ID: 1124136172

View in Genome Browser
Species Human (GRCh38)
Location 15:27038107-27038129
Sequence GTGGCCAACCGGACTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124136172_1124136176 -1 Left 1124136172 15:27038107-27038129 CCCATCTCAGTCCGGTTGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136172_1124136177 0 Left 1124136172 15:27038107-27038129 CCCATCTCAGTCCGGTTGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124136172 Original CRISPR GTGGCCAACCGGACTGAGAT GGG (reversed) Intronic
900812683 1:4819732-4819754 GTGGCCATCTGGTCTGAGTTAGG + Intergenic
901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG + Intronic
909500179 1:76326096-76326118 GTTGCCATCCAGGCTGAGATCGG + Intronic
912249242 1:107993656-107993678 GTTGGCAACCGGAATGAGAGGGG - Intergenic
916635285 1:166661725-166661747 GTGGCCAACCACACTGAGGGTGG - Intergenic
918924031 1:190756726-190756748 GTGCCCACCCTGACTGAGAATGG - Intergenic
1068663651 10:59649414-59649436 CTGGCCACAGGGACTGAGATAGG + Intergenic
1071823001 10:89297129-89297151 GTGGCCAGCTTGGCTGAGATTGG + Intronic
1071992518 10:91113824-91113846 GTGGCAAACGGGACTTAGAAGGG + Intergenic
1072816558 10:98515125-98515147 GTGGTCAAGCCGACTGAGAGTGG + Intronic
1073454228 10:103626938-103626960 TGGGCCAACCTTACTGAGATGGG + Intronic
1074531147 10:114299724-114299746 GTGCCCACCCAGACTGAGAGCGG - Intronic
1080393696 11:31871218-31871240 GTGGCCAAACGCACAGGGATAGG - Intronic
1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG + Intronic
1080678564 11:34451071-34451093 GTGGAGAACCGAACTGCGATGGG - Exonic
1084788576 11:71458693-71458715 GTGGCTTACGGGGCTGAGATAGG - Intronic
1087690944 11:101320220-101320242 GTGGCCATCACCACTGAGATTGG + Intergenic
1087956157 11:104290105-104290127 GTGGACAACCTGAATGAGCTTGG - Intergenic
1089965618 11:122652810-122652832 GTGGCCAAAAGAAGTGAGATGGG - Intergenic
1092998829 12:13976910-13976932 GTGGGCAAATGGACTGAAATTGG - Intronic
1102622096 12:114204240-114204262 AGGGCCAACCTGACTGGGATTGG - Intergenic
1103046052 12:117735372-117735394 GTGGCCAAGCGGAGAGAGAAGGG + Intronic
1107762146 13:43691285-43691307 ATGGGCACCCGGACTAAGATAGG - Intronic
1114038505 14:18653152-18653174 GTGACCACCCAGACTGAGAGTGG + Intergenic
1116269518 14:42743048-42743070 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1127581322 15:60341666-60341688 GTGTCAAATCAGACTGAGATTGG + Intergenic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1129443263 15:75598015-75598037 GTAGCCCAGGGGACTGAGATGGG + Intergenic
1130371635 15:83289499-83289521 GTGGCCCACAGAACTTAGATTGG - Intergenic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1141275743 16:82586533-82586555 GTGCCCACCCAGACTGAGAGTGG - Intergenic
1144142162 17:12360161-12360183 GTGGCCAATCCGACTGAGGTAGG + Intergenic
1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG + Intronic
1151943904 17:77308987-77309009 GTGCCCAACATGACTGCGATGGG - Intronic
1155319082 18:24601192-24601214 GTGGCCAAATGTACTGAGATTGG - Intergenic
1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG + Intronic
1157416873 18:47510776-47510798 GTGGCCTAGAGGACTGAGAGTGG - Intergenic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG + Intergenic
1166417339 19:42605656-42605678 GTGGGCAACAGGTTTGAGATTGG + Intronic
1167744936 19:51345221-51345243 GTGGCCAAGCTGAAGGAGATTGG - Exonic
1167748294 19:51365684-51365706 GGAGCCAACCTGACTGAGCTGGG - Intronic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
933245678 2:79972081-79972103 GGGGCCAACCAGACTCAGAGAGG + Intronic
936372148 2:111911122-111911144 GTTGCCACCCTGAATGAGATTGG + Intronic
942802556 2:179892413-179892435 GTGCCCATCCTTACTGAGATTGG - Intergenic
947794706 2:232886981-232887003 GTGGCCAACTGGTCTGGGAAAGG + Intronic
948348524 2:237319481-237319503 GTGCCCAAACAGACTGAGGTGGG - Intergenic
1175768275 20:61606208-61606230 GTGGCCAAGCAGACAGAGAATGG + Intronic
1179963850 21:44788757-44788779 GTGGGCAACCAGAGTGAGACTGG + Intronic
1184116840 22:42427156-42427178 GTGGGCAACAGGACCCAGATGGG - Intronic
952953688 3:38543714-38543736 GTGGCCATCAGGGCTGATATCGG + Intergenic
958743673 3:98107770-98107792 ATGGCCAACCAAACTAAGATTGG - Intergenic
959775107 3:110150195-110150217 GTGCCCACCCAGACTGAGAGCGG - Intergenic
966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG + Intronic
969177261 4:5408133-5408155 CAGCCCAAACGGACTGAGATGGG + Intronic
972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG + Intergenic
984400701 4:179260511-179260533 GTGCCCAACCAGATTGAGAGTGG - Intergenic
987854292 5:23398702-23398724 TTGGCAAAGCTGACTGAGATTGG + Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
990921592 5:60974121-60974143 GTGCCCACCTGGACTGAGAGTGG - Intronic
993402209 5:87467514-87467536 GTGGCCAGCTTGGCTGAGATTGG - Intergenic
997762660 5:136464359-136464381 GTGGCCAGACTGACTGAGTTGGG - Intergenic
1007278499 6:40693014-40693036 GTGGTGAACTGAACTGAGATGGG - Intergenic
1009678127 6:66854355-66854377 GTGCCCAATCAGACTGAGGTTGG - Intergenic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1018900502 6:168049640-168049662 GTGGCCAAACGGCCTGAGGGAGG - Intergenic
1021147400 7:17106165-17106187 GTGGCCACCCACACTGAGAGTGG + Intergenic
1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG + Intronic
1021958240 7:25847817-25847839 TTGGCCAACCAGCCTGAAATGGG + Intergenic
1028638265 7:93015409-93015431 GTTGCCACCCGGGCTTAGATGGG - Intergenic
1032890610 7:136191167-136191189 GTGCCCACCCAGACTGAGGTTGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1042689596 8:71483399-71483421 GTGGCAAACCTGATTGTGATTGG - Intronic
1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG + Intergenic
1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG + Intergenic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1050110839 9:2214129-2214151 GTGAGAAACAGGACTGAGATAGG + Intergenic
1059827928 9:118053336-118053358 GTGAACAACCAGAATGAGATTGG - Intergenic
1062168769 9:135122609-135122631 GTGGCCACCCCGACTGGGAGAGG - Intergenic
1188982197 X:36736416-36736438 ATGGCCAACCACACTGAGAAGGG - Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1192539813 X:71958276-71958298 GTGGCCAAATGGACTTAGCTGGG + Intergenic
1193135807 X:77969534-77969556 GTGGCCCGCCGGGCTCAGATCGG + Exonic