ID: 1124131013

View in Genome Browser
Species Human (GRCh38)
Location 15:26985655-26985677
Sequence GCATTTTTCTGAGCTGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124131006_1124131013 7 Left 1124131006 15:26985625-26985647 CCAGTGGAAAGCAGACGAAGCCC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 184
1124131004_1124131013 25 Left 1124131004 15:26985607-26985629 CCAAGAGGATTGGATTAGCCAGT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 184
1124131003_1124131013 28 Left 1124131003 15:26985604-26985626 CCTCCAAGAGGATTGGATTAGCC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124131013 Original CRISPR GCATTTTTCTGAGCTGGTCT TGG Intronic