831 2:61118923-61118945 GGACCATGGATAATAAGACATGG - Intronic
933204713 2:79493070-79493092 GGGGCATAGACAAAAACTCCAGG + Intronic
943557315 2:189421564-189421586 TTGCCATGGACACTAACACAGGG + Intergenic
944013228 2:194999930-194999952 GGGCCATAAACATGAAGACAGGG - Intergenic
945433689 2:209795107-209795129 GCGACATAGACAATAAAACCAGG + Intronic
946096589 2:217279742-217279764 TGGCCACAGCCATTAACACATGG + Intergenic
948054408 2:235000483-235000505 TGGCCAGAGTCAATAACACGGGG + Intronic
948675338 2:239593566-239593588 GGGCCATGGATGAGAACACATGG + Intergenic
948675380 2:239593746-239593768 GGGCCATGGATGAGAACACATGG + Intergenic
948748039 2:240110013-240110035 GGGCCAGAGACAAGCACTCATGG + Intergenic
1177723790 21:24941728-24941750 GGGCCATAGGCAGAAACACCAGG + Intergenic
952452980 3:33448799-33448821 GGGCCATAACCAATAGCCCAGGG - Intergenic
953623686 3:44553621-44553643 GGGCCAAAGACAACCACAGAAGG - Intergenic
953923110 3:46965749-46965771 GGACCAAACACAATCACACAGGG - Intronic
957931682 3:86886732-86886754 GGGAGATGAACAATAACACATGG + Intergenic
958460462 3:94387847-94387869 GGGCCTTACACAATAATAAAGGG + Intergenic
960269185 3:115656050-115656072 GGGACATAAACAAAAACACAGGG + Intronic
962384278 3:134920415-134920437 GGGCTGTGGAGAATAACACAGGG + Intronic
966143439 3:176783509-176783531 GTGCCATAGACATTCATACATGG + Intergenic
970591192 4:17561871-17561893 GGGCCACAGACAATGTCAGAGGG + Intergenic
971706865 4:30056309-30056331 GGGTCCTAGACAATAAGCCATGG + Intergenic
971889455 4:32499223-32499245 GTGCCAAAGAAAACAACACATGG - Intergenic
973858117 4:55033644-55033666 GGGCCACACACAATAACAAAAGG - Intergenic
973986567 4:56360154-56360176 GGCCCATAGAAAATAAAAGATGG - Intronic
975489184 4:74969969-74969991 GTGACTTAGACAATAACAAAAGG - Intronic
982171417 4:152665361-152665383 GGACCATAGAGAACAAGACAGGG - Intronic
982853778 4:160354580-160354602 GGACCATAATCAATAAAACATGG - Intergenic
983213684 4:164982765-164982787 GAGAAATAGACAATAACAGATGG - Intergenic
983225506 4:165082446-165082468 GAGCGGTAGACAATACCACAGGG - Intronic
985354398 4:189102310-189102332 GGGCCAAACCCAATAACTCAAGG + Intergenic
986582570 5:9280484-9280506 GGGACATAGGCACTAACACGGGG - Intronic
989822372 5:45808955-45808977 GGGCATTACACAATAACAAAGGG + Intergenic
991275876 5:64845294-64845316 AATGCATAGACAATAACACAAGG + Intronic
994939658 5:106305806-106305828 GGGGAATATACAATAAGACATGG - Intergenic
995104357 5:108357246-108357268 GGGACATACATAATAACAAAAGG + Intronic
1001956495 5:175851382-175851404 GGGTCATAAACAGTCACACAAGG + Intronic
1006204629 6:32329458-32329480 GGGGAATAGTCAATAACAAATGG + Intronic
1006277384 6:33016092-33016114 GGGCCACAGCCCAGAACACACGG - Intergenic
1006632892 6:35442025-35442047 GGGACCTATACAATCACACAGGG - Intergenic
1007389659 6:41543771-41543793 GGGCCATAGTTAAGAGCACAGGG - Intergenic
1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG + Intronic
1009648456 6:66441147-66441169 AGGGCATAGACAATATCAAAAGG + Intergenic
1011634498 6:89358448-89358470 AGGACAAAGACAAAAACACAAGG - Intergenic
1012279309 6:97310190-97310212 GGGCCATAGCCAAGAAGCCAAGG - Intergenic
1015540203 6:134306117-134306139 GTGCCATAAAAAATAGCACAAGG + Intronic
1017077162 6:150630024-150630046 AGGCCATAGACTATTTCACAGGG + Intronic
1017419760 6:154261458-154261480 GGGCCAGAGACAAAAGCCCAGGG + Intronic
1018378485 6:163235576-163235598 AGTCTATAGACATTAACACAGGG - Intronic
1020498457 7:8886830-8886852 GGGCTATAGGCAATCACAGAAGG - Intergenic
1026318077 7:69244989-69245011 GGCCCATATACAATAGAACAAGG - Intergenic
1026548263 7:71344108-71344130 GGGCCTTAGAAAGTAAGACAAGG + Intronic
1033549419 7:142433039-142433061 TGGCATAAGACAATAACACAAGG - Intergenic
1033613504 7:142988347-142988369 GGACCATAGAAAATCACCCAGGG + Intergenic
1036753571 8:11457700-11457722 GGGCCAAAGACAAGGACAAAGGG - Intronic
1040323562 8:46330103-46330125 GGGCCATAGACTACAGCCCAGGG - Intergenic
1040597827 8:48857525-48857547 GGGCCAGACACAGTAAGACAAGG + Intergenic
1040849433 8:51883448-51883470 GGGACACACACAAAAACACAGGG + Intronic
1044642554 8:94399230-94399252 GGGCTACAGAAAATTACACATGG + Intronic
1045518632 8:102883611-102883633 GGGCAATAGACACTACCTCAAGG + Intronic
1046891969 8:119431952-119431974 GGGCCATAGAAAATAATTCTTGG - Intergenic
1048705685 8:137150404-137150426 GGGCCATAGGAAAGAACATAAGG + Intergenic
1050992065 9:12167945-12167967 GGGCTATAGACAGTAACTCCTGG + Intergenic
1051121874 9:13760542-13760564 GGACCAGAGACACTCACACAGGG + Intergenic
1052788357 9:32850976-32850998 GGGCTTTCTACAATAACACATGG + Intergenic
1053098589 9:35350352-35350374 GGCCCAGAGAGAATATCACATGG - Intronic
1055026078 9:71723062-71723084 GAGCCAGAGAAAATAACTCAAGG + Intronic
1056954986 9:91074487-91074509 GGCCAATAGACAAGGACACAGGG - Intergenic
1058655568 9:107217453-107217475 GGGCCATAGGCAAAATCAAAAGG + Intergenic
1191895888 X:65993018-65993040 GGGCCATAGCCAATAAGAAAGGG + Intergenic
1199374353 X:147089209-147089231 GGGCCAGAGAAAATTACACAAGG + Intergenic
1200032995 X:153311443-153311465 GGGCCATAGACAGTGACAGCTGG - Intergenic