ID: 1124136152

View in Genome Browser
Species Human (GRCh38)
Location 15:27037984-27038006
Sequence AGGCTCTGGCCAGCAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 270}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124136145_1124136152 -1 Left 1124136145 15:27037962-27037984 CCCAGCATGCAGGGTCCCAGCCA 0: 1
1: 0
2: 0
3: 20
4: 254
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136137_1124136152 12 Left 1124136137 15:27037949-27037971 CCCTCACCCCGTCCCCAGCATGC 0: 1
1: 0
2: 3
3: 44
4: 422
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136146_1124136152 -2 Left 1124136146 15:27037963-27037985 CCAGCATGCAGGGTCCCAGCCAG 0: 1
1: 0
2: 3
3: 35
4: 292
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136143_1124136152 4 Left 1124136143 15:27037957-27037979 CCGTCCCCAGCATGCAGGGTCCC 0: 1
1: 0
2: 4
3: 30
4: 378
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136141_1124136152 6 Left 1124136141 15:27037955-27037977 CCCCGTCCCCAGCATGCAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136135_1124136152 18 Left 1124136135 15:27037943-27037965 CCCTTGCCCTCACCCCGTCCCCA 0: 1
1: 0
2: 6
3: 60
4: 788
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136136_1124136152 17 Left 1124136136 15:27037944-27037966 CCTTGCCCTCACCCCGTCCCCAG 0: 1
1: 1
2: 8
3: 160
4: 1005
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136138_1124136152 11 Left 1124136138 15:27037950-27037972 CCTCACCCCGTCCCCAGCATGCA 0: 1
1: 1
2: 2
3: 45
4: 529
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136144_1124136152 0 Left 1124136144 15:27037961-27037983 CCCCAGCATGCAGGGTCCCAGCC 0: 1
1: 0
2: 1
3: 24
4: 326
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270
1124136142_1124136152 5 Left 1124136142 15:27037956-27037978 CCCGTCCCCAGCATGCAGGGTCC 0: 1
1: 0
2: 0
3: 34
4: 266
Right 1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG 0: 1
1: 0
2: 3
3: 25
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124136152 Original CRISPR AGGCTCTGGCCAGCAGATGC AGG Intronic
900000431 1:12021-12043 TGGCACAGGCCAGCAGTTGCTGG - Intergenic
900020145 1:182540-182562 TGGCACAGGCCAGCAGTTGCTGG - Intergenic
900477099 1:2881150-2881172 AGGCTCCGGCCAGCGTGTGCGGG + Intergenic
900495378 1:2973752-2973774 AGGCTCTGGCAGGAAGAAGCTGG + Intergenic
900503297 1:3017024-3017046 GGGATCTGGCCACCAGATGTAGG + Intergenic
900707674 1:4090576-4090598 AGGCTCAGGGCAGCAGCAGCTGG - Intergenic
900884317 1:5404385-5404407 AGACCCTGGCCAGCATTTGCTGG - Intergenic
901115977 1:6844434-6844456 AGGCTGAGGCAGGCAGATGCTGG + Intronic
901778450 1:11576637-11576659 AGGCTTGGGCCAGCAGGTGCTGG - Intergenic
902285323 1:15404687-15404709 AGGCTCAGTCCAGGAGAAGCAGG - Intergenic
902758394 1:18564738-18564760 AGACTTTGGCCAACAGCTGCTGG - Intergenic
904082166 1:27879196-27879218 TGGCTCTGGCCAGCAGCTCCTGG + Intronic
904289547 1:29475367-29475389 AGGCTCTGGGCTCCAGATGGAGG + Intergenic
907617247 1:55937886-55937908 TGACTCTGGCAAACAGATGCAGG + Intergenic
910371813 1:86524135-86524157 TGGCGCTGGCCTGCAAATGCTGG + Intergenic
912666144 1:111581411-111581433 GGACTCTGTCTAGCAGATGCTGG - Intronic
913346234 1:117813659-117813681 AGGCTTTGTCCAGGAGCTGCTGG - Intergenic
914258166 1:145977251-145977273 AGGCTCTAGCTTGCAGATGCTGG - Intronic
915759076 1:158292633-158292655 TGGGTCTGGCCAGCTGTTGCTGG + Exonic
916174740 1:162028738-162028760 AGGCTCTGAGCAAAAGATGCAGG - Intergenic
916477830 1:165186569-165186591 AGGCTCTGCTCAGGAGATGATGG - Intergenic
916655595 1:166872743-166872765 AGGCCCTCACCAGAAGATGCTGG + Intronic
918301010 1:183203919-183203941 AGGCTCTGGAGGGGAGATGCTGG + Intronic
922151128 1:223005249-223005271 ACACTCTTGCCAGCAGATGGGGG + Exonic
924670900 1:246123894-246123916 AGGCTGATGGCAGCAGATGCAGG - Intronic
1063934545 10:11064068-11064090 AGTCTCTCCCAAGCAGATGCTGG - Intronic
1065271390 10:24037037-24037059 AGGCTGTCACCAGCACATGCAGG + Intronic
1067297611 10:44983814-44983836 ACTCTCCGTCCAGCAGATGCTGG + Intronic
1074360026 10:112818225-112818247 CGGCTCTGGCCATCCCATGCGGG + Exonic
1075419101 10:122287712-122287734 AGGGTCTGGCCAGAAGTTCCAGG - Intronic
1077208726 11:1358138-1358160 GGGCTCTGGACAGGAGAGGCAGG + Intergenic
1078673487 11:13386688-13386710 AGCCTCTTGGAAGCAGATGCTGG + Exonic
1079876315 11:25861577-25861599 AGGCTCTGGGCATCAAATGCAGG + Intergenic
1080866986 11:36204205-36204227 AGGCTCTGGGCAGAACATCCTGG + Intronic
1081774771 11:45669713-45669735 AGGCTGAGGCCACCAGAAGCAGG + Intergenic
1081973562 11:47216430-47216452 AAGCTCTGCCCAGCTTATGCTGG - Exonic
1082128281 11:48456990-48457012 AGGTTCTGGCCAGCTGTTGGTGG - Intergenic
1082561831 11:54627915-54627937 AGGTTCTGGCCAGCTGTTGGTGG - Intergenic
1083443963 11:62694875-62694897 AGGCTCTAGCCACCAGAAGGGGG - Intronic
1083777982 11:64903489-64903511 AGGACCCGGCCAGCAGCTGCGGG + Intronic
1084624765 11:70297777-70297799 AGGTTGTCACCAGCAGATGCAGG + Intronic
1085387100 11:76163691-76163713 AGGCACTGGCACGCAGAGGCTGG - Intergenic
1085388970 11:76172561-76172583 AGGATCTGGCTACCAGATGAAGG - Intergenic
1087506117 11:99023463-99023485 ATGCTTTGGCCAGCCTATGCGGG - Intronic
1088784368 11:113167377-113167399 AGGCTTTGGGCAGCAGACTCTGG - Intronic
1089294887 11:117461520-117461542 GGGCTCTGACCAGGAGATGACGG + Exonic
1089637047 11:119821570-119821592 TGGCTCTGGCCACCCAATGCAGG + Intergenic
1089784170 11:120896109-120896131 TGGCTCAGGACAGCAGGTGCTGG - Intronic
1090397334 11:126427684-126427706 GGGCTTTGTCCAGCAGATGTGGG + Intronic
1090826983 11:130394483-130394505 GTGCTCTGCCCAGCAGATGGGGG + Intergenic
1090912593 11:131134487-131134509 AGGCTCTTGGCAGCAGCTGCAGG + Intergenic
1091373522 12:12152-12174 TGGCACAGGCCAGCAGTTGCTGG - Intergenic
1091826289 12:3515176-3515198 AGGGTCTGGTCAACAGGTGCTGG + Intronic
1095955146 12:47801761-47801783 AGGCTCGGGCCAGCAGAGGGAGG + Intronic
1098034919 12:66291938-66291960 AAGATATGGACAGCAGATGCAGG - Intergenic
1099059520 12:77889001-77889023 ATGCTGGGCCCAGCAGATGCAGG - Intronic
1103019514 12:117522670-117522692 TTGCTCTGGCCAACAGATGTAGG + Intronic
1104490597 12:129190172-129190194 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490604 12:129190200-129190222 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490611 12:129190228-129190250 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490618 12:129190256-129190278 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490652 12:129190366-129190388 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490659 12:129190394-129190416 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490674 12:129190448-129190470 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104490681 12:129190476-129190498 AGTCTCAGGCCTGCAGATGGAGG + Intronic
1104916959 12:132270647-132270669 GGGCTCTGGCCGGGAGATGACGG - Intronic
1104973820 12:132543183-132543205 AGGCTCAGGACAGCAGCCGCTGG - Intronic
1105607198 13:21935799-21935821 AGCTCCTTGCCAGCAGATGCTGG + Intergenic
1105793867 13:23831527-23831549 AGGCTCTCACCAGGAGCTGCCGG - Intronic
1106601385 13:31190225-31190247 AGACTCTTGCCAGTACATGCTGG + Intergenic
1107407552 13:40128882-40128904 AGGCCCAAGCCAGCAGATGCAGG - Intergenic
1107638928 13:42421333-42421355 GGCCTCTGCCCAGTAGATGCCGG - Intergenic
1109202472 13:59446163-59446185 AGCCTGAGGCCACCAGATGCTGG - Intergenic
1112252654 13:97797561-97797583 AACTTCTTGCCAGCAGATGCTGG - Intergenic
1112327319 13:98450633-98450655 AGGCTCTGGGCAGCTGAGCCAGG + Intronic
1112332427 13:98486604-98486626 TGGCTCTGTCCACTAGATGCCGG + Intronic
1112886070 13:104173561-104173583 ATGTTCTGGCCAGTGGATGCAGG + Intergenic
1113701340 13:112390918-112390940 AGGCTCTGGCCAGTCCATGTAGG - Intronic
1113710125 13:112457615-112457637 AGCCGCTGGCCGGCAGGTGCGGG + Intergenic
1116357808 14:43952635-43952657 AATCTATGGCCAGCAGATGTTGG + Intergenic
1117316405 14:54575231-54575253 AAGCTATGGCCAGCAGATCTGGG + Intronic
1118623734 14:67637878-67637900 TGGCACTGGCCAGCAAATGCAGG - Intronic
1119026261 14:71155276-71155298 AGGCTTTGGCCAGCTCTTGCTGG + Intergenic
1119164426 14:72480497-72480519 AGTCTCTGCCCGGCAGAGGCTGG + Intronic
1119192278 14:72691102-72691124 AGGCCCTGGCAAGGAGAGGCGGG + Intronic
1119400007 14:74356930-74356952 AGGCCCTGGCCTCCAGGTGCTGG + Exonic
1122365750 14:101194009-101194031 AGGCTGTGGCCAGCAAAGGAGGG + Intergenic
1122374028 14:101246894-101246916 GGGCTCTGGGGAACAGATGCAGG - Intergenic
1123412967 15:20074304-20074326 GGGCTTTGGCCAGCACATTCAGG + Intergenic
1123522309 15:21081417-21081439 GGGCTTTGGCCAGCACATTCAGG + Intergenic
1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG + Intronic
1124200084 15:27671928-27671950 GGGCTCTGGCCAGCAGCTGAAGG - Intergenic
1125370000 15:38965135-38965157 AGGTTCTGGCCAGCACAACCAGG - Intergenic
1127300722 15:57651052-57651074 TGGCTCTGGCCAGTGGGTGCTGG + Intronic
1128413144 15:67418967-67418989 AGGCTTTTGCAGGCAGATGCTGG - Intronic
1129196704 15:73972844-73972866 AGGCTTTGGCCAGGAGAAACTGG - Intergenic
1131306386 15:91247596-91247618 AGGCCCTGGCTGGCAGTTGCTGG + Intronic
1131993425 15:98112076-98112098 GGGCTCTAGCCATCACATGCTGG - Intergenic
1132453076 15:101978924-101978946 TGGCACAGGCCAGCAGTTGCTGG + Intergenic
1132453819 16:11702-11724 TGGCACAGGCCAGCAGTTGCTGG - Intergenic
1133753934 16:8747124-8747146 TGGCTTTGGCCAGCAGAAGGAGG - Intronic
1133882678 16:9797816-9797838 AGGCCAGGGCCAGAAGATGCAGG - Intronic
1134450267 16:14358980-14359002 AGGCTCTGCCCAGCAGATCTTGG + Intergenic
1135673600 16:24395330-24395352 AGGCTCTCCCCAGCAGGAGCTGG - Intergenic
1139309656 16:66017831-66017853 CAGCTCTGGGCAGCAGGTGCCGG + Intergenic
1139384956 16:66561143-66561165 AGGCAGTGGCTAGCAGATGGAGG - Intronic
1142755722 17:2015365-2015387 TGGCTCTGGACATCAGAGGCTGG + Intronic
1142976096 17:3645425-3645447 AGGCTCTGGGTAGCAGAGCCTGG + Intronic
1143562290 17:7703255-7703277 AGGCAGTGGCCAGGAGAGGCAGG - Exonic
1144750149 17:17642821-17642843 AGGATCAAGCCAGCAGATGCTGG - Intergenic
1144960683 17:19042446-19042468 AGGCTCTGGGGAGCAGATAAGGG + Intronic
1144974477 17:19132078-19132100 AGGCTCTGGGGAGCAGATAAGGG - Intronic
1146408761 17:32564135-32564157 AGTCCCTGGCCTGCAGGTGCTGG + Intronic
1147502588 17:40979714-40979736 AGGCTCTGGATACCAGAGGCTGG + Intronic
1147555280 17:41475196-41475218 ATGCTTTGCCCAGCATATGCAGG - Intergenic
1149571945 17:57678330-57678352 TGGCTCTGGCCAGCAATGGCTGG - Intronic
1150645836 17:66976946-66976968 AGGCTCTTGGCAGCATTTGCTGG - Intronic
1152467725 17:80475457-80475479 AGGGTCGGGCAAGCAGGTGCAGG + Intronic
1153808835 18:8734179-8734201 AGCCTCTGCCCACTAGATGCTGG + Intronic
1154216764 18:12421172-12421194 AGGCTGGGGGCAGCAGGTGCAGG - Intronic
1155064060 18:22253885-22253907 AGGCTCTGTCCAGCGGAGCCAGG - Intergenic
1155517631 18:26639336-26639358 TGGCTGAGGTCAGCAGATGCGGG + Intronic
1155537680 18:26833686-26833708 AGGCTCTCCCCAGGAGAGGCTGG + Intergenic
1155810200 18:30223439-30223461 GGCCTCTGGGCAGCACATGCAGG - Intergenic
1157293453 18:46425693-46425715 CTCCTCTGGCCAGCAGATGAGGG - Intronic
1159015510 18:63099030-63099052 AGGGTGTGGCCTGCAGAAGCTGG + Intergenic
1159658495 18:71062251-71062273 AGGCTCTGGGCAGGAGACGTGGG - Intergenic
1161209214 19:3057515-3057537 AGGCTCAGCCCAGCAGGGGCCGG + Intronic
1162036221 19:7941065-7941087 ATGCTCGGGCCAGCAGACACAGG - Intronic
1162038619 19:7955991-7956013 ACGCTCTGGGCAGCAGGGGCAGG - Intergenic
1162378093 19:10316766-10316788 TGGCTCTGGCCAGCAGGGCCTGG + Exonic
1163702920 19:18795585-18795607 ATGCTCTGGCCAGGAGGTCCTGG - Intergenic
1164516762 19:28943348-28943370 AAGCTCTGGGCACCAGAAGCTGG - Intergenic
1164737325 19:30551529-30551551 AGCCTTTGGGCAGCAGATCCTGG + Intronic
1165144967 19:33724942-33724964 AGGATCGACCCAGCAGATGCTGG + Intronic
1166997305 19:46725799-46725821 AGACTCTGCCCAGCAGAGGAAGG - Intronic
1167411739 19:49348071-49348093 TGCATCTGGCCAGCAGATGGAGG - Intronic
1168121695 19:54255421-54255443 GGGCTCTGGCCAGCAGCCCCAGG - Exonic
1168578189 19:57531158-57531180 TGGGTCTGGCCCACAGATGCAGG + Intronic
1168670400 19:58237308-58237330 AAACTCTGGGCAGCAGAGGCAGG - Intronic
925364648 2:3303543-3303565 ATGCTCAGGCCAGCAGAGTCGGG + Intronic
933001895 2:76935845-76935867 AAGTTCTGGCCAGCACATTCAGG - Intronic
934046949 2:88180141-88180163 AGGCTCTGGGCTGCAGAGGGCGG - Intronic
934523246 2:95033029-95033051 AGGCTGTGGCCAGGAACTGCAGG - Intronic
935147896 2:100408740-100408762 AGACTGTGGCCAGAGGATGCAGG + Intronic
936285807 2:111180410-111180432 AGGCTGTGGCCAGCAGAGGAAGG + Intergenic
936401558 2:112168458-112168480 GGGCCGTGGCCAGCAGCTGCTGG - Intronic
936569293 2:113601396-113601418 TGGCACAGGCCAGCAGTTGCTGG + Intergenic
938370785 2:130767182-130767204 AGTGTCAGGCCAGCAGGTGCAGG + Exonic
942541345 2:177018330-177018352 AGCCCCTCTCCAGCAGATGCTGG - Intergenic
943230446 2:185244100-185244122 CTGCTATGGCCAGCTGATGCAGG + Intergenic
944105747 2:196077429-196077451 AGTCTGTGGCCAGCACATCCTGG - Intergenic
944447349 2:199805013-199805035 TGGCACTGCCCAGCTGATGCTGG + Intronic
945068495 2:205967523-205967545 AGTGTCTGGACTGCAGATGCTGG - Intergenic
945292048 2:208136324-208136346 AGGCTCTGACATTCAGATGCTGG + Intergenic
947918567 2:233850414-233850436 AGGCTCTGGAGAGCTGAAGCAGG - Intronic
949062076 2:241967104-241967126 TGGCTCTGGCCAGGGGACGCTGG + Intergenic
1169053895 20:2604095-2604117 AGGCACTGGCCAGCAGAAGTGGG + Intronic
1169254926 20:4089861-4089883 AGGCTTTTGCAATCAGATGCTGG + Intergenic
1171352930 20:24518618-24518640 ACGCTCTGGGCAGAAGGTGCTGG + Intronic
1171386033 20:24770020-24770042 GGGCTTTGGCCAGCACTTGCTGG + Intergenic
1172749533 20:37240552-37240574 AGGCTCCAGCAAGCAGAGGCAGG - Intronic
1174209372 20:48865229-48865251 AGCCTTTGGCCAGCAGTTTCAGG + Intergenic
1175218614 20:57404584-57404606 GAGCTCTGGCCAGCGGAGGCAGG - Intronic
1175228851 20:57460911-57460933 AGGCCCTGGCCCGCAGACTCAGG - Intergenic
1175305677 20:57974038-57974060 AGGGTCAGGCCACCAGGTGCTGG + Intergenic
1175530811 20:59673373-59673395 AGGCGTTGGGCACCAGATGCAGG + Intronic
1175889153 20:62308484-62308506 TGGCTCTGGCCTGGAGGTGCAGG - Intronic
1176058729 20:63162487-63162509 AAGCTCGGGCGGGCAGATGCCGG + Intergenic
1179560942 21:42215760-42215782 AGGCCCTGGCCAGCCAATGATGG - Intronic
1181974856 22:26721707-26721729 GGTCTCTGCCCAGCAGACGCTGG - Intergenic
1182321693 22:29481872-29481894 AGGCTGTGCCCAGCAGCTGCAGG + Intronic
1182775924 22:32830889-32830911 AGGCTGAGGCCAGCAGATCGCGG - Intronic
1182861969 22:33568114-33568136 GGGCCCAGGCCAGCAGATGCTGG + Intronic
1183320083 22:37159881-37159903 AGGCTTTGGGCTGCAGATGCAGG - Intronic
1183371392 22:37434559-37434581 AGGCTGTGGCCACGAGACGCTGG + Intergenic
1184301937 22:43566584-43566606 AAGCTCCTGCCAGCAGGTGCTGG + Intronic
1184661576 22:45967866-45967888 AGGCTCCAGCCAGCAGTTGGAGG - Intronic
1184734693 22:46391232-46391254 GGTCTGTGGCCACCAGATGCCGG + Exonic
1184749950 22:46479538-46479560 TGCCTCTGGGCAGGAGATGCTGG + Intronic
1184865655 22:47200609-47200631 GGGCTCGGGCCAGCAGATGTGGG + Intergenic
1184974068 22:48048338-48048360 AGGATCTGGGCAGCCCATGCTGG - Intergenic
1185128447 22:49024554-49024576 AGGGTCTGGCCAGGAGATGCTGG - Intergenic
1185344141 22:50304100-50304122 AGGATCTGGGCTGCAGAGGCGGG + Intronic
952223861 3:31353376-31353398 TGACTAAGGCCAGCAGATGCAGG - Intergenic
953687997 3:45093379-45093401 AGGCTCTATCAAGCAGATCCAGG - Exonic
956137010 3:66109343-66109365 AGGCCTTGGCCAGCTGAGGCAGG - Intergenic
959241969 3:103808306-103808328 AGGCTGGGGCCAGCAGATCAAGG - Intergenic
961678905 3:128585465-128585487 AGTCTGTGGCCACCAGAAGCTGG + Intergenic
962008320 3:131370015-131370037 TGGCTCTGGCCAGCAACTCCAGG - Intergenic
962457030 3:135573996-135574018 TGGCTCTTGCCACCACATGCAGG + Intergenic
963264157 3:143222635-143222657 GGGTTCTGGCCATCAGATGCAGG + Intergenic
963997322 3:151725026-151725048 AGTCTGTGGCCAGCACATCCTGG - Intergenic
966488316 3:180497252-180497274 AGACGCTGGACAGCAGATGTAGG + Intergenic
966833721 3:184032926-184032948 AGGCTTTGGCCAGCACAGGGTGG + Exonic
968464257 4:742643-742665 AGGTTCTGGCCAGCTCTTGCTGG + Intronic
968473053 4:790639-790661 AGGATCATGCCAGCAGAGGCCGG + Intronic
969213464 4:5706011-5706033 AGTCTCTGGCCCCCTGATGCTGG - Intronic
969583224 4:8077456-8077478 AGGCCCTGGACAGCTGATGAGGG + Intronic
969856224 4:10001962-10001984 AGGCTCAGCCAATCAGATGCTGG + Intronic
971105514 4:23520032-23520054 AGGCTCTGGCCATAAGATGTTGG - Intergenic
975504734 4:75125255-75125277 ATGCTCTGGCCGTCAGATGATGG - Intergenic
976083793 4:81386585-81386607 AAGCTCTGGCCAGCACAATCAGG + Intergenic
976329506 4:83813270-83813292 AGTCTCTGCCCACTAGATGCCGG + Intergenic
980239454 4:130154449-130154471 AAGCTCTGGGGAGCAAATGCTGG - Intergenic
982139235 4:152301870-152301892 AGGCTGTGGCCAGCTGAGGCAGG - Intergenic
982669124 4:158299034-158299056 AGGGTCTGACCTGCAGACGCTGG - Intergenic
983698632 4:170564287-170564309 AGGCACTGGACAGCAGAGGCAGG + Intergenic
985315221 4:188651432-188651454 AGGGTCACGCAAGCAGATGCTGG - Intergenic
985544903 5:504643-504665 AGGCACTGCCCAGCAGCTGAGGG - Intronic
986712056 5:10494857-10494879 TGGGTCTGGCCTGCAGATCCTGG - Intergenic
987925555 5:24336492-24336514 AGTCTGTGGCCAGCACATCCTGG - Intergenic
991638514 5:68730694-68730716 ATGCTCTGCCCAGCAGATCTAGG + Intergenic
992199635 5:74370605-74370627 ACTCTCTGGCCAGCAAATGGGGG + Intergenic
994098829 5:95872774-95872796 AGGCTGTGGACAGCAGGTCCTGG - Intergenic
995198674 5:109401325-109401347 TGGCTCAGGCCTGCAAATGCAGG + Intronic
995662532 5:114500940-114500962 AGGCTGTGGTCAGCAGATTGTGG + Intergenic
995804443 5:116035791-116035813 AGGCTCTGGCCAGCTGCCGCTGG + Intronic
995863649 5:116667055-116667077 AGGAGCTGGCCAGCAAATGTGGG + Intergenic
997412020 5:133697693-133697715 AGGCTCTGGCCCTCAGAGGCAGG + Intergenic
999192683 5:149760246-149760268 GGGCTCTGGGCAGCAGTTCCTGG + Intronic
999830327 5:155312879-155312901 TGGTTCTGGCCAGCTGATGGAGG - Intergenic
1001176148 5:169470682-169470704 AGGCTCTCACCAGAAGATGCTGG + Intergenic
1001299271 5:170522287-170522309 AGGCTCTGACCATCTGCTGCAGG - Intronic
1001329562 5:170752641-170752663 AGGCTGTGGGTAGCAGAGGCTGG - Intergenic
1001716160 5:173818023-173818045 AGGCCATGTCCAGCAGGTGCAGG + Intergenic
1002311800 5:178319560-178319582 AGGCACTTGCCAGGAGAAGCTGG + Intronic
1002501656 5:179651087-179651109 GAGCACTGGCCAGCAGATGAGGG - Intergenic
1003175362 6:3750033-3750055 AGGCTCTGGGGAGCAGAGGGAGG + Intronic
1006616048 6:35327636-35327658 AGCCTCTAGCCAGCAGGTGGGGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1014150020 6:118044069-118044091 AGGCACTGGCCTGCACCTGCAGG - Intronic
1017091064 6:150759509-150759531 AGGCTATTGTCAGCAGATCCTGG + Intronic
1017912685 6:158807859-158807881 ATGCTCTGGAAAGGAGATGCTGG - Intronic
1019707909 7:2505134-2505156 CGCCCCTGCCCAGCAGATGCGGG - Intergenic
1019971210 7:4542412-4542434 AGCCTCTGTCCAGCAGAGCCAGG + Intergenic
1021111191 7:16696676-16696698 TAGCTCTGGCCAGGAGCTGCTGG - Intronic
1021640326 7:22730153-22730175 AGGCTTTGGCCACCAGTAGCTGG + Intronic
1023912792 7:44567366-44567388 AGGCTGTGGGCAGCAAGTGCAGG - Intronic
1025012168 7:55406306-55406328 ACGCTCTGGCCAGCCTATGAAGG - Intronic
1025908667 7:65810016-65810038 AGGTCCTCACCAGCAGATGCTGG - Intergenic
1025980229 7:66399217-66399239 AGGTCCTCACCAGCAGATGCTGG + Intronic
1026043300 7:66886901-66886923 AGGTCCTCACCAGCAGATGCTGG - Intergenic
1027333839 7:77127225-77127247 AGGCCCAGGTCAGCAGCTGCTGG + Intronic
1027486548 7:78768990-78769012 AAGCTCCAGCCAGCAGAGGCAGG - Intronic
1029960812 7:104687712-104687734 ATGCTCTGGCTTCCAGATGCTGG - Intronic
1030338520 7:108350960-108350982 AGGCTCTGTTCAGCATATGAGGG - Intronic
1032256360 7:130300201-130300223 AGGCACTGGATACCAGATGCGGG + Intronic
1033228059 7:139576363-139576385 AGACTCTGGCCAGCAGCTCTGGG + Intronic
1034562533 7:151890479-151890501 AGGCTCTGGGCAGCAGAGCAGGG + Intergenic
1034864579 7:154630206-154630228 AGGCTGAGGCCAGCAGAAGAGGG - Intronic
1034875286 7:154719989-154720011 AGGTTCTGGGAAGCAGATGCAGG - Intronic
1035013289 7:155739971-155739993 AGCCTCAGGCCAGCAGCAGCCGG + Exonic
1035039843 7:155919679-155919701 AGGCTCGGGGCAGGAGAGGCTGG + Intergenic
1035745551 8:1960006-1960028 AGGGTCTACCCAGCAGATGGGGG - Intergenic
1035785123 8:2253931-2253953 AGGCTCTGGGTAGCAGATGCTGG - Intergenic
1035807688 8:2467785-2467807 AGGCTCTGGGTAGCAGATGCTGG + Intergenic
1036500983 8:9313726-9313748 AGGCAATGGCCAGGAGAGGCAGG - Intergenic
1036696634 8:10979353-10979375 AGGCTCGGGTCAGCAGCTACAGG + Intronic
1036911997 8:12765492-12765514 AGTCTGTGGCCAGCACATCCTGG - Intergenic
1038101967 8:24387829-24387851 TGGCTCTGTCCTGCAGACGCTGG + Intronic
1038666654 8:29543379-29543401 ATGCTCTGTCCACCAGAAGCTGG + Intergenic
1040466281 8:47698362-47698384 AGTCTATGCCCAGCAGAGGCGGG + Intronic
1041463633 8:58138051-58138073 AGGGTCTGCCCAGTAGAGGCTGG - Intronic
1044599686 8:93991425-93991447 AGGCTCAGGGCAGCAGAAGAGGG + Intergenic
1046252688 8:111653337-111653359 AGTCTATGGCCAGCACATCCTGG + Intergenic
1047460276 8:125057212-125057234 GGGCTCTGACCGGGAGATGCTGG + Intronic
1048369951 8:133768627-133768649 AAGCCCCAGCCAGCAGATGCTGG + Intergenic
1049883235 9:12134-12156 TGGCACAGGCCAGCAGTTGCTGG - Intergenic
1051565799 9:18496744-18496766 AGGCTCTGGAAAGCACATGTTGG - Intronic
1053461751 9:38276960-38276982 GGGGTCTGACCTGCAGATGCAGG - Intergenic
1057281639 9:93716865-93716887 ATCCTCTGCCCAGCAGAAGCAGG - Intergenic
1057411406 9:94819374-94819396 AGTGTGTGGCCAGCAGCTGCGGG + Intronic
1057706255 9:97397041-97397063 TGTCTCTGGGAAGCAGATGCTGG - Intergenic
1057727321 9:97577129-97577151 AGTCTCTGGGCAGCAGAGCCAGG - Intronic
1058895440 9:109396942-109396964 TGGCTCTAACCAGCGGATGCTGG + Intronic
1059157067 9:111999582-111999604 AGGCCCGACCCAGCAGATGCTGG + Intergenic
1059981825 9:119781504-119781526 TGGTTCTGGCCAGTAGATGTGGG - Intergenic
1061288650 9:129638619-129638641 ATGCTCTGGCCAGCAGCGACGGG - Exonic
1061645952 9:132002024-132002046 AGGGACTAGCCAGCTGATGCAGG - Intronic
1061969262 9:134035146-134035168 AGGCTCTGCCCTGCACATGAGGG - Intronic
1062025212 9:134337096-134337118 AGGCTCTGTCCAGCAGCCGGTGG - Intronic
1185781139 X:2847909-2847931 GGGCTCCGCCCACCAGATGCCGG + Intronic
1187065138 X:15827391-15827413 AGACTCTGGTAAGCAGATCCAGG + Intronic
1188245099 X:27829748-27829770 AGACTCAGGCCAGCAGAAGGAGG + Intergenic
1188864540 X:35299393-35299415 AGGCTGTTGCCAGAAGATGGAGG - Intergenic
1188892003 X:35623038-35623060 TGGTTCTGTCCTGCAGATGCTGG - Intergenic
1189245830 X:39562614-39562636 AGGCCCTCACCAGAAGATGCCGG - Intergenic
1189375035 X:40459916-40459938 AGATTCTGGGCAGCTGATGCCGG - Intergenic
1189859674 X:45259550-45259572 AGGGTGTGGCCAGCAGTTGAAGG - Intergenic
1197641219 X:128970310-128970332 AGTCTCTGGCCATCTGAGGCTGG + Intergenic
1198040812 X:132850332-132850354 GGTCTCTGGCCACCAGATGAAGG + Intronic
1200272680 X:154700796-154700818 TTGCTCTGGCCACCACATGCTGG - Intronic
1200402578 X:156028014-156028036 TGGCACAGGCCAGCAGTTGCTGG + Intergenic
1200941185 Y:8783650-8783672 AGGCTCTGTCCAGCAGAAAATGG - Intergenic
1200953529 Y:8923324-8923346 AGGCTCTGTCCAGCAGAAAATGG + Intergenic
1202231631 Y:22664676-22664698 AGGCTCTGTCCAGCAGAAAATGG + Intergenic
1202311527 Y:23531489-23531511 AGGCTCTGTCCAGCAGAAAATGG - Intergenic
1202559275 Y:26139105-26139127 AGGCTCTGTCCAGCAGAAAATGG + Intergenic