ID: 1124131013

View in Genome Browser
Species Human (GRCh38)
Location 15:26985655-26985677
Sequence GCATTTTTCTGAGCTGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124131004_1124131013 25 Left 1124131004 15:26985607-26985629 CCAAGAGGATTGGATTAGCCAGT 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 184
1124131003_1124131013 28 Left 1124131003 15:26985604-26985626 CCTCCAAGAGGATTGGATTAGCC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 184
1124131006_1124131013 7 Left 1124131006 15:26985625-26985647 CCAGTGGAAAGCAGACGAAGCCC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124131013 Original CRISPR GCATTTTTCTGAGCTGGTCT TGG Intronic
901166029 1:7222251-7222273 GTCTTTTTCTGTGCTCGTCTGGG + Intronic
901673946 1:10872083-10872105 GCATATGGCGGAGCTGGTCTTGG - Intergenic
901919216 1:12524467-12524489 GCATGATTCTGAGCTCCTCTAGG - Intergenic
902692452 1:18118327-18118349 GCATCATTCTGGGCTGGGCTGGG + Intronic
904058359 1:27686893-27686915 GCAACTGGCTGAGCTGGTCTAGG + Intergenic
904487741 1:30838724-30838746 GCATTGTTCAGAGCTGGGGTGGG - Intergenic
905513867 1:38546333-38546355 CCAGTTCTCTGAACTGGTCTTGG - Intergenic
911886678 1:103309982-103310004 TAATCTTTCTGAGCAGGTCTGGG - Intergenic
912864357 1:113244152-113244174 GGATTTTTCTCAACTGGTCTAGG - Intergenic
914503824 1:148271176-148271198 GCATGTTTCAGTACTGGTCTGGG - Intergenic
916070572 1:161167367-161167389 GCAGGTTTCTGAGCTTGGCTTGG + Exonic
918415272 1:184299588-184299610 GCATTTTTCTGAGATGAACCAGG - Intergenic
919535974 1:198788452-198788474 TGATTTTTCTGAGATGGTCTGGG + Intergenic
919781051 1:201221495-201221517 GCATCACTCTGAGCTGGGCTGGG + Exonic
920084152 1:203402387-203402409 GCATTTTTCTGAGCTTTTAGTGG - Intergenic
920407573 1:205729335-205729357 GCTTTTTTCTTACCTGGTTTTGG - Intronic
921259144 1:213370102-213370124 GCATCTTTTTGAGCTTTTCTTGG - Intergenic
1064533722 10:16336425-16336447 GCAGTTTCCTTATCTGGTCTTGG + Intergenic
1066444438 10:35469139-35469161 CCAGTTGTGTGAGCTGGTCTTGG - Intronic
1069321273 10:67174531-67174553 TTATTTTTCTGAGCTGCTCTGGG - Intronic
1071838290 10:89441774-89441796 GCATTTTTCTTAGATTTTCTGGG - Intronic
1074007716 10:109445192-109445214 GCATTTTTCTAAGAAGTTCTAGG + Intergenic
1075269432 10:121035761-121035783 GCCTTTTTCTGGGCTGGCCAAGG - Intergenic
1077866955 11:6230291-6230313 GAATTTTACTGACCTGTTCTTGG - Intronic
1078745274 11:14107712-14107734 GCATTACTCTGATCTGGTTTGGG - Intronic
1084340843 11:68499493-68499515 TCATTTTTGTGACCTAGTCTTGG + Intronic
1085061380 11:73450276-73450298 CCAATTTTGTGAGCTTGTCTAGG - Intronic
1085247900 11:75119140-75119162 TGATTTTTCAGAGCTGTTCTTGG - Intronic
1085348157 11:75781366-75781388 GAATATTTCTGAGGTGGACTGGG + Intronic
1087486442 11:98763831-98763853 GCCTCTTTCTGGGCTGGTCAAGG - Intergenic
1088769027 11:113014726-113014748 GGATTTTTCTGAGGTCGTCTTGG + Intronic
1091313543 11:134594499-134594521 ACAATTTTCAGAGCTGGTATAGG - Intergenic
1091335905 11:134765706-134765728 GCCTTTTTCAGTGCTGGTCTTGG + Intergenic
1093119149 12:15246540-15246562 GCAGTTTTCAGAGCTGGTAATGG - Intronic
1093687467 12:22073019-22073041 CCATTTTTCTGATTTGGACTTGG - Intronic
1097285825 12:57876468-57876490 GCATTTTTCTGGGCTGCCCAAGG + Intergenic
1098351096 12:69561664-69561686 TGATTTTTCTGAACTGGTTTTGG + Intronic
1098834005 12:75398559-75398581 TTCTTTTTCTGAGCTGTTCTGGG + Intronic
1100383866 12:94087422-94087444 GCATTTTACTGAGATGCCCTTGG - Intergenic
1102207185 12:111098675-111098697 GCTCTTGTCTGAGCTGCTCTGGG - Intronic
1103021816 12:117540358-117540380 CCTTGTTTTTGAGCTGGTCTGGG - Intronic
1104027200 12:125036641-125036663 GAAGTTTTGTGAGCTGGTCACGG + Intergenic
1104550060 12:129748447-129748469 TCATGTTTTTGAGCTTGTCTGGG + Intronic
1110095998 13:71521710-71521732 GCATTTTTATGTGATGCTCTGGG - Intronic
1113765616 13:112879197-112879219 GCATTTTTCTAAGCTGCATTTGG - Intronic
1114678632 14:24463491-24463513 GCATTTTTATAACCTAGTCTTGG - Intergenic
1116115882 14:40650181-40650203 TGATTTTTCTGAACTGGTTTTGG + Intergenic
1116142165 14:41011087-41011109 GGATTTATCTGAGATGGTGTCGG - Intergenic
1120690529 14:87587919-87587941 TCATTTTTCAGAGCTGGCATTGG + Intergenic
1120850929 14:89169238-89169260 CCATGTTGCTGGGCTGGTCTTGG - Intronic
1121521397 14:94588413-94588435 GCATTTGTCTGAGGGAGTCTTGG - Intronic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1124711050 15:32012008-32012030 TCATTTTTATATGCTGGTCTTGG - Intergenic
1125745176 15:41992829-41992851 GGAATTTGCGGAGCTGGTCTGGG + Exonic
1125885601 15:43226970-43226992 GCCTTTCTCTGGGCTGGTCCAGG - Intergenic
1127276857 15:57453737-57453759 GCATTTCTGAGAGCTGGTCCTGG - Exonic
1129019017 15:72498022-72498044 GATTTTTTTTCAGCTGGTCTTGG + Intronic
1129684993 15:77680741-77680763 GCCTTTCTGGGAGCTGGTCTTGG - Intronic
1132750640 16:1455881-1455903 GCTTCTTTCTGACGTGGTCTGGG - Intronic
1135206226 16:20486499-20486521 GCATTTTTCAGAACTGCTGTAGG - Intronic
1135212693 16:20537415-20537437 GCATTTTTCAGAACTGCTGTAGG + Intronic
1135693755 16:24567985-24568007 GAATTTTTCTGATTCGGTCTAGG + Intronic
1135968589 16:27055689-27055711 GCTTCTCTCTGAGCTGGGCTGGG - Intergenic
1137050393 16:35706845-35706867 GGACTTTTCTGAGCTGATTTAGG + Intergenic
1137753414 16:50883335-50883357 ACATTTCTCTGAGTTGGTCAAGG + Intergenic
1137934599 16:52622450-52622472 GCATTTTTCTGGGGTGAACTGGG + Intergenic
1138595291 16:58026318-58026340 GCAGTGTTCCGAGCTGGGCTGGG + Exonic
1140701054 16:77581926-77581948 CCTTTTTTCTGAGCCTGTCTTGG - Intergenic
1142558400 17:795193-795215 TCTTTCTTCTGAGGTGGTCTGGG - Intergenic
1143618425 17:8067360-8067382 GCATTGTTCTGAGATGGTGAGGG + Intergenic
1143861744 17:9896504-9896526 GCATTTTTCTGACCTCATCTTGG + Exonic
1144780645 17:17806827-17806849 GCACTTCTCTGTGCTGGACTTGG - Intronic
1146959614 17:36962625-36962647 TTATTTTTCTGAGCTACTCTGGG - Intronic
1151891628 17:76954288-76954310 GCATTTTTTTGAACTAGCCTTGG + Intergenic
1152222425 17:79075905-79075927 GGATTGTTCTGAGAAGGTCTGGG + Intronic
1152825168 17:82460046-82460068 CCATTTTCCTGGGCTGGACTCGG - Exonic
1153022901 18:647382-647404 TCTTTTAGCTGAGCTGGTCTTGG - Intronic
1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG + Intronic
1157991783 18:52504982-52505004 GCTTTATTCTGAGCTTTTCTAGG - Intronic
1158202077 18:54952363-54952385 ACAGTTTTCTGAGCTTGTCCTGG + Intronic
1159755789 18:72362359-72362381 GCATTTTTATTAGCTGTGCTTGG + Intergenic
1160597445 18:79986634-79986656 GCATCTTGCTGAGCTGTGCTCGG + Intronic
1160614564 18:80114971-80114993 GCATTTTTATGATCTAGTCTTGG + Intronic
1161902277 19:7128030-7128052 ACATTTTTCTCAGCTGGGCACGG - Intronic
1162158784 19:8697142-8697164 GCACTTGTCAGAGGTGGTCTGGG + Intergenic
1162790803 19:13061832-13061854 TCATGTTGCTGAGCAGGTCTTGG + Intronic
1163387728 19:17010121-17010143 GCATGTTTCTTTGCTGGTCCAGG - Intronic
1164250774 19:23472959-23472981 GCATTTCACTGAGCTGGTACAGG + Intergenic
1164352125 19:27361619-27361641 GGATATTTCTGAGCTGTTTTAGG - Intergenic
1164694919 19:30236184-30236206 GCTTGCTTCTGTGCTGGTCTTGG + Intronic
1166440765 19:42813015-42813037 GGATGTTTCTCAGCTGGACTTGG + Intronic
1166460267 19:42981897-42981919 GGATGTTTCTCAGCTGGACTTGG + Intronic
1166477542 19:43141604-43141626 GGATTTTTCTCAGCTGGACTTGG + Intronic
1166488970 19:43241086-43241108 GGATGTTTCTCAGCTGGACTTGG + Intronic
925053833 2:839951-839973 GCATTTTTCTCAGATGTTTTTGG - Intergenic
925845793 2:8032018-8032040 GCAGTTTTCTGAGCTGCTGTCGG - Intergenic
925998230 2:9309105-9309127 GCCTTTTTATAAGGTGGTCTTGG - Intronic
928218011 2:29378665-29378687 GCATTTTTAGGAGCTGTTCAGGG + Intronic
928890678 2:36199710-36199732 GCCTTTCTCTGCTCTGGTCTGGG + Intergenic
930644881 2:53895284-53895306 GTATTTCTCTGGGCTGGTTTAGG + Intronic
932078956 2:68694001-68694023 GCATTTTTCTAAGTTCCTCTGGG + Intronic
932118748 2:69078471-69078493 GAATTTTCCTGGGTTGGTCTGGG - Intronic
932199339 2:69812008-69812030 GCCTTCTTGTGAGCTGGTGTTGG + Intronic
932449969 2:71803204-71803226 GCATGCTTCTGAGATGCTCTTGG - Intergenic
933917613 2:87012016-87012038 CCATTTTTATGAGGTAGTCTAGG - Intronic
934005383 2:87757901-87757923 CCATTTTTATGAGGTAGTCTAGG + Intronic
935200952 2:100856129-100856151 CCATTTTTCTGTTCTGGTTTTGG - Intronic
935768341 2:106391992-106392014 CCATTTTTATGAGGTAGTCTAGG + Intronic
940112700 2:150171448-150171470 GCCCTTTTCTGGGCTGGTCAAGG - Intergenic
940636260 2:156300679-156300701 GTATTTATCAGAGCTGGTTTTGG - Intergenic
940802604 2:158149546-158149568 GAATTTTTCTTAGCAGTTCTAGG - Intergenic
942763741 2:179429564-179429586 GCATTTCTCTGAGATAGTCATGG + Intergenic
944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG + Intronic
944970053 2:204982401-204982423 GCTGTGCTCTGAGCTGGTCTAGG - Intronic
945399237 2:209359188-209359210 GCATTGTTCTGAGTTGGTTGTGG + Intergenic
945544275 2:211130332-211130354 CCATTTCTCTGAGCTTGTCTGGG + Intergenic
945665997 2:212743629-212743651 GCATTTTTATGATCTGATCATGG - Intergenic
945797595 2:214384076-214384098 GAAATATTCTGAGATGGTCTTGG - Intronic
945964047 2:216166410-216166432 AATTTTTTCTGAGCTGGACTTGG - Intronic
946902480 2:224385437-224385459 TCATTCTTCAGAGCTGGCCTGGG + Intronic
948551998 2:238778924-238778946 GCTTTGGCCTGAGCTGGTCTTGG - Intergenic
948682653 2:239646425-239646447 ACATTTTCCAGAGCTGATCTGGG + Intergenic
1169636299 20:7695789-7695811 GAATCTTTCTGAGGTGGTTTGGG - Intergenic
1169651170 20:7869218-7869240 GCATCTTCCTGAGATTGTCTGGG + Intergenic
1170824175 20:19779152-19779174 ACATCTTTCTGAGCTGGACCTGG - Intergenic
1171449306 20:25224841-25224863 GGATTGTTCTGAGCTGGCTTTGG + Intronic
1173070290 20:39757860-39757882 CCATCTTTCTTGGCTGGTCTTGG - Intergenic
1174189097 20:48727635-48727657 TCACTTTTCTGGGATGGTCTTGG - Intronic
1176067812 20:63208140-63208162 CCATTTTTCTGAGATGGAGTTGG + Intronic
1176663170 21:9659974-9659996 GCCTCTTTCTGAGCTGGCCAAGG + Intergenic
1179058298 21:37956000-37956022 ACATTTTTCTGAGATGATTTGGG - Intronic
1183688489 22:39375375-39375397 GCCTTGTCCTGAGCAGGTCTGGG + Intronic
1185162409 22:49237876-49237898 CCGTTTTCCTGACCTGGTCTTGG + Intergenic
949091227 3:31771-31793 GCATTTTTCTGTGCTTTTCCTGG + Intergenic
950721465 3:14885726-14885748 GCATTTTTATGATCTGGCCTTGG + Intronic
951520039 3:23602944-23602966 GCATCTTTCTGAGCTAATTTTGG - Intergenic
951709575 3:25574688-25574710 TCATTTTTCTGAGCAGGTTAAGG - Intronic
956228068 3:66982126-66982148 GCATGATTCTGAGCTTTTCTAGG - Intergenic
961385540 3:126521501-126521523 GCCATTTTCTGACCTGGCCTGGG - Intergenic
962894259 3:139699635-139699657 GGATTTGTCTGAGCTGCCCTAGG + Intergenic
962978306 3:140465391-140465413 GCACTTTTCTCAGCAGTTCTGGG - Intronic
963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG + Intronic
964156441 3:153590286-153590308 GCATTTTTAAAAGCTGGTTTGGG + Intergenic
965780041 3:172275771-172275793 GCATTTTTCTTTTCTGGACTAGG + Intronic
970774665 4:19659042-19659064 GCCTTTGGTTGAGCTGGTCTGGG - Intergenic
971011377 4:22439853-22439875 GTATTTTTTTGAGCTGGGGTGGG - Intronic
971388252 4:26161293-26161315 CCATTATTCTGGGCTGGGCTTGG - Intergenic
973090348 4:46127911-46127933 GCATTGTTCTTAGCAGTTCTAGG + Intergenic
975125285 4:70775598-70775620 GCATATTTCAGAACTGATCTTGG + Intronic
975255053 4:72224284-72224306 GTGTGTTTCTGAGCTGGACTAGG - Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978739827 4:112123950-112123972 GCATTAGCCCGAGCTGGTCTGGG + Intergenic
981642274 4:146958368-146958390 TTATTTTTTTGAGCTGGTCGAGG - Intergenic
981827579 4:148961287-148961309 TCATTGTTCTGTGCTGCTCTTGG - Intergenic
982710686 4:158755924-158755946 CCATTTTTCTGAGCTACTCCTGG + Intergenic
983365077 4:166776122-166776144 ACATTTTTCTGGGCTGGGCACGG + Intronic
985767225 5:1786353-1786375 GCCTCTTTCTGTGCTGGTCCTGG - Intergenic
990497650 5:56364688-56364710 GCTGTTATCTGAGTTGGTCTTGG - Intergenic
992775290 5:80083571-80083593 GCGTTTTTCTGACCTAGTCCTGG + Intergenic
996163737 5:120199271-120199293 GCATTTATCTTAGCTGGGATTGG - Intergenic
997714776 5:136034075-136034097 ACATTTTTCAGGGCTGGTTTGGG + Intronic
1001429866 5:171650720-171650742 GCTTTTTACTGAGCTGAGCTGGG + Intergenic
1004356001 6:14930523-14930545 GCCTTTTTCTTATCTGGTATTGG - Intergenic
1004502138 6:16218418-16218440 GCCCTTTTCTGAGCTGGCCAAGG - Intergenic
1007289265 6:40772883-40772905 ACATTTTTCTCAGCCAGTCTTGG + Intergenic
1010049398 6:71485087-71485109 ACATTTTTCTGAGTGTGTCTGGG - Intergenic
1011864739 6:91810797-91810819 CCTTTTTTCTGTGCTTGTCTGGG - Intergenic
1013827881 6:114236517-114236539 GAATTTTTCTGTGCTGTTTTTGG + Intronic
1018129181 6:160712161-160712183 CCATTTTTATGAGGTAGTCTAGG + Intronic
1020769536 7:12370824-12370846 GCATTTATCCGTGCTGATCTTGG - Exonic
1024781035 7:52848270-52848292 GAGTTTTTCTGGGCTGGTCATGG + Intergenic
1025502110 7:61315028-61315050 GGATATTTCTGAGCTGTTCGAGG - Intergenic
1025516975 7:61661250-61661272 GGATATTTCTGAGCTGTTCGAGG - Intergenic
1025541312 7:62090074-62090096 GGATATTTCTGAGCTGTTCGAGG - Intergenic
1026072110 7:67131048-67131070 GCATTTATCTGATCTCCTCTTGG + Intronic
1034198648 7:149266848-149266870 GTATTTCTCTGAGCTGGAGTGGG + Exonic
1038650371 8:29397504-29397526 GTATTTCTCTGAGTTGGTTTAGG + Intergenic
1039163452 8:34649106-34649128 GCATTTTTCTGAGGTAGTTTGGG - Intergenic
1043953717 8:86338417-86338439 GCCTTTTTATGGCCTGGTCTTGG + Intergenic
1046268384 8:111860426-111860448 GCATTTTTCTGACATAGTCATGG + Intergenic
1048562645 8:135558203-135558225 GTAAATTCCTGAGCTGGTCTAGG + Intronic
1049996589 9:1040878-1040900 GAATTTTTCTGAGCAGGGATGGG + Intergenic
1052253107 9:26423406-26423428 GCATTTTTGTGACCTGGTTTAGG + Intergenic
1053229633 9:36396587-36396609 GCATTCTTCAAAGCTGGTCCAGG + Intronic
1054764491 9:69032188-69032210 TCATTTTTATGACCTGGACTTGG + Intergenic
1059144492 9:111886226-111886248 CCATTTTTCTGAGATAGTCTTGG - Intergenic
1059453171 9:114383476-114383498 GCCTTTGTGTGAGCTGCTCTGGG - Intronic
1061475746 9:130864813-130864835 TCAGTTTGCTGAGCTGGTCAAGG - Intronic
1061702098 9:132423750-132423772 GCATGTTTCTGAGCCTTTCTGGG - Intronic
1062156424 9:135051339-135051361 GCTTTTTTGTGAGCTGGCCTTGG - Intergenic
1062479287 9:136744031-136744053 GCTTTATTCTGAGCTGGTGCTGG + Exonic
1203662929 Un_KI270753v1:61791-61813 GCCTCTTTCTGAGCTGGCCAAGG - Intergenic
1186187610 X:7037199-7037221 GGATTTTTCTCAGCTGGACTTGG + Intergenic
1188024735 X:25196211-25196233 GAATTTTTCTGACCTTGTCCTGG + Intergenic
1189660238 X:43288674-43288696 GCATTTATCTGAGCTGGGGAGGG - Intergenic
1189804878 X:44725314-44725336 AGATTTTTCTGAGCTACTCTGGG - Intergenic
1191649903 X:63525432-63525454 GCATTCTTGTGATTTGGTCTAGG - Intergenic
1191700921 X:64042146-64042168 TCATTTTTCTGTTCTGGTTTTGG - Intergenic
1194388962 X:93292717-93292739 GCAACTTTTTGTGCTGGTCTAGG + Intergenic
1194815191 X:98432481-98432503 GAATTAATCTGAGCTTGTCTTGG + Intergenic
1196760756 X:119198517-119198539 GCACTGGGCTGAGCTGGTCTGGG + Intergenic
1199324129 X:146476878-146476900 GCATTTTCCTGGGCTGGCCCTGG - Intergenic