ID: 1124136176

View in Genome Browser
Species Human (GRCh38)
Location 15:27038129-27038151
Sequence CTGTAACAAATACCTTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 854
Summary {0: 1, 1: 7, 2: 56, 3: 199, 4: 591}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124136167_1124136176 10 Left 1124136167 15:27038096-27038118 CCCAGAACAGCCCCATCTCAGTC 0: 1
1: 0
2: 2
3: 15
4: 221
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136171_1124136176 0 Left 1124136171 15:27038106-27038128 CCCCATCTCAGTCCGGTTGGCCA 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136172_1124136176 -1 Left 1124136172 15:27038107-27038129 CCCATCTCAGTCCGGTTGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136165_1124136176 28 Left 1124136165 15:27038078-27038100 CCATGCTCCGTAACTAGTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136166_1124136176 21 Left 1124136166 15:27038085-27038107 CCGTAACTAGTCCCAGAACAGCC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136168_1124136176 9 Left 1124136168 15:27038097-27038119 CCAGAACAGCCCCATCTCAGTCC 0: 1
1: 0
2: 0
3: 23
4: 193
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591
1124136173_1124136176 -2 Left 1124136173 15:27038108-27038130 CCATCTCAGTCCGGTTGGCCACT 0: 1
1: 0
2: 2
3: 6
4: 66
Right 1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG 0: 1
1: 7
2: 56
3: 199
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124136176 Original CRISPR CTGTAACAAATACCTTAGAC TGG Intronic
902096158 1:13947626-13947648 CCGTAACAAATACTTCAGACTGG + Intergenic
902111837 1:14085760-14085782 CTTTAATAAATACCTTGGAATGG + Intergenic
902138992 1:14335687-14335709 CTGTAAGAAATACCTGAGGCTGG - Intergenic
904293828 1:29505035-29505057 CTATAACAAATACCATTGACTGG + Intergenic
904553976 1:31345598-31345620 CTATAAGAACTACCTGAGACTGG + Intronic
905364142 1:37439604-37439626 CTATAACTAATACCACAGACTGG + Intergenic
906651875 1:47518519-47518541 CTATAACAAATGCCTTAGACCGG - Intergenic
906991629 1:50745746-50745768 CTATAAAAAATACCCGAGACTGG - Intronic
907632854 1:56101415-56101437 CCATAACAAATACCACAGACTGG + Intergenic
907745986 1:57214069-57214091 CTAAAACAAATACTTGAGACAGG + Intronic
908932945 1:69339588-69339610 CTTTAAGAAATACCTAAGACTGG - Intergenic
909664956 1:78122394-78122416 CTGTAAAGAATACCTGAGACTGG + Intronic
909955537 1:81774114-81774136 CCATAACAAATACCACAGACAGG - Intronic
910041404 1:82856008-82856030 CTATAACAAATACTTTAAACTGG - Intergenic
910186196 1:84543349-84543371 CTATAAAAAATACCTGAGACTGG + Intergenic
910414157 1:86980946-86980968 CTATAAAAAACACCTGAGACTGG + Intronic
910414498 1:86983263-86983285 CTGTAAAGAATACCTGAGACTGG + Intronic
910611084 1:89142832-89142854 TTGCTACAAATACCTGAGACTGG + Intronic
910705697 1:90127202-90127224 CTATAAAAAATACCTGAAACTGG - Intergenic
910723686 1:90315224-90315246 CTGTAACAAGTACCATGGACTGG + Intergenic
910785683 1:90995977-90995999 CTGTAACAAGTACTATAGACTGG - Intronic
910988085 1:93026156-93026178 CCATAACAAATACCATAGACTGG + Intergenic
911317726 1:96375583-96375605 CTATAATAAATACCTTAGACTGG - Intergenic
911541493 1:99163230-99163252 CTGTTATAAATATCTGAGACTGG + Intergenic
911864152 1:102994577-102994599 CTATAAGAAATACCTGAGACTGG - Intronic
911889772 1:103353475-103353497 CTATAACAAATACCATAAACTGG - Intergenic
912019286 1:105086222-105086244 CAGAAACAAATACATTAGATAGG + Intergenic
912039517 1:105370413-105370435 CTACAACAACTACCTGAGACTGG + Intergenic
912092230 1:106093386-106093408 CTCTAACAAATATCATAAACTGG - Intergenic
912222904 1:107698689-107698711 CAGGAAGAAATACCTGAGACTGG + Intronic
912807394 1:112768107-112768129 CTGTAGCAGATACCTCTGACTGG - Intergenic
912975042 1:114321754-114321776 ATATATCAAATACCTTAGAATGG - Intergenic
913348378 1:117830363-117830385 CTATAAAAAATACCTGTGACTGG - Intergenic
915718737 1:157967940-157967962 CTATGACAAATACCATAGACAGG - Intergenic
916386773 1:164281874-164281896 CTATCACAAATGCCTGAGACTGG - Intergenic
916797894 1:168184628-168184650 CTGTAAGAAAAACCTTGTACTGG + Intronic
916910424 1:169340430-169340452 CTGTAAAGAATACCTGAAACTGG - Intronic
917284290 1:173408118-173408140 CTATAACAAATATCATAGACTGG - Intergenic
917477324 1:175379898-175379920 CTGTGACAAATTCCTTGGGCAGG + Intronic
917694422 1:177507061-177507083 CTGTAACAAATACCTAAAAATGG - Intergenic
918121355 1:181543700-181543722 CTTTAAAAAATACCATACACTGG - Intronic
918491591 1:185087178-185087200 CTATAAAAAATACTTTAGGCTGG + Intronic
918791388 1:188834703-188834725 CTATAACAAATATCTGAGATTGG - Intergenic
918823513 1:189291326-189291348 CTATAAAAAATACTTGAGACTGG + Intergenic
918918753 1:190676936-190676958 CTATAAACAATACCTGAGACTGG - Intergenic
919317339 1:195988638-195988660 CTTAAAGAAATACCTAAGACTGG - Intergenic
920830450 1:209460218-209460240 CTATAACAAAAACCATAAACTGG - Intergenic
920890859 1:209984677-209984699 CTGCTATAAATACCTGAGACTGG + Intronic
921541190 1:216417794-216417816 CTATAAAAAATACCGGAGACTGG - Intronic
921674476 1:217962931-217962953 CTGTAATAAGTACCATAGACTGG + Intergenic
921741200 1:218687211-218687233 CTATAACAAATACCACAGACTGG + Intergenic
922439330 1:225639654-225639676 CTATAACAGATACCACAGACTGG - Intronic
924240162 1:242032687-242032709 CTATAACAAAGATCTTAAACTGG + Intergenic
924610003 1:245565787-245565809 CTATAAAAAATACCTAAGGCTGG + Intronic
1062895811 10:1102393-1102415 CTATAAAAAATACTTGAGACAGG + Intronic
1063544316 10:6965304-6965326 CTGTAACAAATACCACACGCTGG + Intergenic
1063849308 10:10166552-10166574 CTTTAACATTTACCTTAGATTGG + Intergenic
1064235725 10:13572847-13572869 CCGTAAAAAATATCTTAGGCTGG - Intergenic
1064286489 10:13995958-13995980 CTATAACAAATCCCATAAACTGG + Intronic
1064352236 10:14586719-14586741 CTGTAACAAATACCACAGACGGG - Intronic
1064577928 10:16764640-16764662 CTGTAAAAAATAAATAAGACCGG - Intronic
1064823881 10:19372854-19372876 GTATAACAAATACGTAAGACTGG + Intronic
1064868787 10:19913432-19913454 CTATAAAAAATACCTAATACTGG - Intronic
1064871153 10:19938323-19938345 TTGTTATAAATACCTAAGACTGG + Intronic
1065317612 10:24479620-24479642 CTATAAAAAATACCTGAGACTGG + Intronic
1065505771 10:26428808-26428830 CATTAAGAAATACCTGAGACGGG + Intergenic
1065667172 10:28074917-28074939 CTATAAAGAATACCTGAGACTGG + Intronic
1066041166 10:31549095-31549117 CTATAAAAAATACCTGAGACTGG - Intergenic
1066253039 10:33652703-33652725 CTATAACAAATACCTGAGACTGG + Intergenic
1067024704 10:42834453-42834475 CTTTAAGAAATACCTGAGTCTGG - Exonic
1067291858 10:44949547-44949569 CCATAACAAATACCATACACTGG + Intergenic
1067822345 10:49540989-49541011 CCATAACAAATGCCATAGACTGG + Intergenic
1067826974 10:49583178-49583200 CTGTAAAGAATACCTGAGACTGG + Intergenic
1067944425 10:50681258-50681280 CCGTAACGAATGCCATAGACTGG + Intergenic
1068355935 10:55908205-55908227 CTATAAAGAATACCTTGGACTGG + Intergenic
1068385312 10:56318459-56318481 CTATAACAAATACTGTTGACTGG - Intergenic
1068484883 10:57645084-57645106 CTCTAAGAACTACCTGAGACTGG - Intergenic
1068590491 10:58848026-58848048 CTGTACAAAATACCTGAGACTGG - Intergenic
1068639168 10:59382634-59382656 CTATAACAAATATCATACACTGG - Intergenic
1069336758 10:67360542-67360564 CTATAAAGAATACCTGAGACTGG + Intronic
1069361929 10:67652991-67653013 CTATAAGAAATACCTGAGATTGG + Intronic
1069390877 10:67933249-67933271 CTTTAACAAATGCCTAAGAGAGG + Intronic
1069789554 10:71010948-71010970 CTGTAAAGAATACCTGAGACTGG + Intergenic
1069803806 10:71104179-71104201 CCGTAACAAGTACCAAAGACTGG + Intergenic
1070487092 10:76941776-76941798 CTGTAACAAACACCATAATCTGG + Intronic
1070865925 10:79708129-79708151 CCGTAACGAATGCCGTAGACTGG + Intronic
1070879719 10:79846260-79846282 CCGTAACGAATGCCGTAGACTGG + Intronic
1070937593 10:80313505-80313527 CTATAAAAAATACCTGAGGCTGG + Intergenic
1071302142 10:84263915-84263937 CTGTAACAAAATACATAGACTGG - Intergenic
1071632825 10:87230350-87230372 CCGTAACGAATGCCGTAGACTGG + Intronic
1071646274 10:87362568-87362590 CCGTAACGAATGCCGTAGACTGG + Intronic
1071880057 10:89887672-89887694 CTATAATAAATACCATAGACTGG + Intergenic
1071888655 10:89978451-89978473 CTGAAACAAATACCACAGACAGG - Intergenic
1071989981 10:91092322-91092344 ATAAAACAAATACCTGAGACTGG + Intergenic
1072860567 10:98999971-98999993 CTAAAACAAACACCTCAGACTGG - Intronic
1073629210 10:105131604-105131626 TTGTTATAAATACCTGAGACTGG + Intronic
1073947254 10:108765538-108765560 CTGCAATAAATACCTAATACAGG + Intergenic
1074112584 10:110433075-110433097 CTGTAACAAACACCACAGACTGG - Intergenic
1074939157 10:118217893-118217915 CTACAATAAATACCTTAGACTGG + Intergenic
1075053147 10:119198227-119198249 CTGTAACAAGTTCCATAGACTGG + Intergenic
1075217760 10:120553536-120553558 CTATAACAAATACCATACACTGG - Intronic
1076290325 10:129340755-129340777 CAATAACAAATACCACAGACTGG + Intergenic
1076422364 10:130340466-130340488 CGGTAACAGATACCACAGACTGG + Intergenic
1076842307 10:133051782-133051804 CTATAAGAAATACCTAAGACTGG + Intergenic
1077594191 11:3517455-3517477 CTATAAAAAATACCTGAGACTGG - Intergenic
1077730612 11:4725231-4725253 CTGCTATAAATACCTGAGACTGG - Intronic
1078592633 11:12658099-12658121 CCGTAACAAACACCATAGACTGG + Intergenic
1078780072 11:14429771-14429793 CTTTAAAAGATAGCTTAGACTGG - Intergenic
1078918965 11:15809059-15809081 TTTTAAAAAATACCATAGACGGG - Intergenic
1079293024 11:19205632-19205654 ATGTAACAAATGCCATAGACAGG + Intronic
1079732295 11:23949949-23949971 CTATAAAGAATACCTGAGACTGG + Intergenic
1079795929 11:24803005-24803027 CTATAACAAATACCACAGACTGG - Intronic
1079962758 11:26944201-26944223 CAATAACAAATACTTCAGACTGG - Intergenic
1080306549 11:30843351-30843373 CTGCTATAAATACCTGAGACTGG + Intronic
1080577408 11:33612573-33612595 CTATAAAAAATACCTGAGACTGG + Intronic
1080890579 11:36405685-36405707 CCATAACAAATACCATAGACTGG + Intronic
1081016185 11:37884354-37884376 CTGTAACAAAAACCATAAACTGG + Intergenic
1081234104 11:40625283-40625305 CTGTAAGAAATACCCAAGACTGG + Intronic
1081439123 11:43061121-43061143 ATGAAAACAATACCTTAGACTGG + Intergenic
1081440911 11:43079917-43079939 CTGTACCACATACTCTAGACGGG - Intergenic
1082041334 11:47687763-47687785 AAGAAAGAAATACCTTAGACTGG - Intronic
1082222293 11:49654028-49654050 CTTTTACAAACACCTTAGACAGG - Intergenic
1083043179 11:59707978-59708000 CTATAATAAATACCTGAGACTGG + Intergenic
1083464136 11:62834033-62834055 CTGCAACAAAACCCTGAGACTGG + Intronic
1085698607 11:78726881-78726903 TTGTTATAAATACCTGAGACTGG - Intronic
1085832640 11:79917836-79917858 CCATAACAAATACCACAGACTGG + Intergenic
1085911472 11:80832103-80832125 CTATAAAAAATGCCATAGACTGG + Intergenic
1086520749 11:87665430-87665452 CTGTAAAAAATACCTGAGACTGG + Intergenic
1086626749 11:88965171-88965193 CTTTTACAAATACCTTAGACAGG + Intronic
1087101179 11:94366624-94366646 CTATAACTAATACATCAGACTGG + Intergenic
1087186557 11:95204783-95204805 CTATAACAAAAACCAAAGACTGG - Intronic
1087512698 11:99117915-99117937 CTATAACAAATAGCATGGACTGG - Intronic
1087827499 11:102782404-102782426 CTATCAAAAATACCTGAGACTGG - Intergenic
1088202209 11:107350622-107350644 CTATAAAAAATACCGTAGACTGG - Intronic
1088942669 11:114476489-114476511 CTATAAAGAATACCTGAGACTGG + Intergenic
1089394003 11:118123090-118123112 CTGCTCTAAATACCTTAGACTGG - Intergenic
1090151111 11:124385571-124385593 ATGTAACAAAAACCTAAGTCAGG + Intergenic
1090174110 11:124632550-124632572 CTACAACAAATACCATAGACAGG + Exonic
1090410379 11:126503963-126503985 CTATAACAAATACTATAGACTGG - Intronic
1090490731 11:127158526-127158548 CTGTAAAGAATACCTGAGACCGG + Intergenic
1090834531 11:130444500-130444522 CTCTGACAAAAACCTTAGCCTGG - Intergenic
1091860276 12:3775077-3775099 CTATAAAGAATACCTGAGACTGG - Intergenic
1091933264 12:4414456-4414478 CTGTAACAAATATCATACACTGG - Intergenic
1092128963 12:6095206-6095228 CTATAACAAATGCCTGAGACTGG - Intronic
1093120389 12:15264272-15264294 CTGTAACAAAGACCACAAACTGG - Intronic
1093280209 12:17184892-17184914 CAGAAAGAAATACCTGAGACTGG - Intergenic
1093725143 12:22498243-22498265 GTGTAAGAATTACCCTAGACTGG + Intronic
1094053995 12:26249958-26249980 CTGTAACAAATACCACAAACTGG - Intronic
1094209602 12:27875170-27875192 CTATAAAAAATATCTGAGACAGG + Intergenic
1094378956 12:29821890-29821912 CTATAACAAATTCATTAGACTGG + Intergenic
1095199193 12:39362237-39362259 CTGCCATAAATACCTGAGACTGG - Intronic
1095208119 12:39461510-39461532 CCATAGCAAATACCTTAGATTGG - Intergenic
1095226834 12:39687287-39687309 CTATAAAAAATACTTGAGACTGG + Intronic
1095482746 12:42652615-42652637 CTATAACAAACACCACAGACAGG - Intergenic
1096321047 12:50613087-50613109 CTGTCACAAAGACCTTAGAGAGG + Intronic
1097152093 12:56986724-56986746 CTATAATAAATACCTGAGACTGG - Intergenic
1097308894 12:58097397-58097419 CTATAAAAGATACCTTAGATTGG + Intergenic
1097326313 12:58281356-58281378 CTGCTATAAATACCTGAGACTGG + Intergenic
1097979684 12:65725058-65725080 AAATAATAAATACCTTAGACTGG - Intergenic
1098152490 12:67561463-67561485 CCGTAACAAGTACCATAGACTGG + Intergenic
1098571100 12:71988324-71988346 CTATAAAAAATACCCGAGACTGG + Intronic
1098771390 12:74558309-74558331 CTATAAAAAATACCTGAGACTGG + Intergenic
1099320157 12:81136835-81136857 CTGTAATAAAAACCTTTGATAGG + Intronic
1099432515 12:82604727-82604749 CTATAACAAATACTTGAGATTGG - Intergenic
1099734453 12:86550254-86550276 CTGTAAAGAATACCTGAGACAGG - Intronic
1100038645 12:90283450-90283472 CTGTAGCAAAGACCACAGACTGG + Intergenic
1100107429 12:91192802-91192824 CTCAAAGAAATACCTGAGACTGG - Intergenic
1100188785 12:92167867-92167889 CTGTAACAGATACCATAAACTGG + Intergenic
1100285085 12:93157568-93157590 CTATAATAAATACCCAAGACTGG - Intergenic
1100598142 12:96089177-96089199 CTATAACAAATACCATATACAGG + Intergenic
1101468860 12:104976633-104976655 CTGTAACAAATTACATAAACTGG + Intergenic
1101511386 12:105395749-105395771 CTGTAACAACAACCTTAAATAGG - Intronic
1102525617 12:113510461-113510483 CTGTAACAAATGCCACACACTGG + Intergenic
1102622078 12:114204058-114204080 CTATAAAAAATACCTGAGGCTGG - Intergenic
1102877950 12:116462286-116462308 CTCTAATGAATACCTGAGACTGG + Intergenic
1102982271 12:117251279-117251301 CTATACCAAATACCATAAACTGG - Intronic
1103131274 12:118470670-118470692 CTATAAGAAGTACCTGAGACTGG - Intergenic
1104115821 12:125748140-125748162 CTATAAGGAATACCTGAGACTGG - Intergenic
1104117277 12:125761798-125761820 CTGTTACAAAGAACTTAGAGAGG + Intergenic
1104200093 12:126580353-126580375 CTATACAAAATACCTGAGACTGG + Intergenic
1104205907 12:126638258-126638280 CTGCAATAAACACCTGAGACTGG + Intergenic
1104722129 12:131050415-131050437 CTATAAGAAATACCTGAGGCTGG + Intronic
1104780545 12:131417159-131417181 CTATAAGAAATGCCTGAGACTGG - Intergenic
1106362462 13:29045218-29045240 CTATAACAAATACCATAGATTGG + Intronic
1106392657 13:29350654-29350676 CTATAACAAATACCATAGATTGG + Intronic
1106478416 13:30117733-30117755 CTATAAAGAATACCTGAGACTGG + Intergenic
1106633680 13:31504544-31504566 CATTAAGAAATACCTGAGACTGG - Intergenic
1106714275 13:32372345-32372367 CTATAAAGAATACCTGAGACTGG + Intronic
1106714637 13:32374902-32374924 CTATAAAAAATACCTGAGACTGG + Intronic
1107298737 13:38942713-38942735 CCATAAAAAATACCTGAGACTGG - Intergenic
1107907364 13:45073795-45073817 CTGCTATAAATACCTGAGACTGG + Intergenic
1108038430 13:46316355-46316377 CTATAATAAATACCATAGATGGG + Intergenic
1108104068 13:46989843-46989865 CTGTACCAAATACCACAGACTGG + Intergenic
1108697723 13:52917504-52917526 CTATAACAAATACCACAGACTGG + Intergenic
1108893484 13:55293750-55293772 CTATAAAAAAAACCTGAGACTGG - Intergenic
1109091655 13:58053353-58053375 CTATAAAAAATACCTGAGACTGG - Intergenic
1109549668 13:63876919-63876941 CTATAAAAAATACCTGAGACTGG - Intergenic
1109656195 13:65393754-65393776 CTATTACAAATACTTTATACTGG + Intergenic
1110034000 13:70655237-70655259 ATAAAACAAATACCTGAGACTGG - Intergenic
1110084433 13:71360062-71360084 TTGTAAGAAATAACTTAGAGTGG + Intergenic
1110752576 13:79132300-79132322 CTATAACAAATACCGTATAGTGG + Intergenic
1110829490 13:80013660-80013682 CTATAACAGATACCTGAGACTGG - Intergenic
1110933487 13:81253055-81253077 CTGTAACAAATGTCATAGATTGG + Intergenic
1111246354 13:85547109-85547131 CTATAAAAACTACCTGAGACTGG + Intergenic
1111420014 13:87999513-87999535 CTGTAAAAAATAACTTAGGCTGG - Intergenic
1111480078 13:88812273-88812295 CTGTGAAGAATACCTCAGACTGG - Intergenic
1111635979 13:90903940-90903962 CTTAAAGAAATACCTAAGACTGG - Intergenic
1112068093 13:95816152-95816174 CATTAAGAAATACCTGAGACTGG - Intronic
1112130176 13:96514720-96514742 CCATAACAAATACCACAGACTGG - Intronic
1112235752 13:97634706-97634728 CTATAAGAAATGCCTGAGACTGG + Intergenic
1113198233 13:107834837-107834859 GTGTAACAAATTCCTCAGAAAGG + Intronic
1113528437 13:111000937-111000959 CAGTAACAAACACCACAGACTGG - Intergenic
1114829723 14:26126101-26126123 CTGTAACAGAAACGTTAGACTGG + Intergenic
1115197523 14:30817312-30817334 CTATAACTAATACCATAGACTGG - Intergenic
1115821983 14:37222920-37222942 CTATAACAAATACCACAGGCTGG + Intronic
1115952556 14:38737452-38737474 CTGTACCAAATACCATAAATTGG - Intergenic
1116112471 14:40604558-40604580 CCATAACAAATACCATAGACTGG + Intergenic
1116520373 14:45839535-45839557 ATATAAAAAATACCATAGACTGG + Intergenic
1117498664 14:56330771-56330793 CCGTAACAAATACCACAAACTGG + Intergenic
1117562937 14:56962513-56962535 CTGTTTGAAATACCTTAGTCAGG + Intergenic
1117743318 14:58841803-58841825 CTATAAAAAATACAATAGACTGG + Intergenic
1118764835 14:68902770-68902792 CTGTAGCAAGTTCCTTATACTGG - Intronic
1119018926 14:71089429-71089451 CTGTAAGGAATACCCGAGACTGG + Intronic
1120057483 14:79941746-79941768 CTGTAACAAAGACCATGAACTGG - Intergenic
1120287330 14:82520509-82520531 CTACAAAAAATACCTTAGACTGG - Intergenic
1120653027 14:87157312-87157334 CTATAAGAAATACCTGAGACTGG - Intergenic
1120712364 14:87806325-87806347 CTATAAGGAATACCTGAGACTGG + Intergenic
1121734268 14:96206805-96206827 CTATAAGAAATACTTTAGACTGG + Intronic
1121917095 14:97844982-97845004 TTGTAACATATACCTTAGATAGG - Intergenic
1122085997 14:99305266-99305288 CTATAAAGAATACCTGAGACTGG - Intergenic
1122171180 14:99877038-99877060 CTGTAACAAAGTCCATAGACTGG + Intronic
1122711221 14:103659775-103659797 CTGTAACAAATACCACGGGCTGG + Intronic
1122868735 14:104623874-104623896 CTCTAACAAATACCTACAACTGG + Intergenic
1123101465 14:105804756-105804778 CTGACAAAAATACCATAGACTGG + Intergenic
1123181109 14:106470877-106470899 CTGTAACAGATGCCTCAGAGTGG + Intergenic
1123965742 15:25455536-25455558 TTGCTACAAATACCTGAGACTGG + Intergenic
1124136176 15:27038129-27038151 CTGTAACAAATACCTTAGACTGG + Intronic
1125106936 15:35982593-35982615 CTGCCACAAAGACCTTAGAATGG - Intergenic
1125906205 15:43394920-43394942 CTGTAAAGAATACCTTAGACTGG - Intronic
1125969615 15:43901289-43901311 CTGTAACAAGTATCACAGACTGG - Intronic
1127176074 15:56359012-56359034 CTATAAAAAATACCTGAGACTGG - Intronic
1127920459 15:63490421-63490443 CTGTAACATATACCACAGATTGG - Intergenic
1128461565 15:67872334-67872356 CTGTAACAGATACCACAGATTGG + Intergenic
1128616199 15:69111935-69111957 CCATAACAAATACCATAAACTGG - Intergenic
1128631626 15:69273947-69273969 CTCTAACGAATACCACAGACCGG + Intergenic
1129043678 15:72713296-72713318 GTGTCACAAAGACCTTAGATGGG - Intronic
1129130454 15:73488891-73488913 CTATAACAAATACCTGAAAATGG - Intronic
1129132799 15:73515826-73515848 CCATAACAAATACCAGAGACAGG - Intronic
1130731395 15:86496365-86496387 CTATAAAGAATACCTGAGACTGG - Intronic
1131412757 15:92224388-92224410 CTATAAAGAATACCTGAGACTGG + Intergenic
1132202209 15:99962785-99962807 CTATAACAAACACCTTAGCCTGG - Intergenic
1132221130 15:100106314-100106336 CTCTAACGAATACCCTAGACTGG - Intronic
1132291577 15:100707257-100707279 CCAGAACAAATACCATAGACAGG - Intergenic
1132763739 16:1524165-1524187 CTGCAAGAAATACCTGACACGGG + Intronic
1133045305 16:3085024-3085046 CTGTAAAAAATACCTGAGACTGG + Intergenic
1133537135 16:6713109-6713131 CTGTAAGAAATACCTGAGACTGG - Intronic
1135052970 16:19207357-19207379 CTATAAGAAATACCTGAGACTGG + Intronic
1135128547 16:19832684-19832706 CTATAAAGAATACCTGAGACTGG + Intronic
1135981369 16:27150112-27150134 CTATAACAAATACCATGGACTGG + Intergenic
1136287951 16:29255021-29255043 CTGTAACAAATGCCACACACCGG + Intergenic
1136603833 16:31317591-31317613 GTATAACAAATAACATAGACTGG - Intronic
1136858969 16:33683946-33683968 CTTTAAGAAATACCTGAGTCTGG + Intergenic
1137376073 16:47952942-47952964 CCATAACAAATGCCATAGACTGG + Intergenic
1138239196 16:55412740-55412762 CTATAAAAAATACCCAAGACTGG - Intronic
1138997782 16:62475379-62475401 CTGCTACAAAGACCTGAGACTGG - Intergenic
1139316574 16:66076333-66076355 CTGCAAAGAATACCTGAGACTGG + Intergenic
1139669764 16:68484854-68484876 CTGTAACCCAGACCTTAGGCCGG - Intergenic
1140596378 16:76419692-76419714 CTATAACCAATACCATAGACTGG + Intronic
1140836155 16:78796055-78796077 ATATAATAAATACTTTAGACTGG + Intronic
1141064813 16:80905542-80905564 CTCTAAAAAATACCTGAGGCTGG - Intergenic
1141368818 16:83468489-83468511 CTGTAACAAATACCACGAACTGG - Intronic
1141782434 16:86172374-86172396 CTATAACAAATATCATAGACTGG - Intergenic
1142093608 16:88227738-88227760 CTGTAACAAATGCCACACACCGG + Intergenic
1203120482 16_KI270728v1_random:1532125-1532147 CTTTAAGAAATACCTGAGTCTGG + Intergenic
1142839927 17:2620286-2620308 CTGTAACATTCACCTTAGAATGG + Intronic
1142907782 17:3057106-3057128 TTATAACAAATACCATACACTGG - Intergenic
1142926781 17:3247153-3247175 TTATAACAAATACCATACACTGG + Intergenic
1144241580 17:13318008-13318030 CTATAAAGAATACCTGAGACTGG + Intergenic
1144498147 17:15763267-15763289 CTCTAAAGAATACCTGAGACTGG - Intergenic
1144528915 17:16017112-16017134 TCGTAACAAATACCTTAAATAGG - Intronic
1145161524 17:20578308-20578330 CTCTAAAGAATACCTGAGACTGG - Intergenic
1145438439 17:23070439-23070461 TTGCAACAAATTCCTCAGACAGG - Intergenic
1146383223 17:32346898-32346920 CTGTAACAAACACCACAGACTGG + Intronic
1146567698 17:33927619-33927641 CTCTAACAAATACCATAGATTGG - Intronic
1146919304 17:36699394-36699416 CTGAAATAAAGACCTTAAACTGG - Intergenic
1147281602 17:39366420-39366442 CTCTAAGAAATTCCCTAGACTGG + Intronic
1147812850 17:43185538-43185560 CTAAAACAAAAACCTTAGCCAGG + Intronic
1150117832 17:62569828-62569850 CTGTAACAAATACCATAAACTGG + Intronic
1150155957 17:62853340-62853362 CTGTAAGAACTGCCTGAGACTGG + Intergenic
1152403640 17:80084162-80084184 CTGTAGGAAATACCTAAGACTGG + Intronic
1153076661 18:1169723-1169745 ATGTAATAAATACCTTTGTCCGG - Intergenic
1153138384 18:1943334-1943356 CTGTAAAGAATACCTGAGGCTGG - Intergenic
1153186580 18:2492933-2492955 CTGTAACAAGTACAATACACTGG - Intergenic
1154408273 18:14117587-14117609 CTGCTATAAATACCTGAGACTGG + Intronic
1154474418 18:14742184-14742206 GTAAAACAAATACCTAAGACTGG + Intronic
1155776218 18:29765412-29765434 CTATACCAAATACCATAAACTGG + Intergenic
1156169115 18:34460898-34460920 CTATAAGAAATACTTGAGACTGG - Intergenic
1156521734 18:37727600-37727622 CCGTAACAAATACCACAGAATGG + Intergenic
1156789598 18:40954861-40954883 TTCTAAAAAATACCTGAGACTGG - Intergenic
1156924964 18:42564803-42564825 CTGTGAAGAATACCTGAGACTGG - Intergenic
1156960407 18:43021825-43021847 CTATAAAAAATACCTGAGACTGG - Intronic
1157433792 18:47651877-47651899 CTGTAACAAAGTCCTAAGACTGG + Intergenic
1157999026 18:52594580-52594602 CTATAATAAATACCAGAGACTGG + Intronic
1158564237 18:58541102-58541124 CTGCTATAAATACCTGAGACTGG + Intronic
1159418511 18:68184309-68184331 CTATAAAAAATACCCAAGACTGG - Intergenic
1159606156 18:70477470-70477492 CTGGAAGAAATACCTGAGACTGG - Intergenic
1159703824 18:71662182-71662204 CTATAAAAAATACCCAAGACTGG - Intergenic
1160191037 18:76714111-76714133 CTACAACAAATACCCGAGACTGG - Intergenic
1160342027 18:78097525-78097547 CTATAAGACATACCTGAGACTGG + Intergenic
1162609074 19:11735450-11735472 CAGTAACAAAGACCTCAGACAGG + Intronic
1162883750 19:13680789-13680811 CTGTAAGAAGTACCTGACACAGG + Intergenic
1164448708 19:28340026-28340048 CTATAAAGAATACCTGAGACTGG - Intergenic
1166416775 19:42601034-42601056 CTATAACAAACACCATAGCCTGG + Intronic
1166436294 19:42768590-42768612 CCATAACAAACACCTTAGCCTGG + Intronic
1166446166 19:42858618-42858640 CCATAACAAACACCTTAGCCTGG + Intronic
1166449154 19:42882567-42882589 CTATAACAAACACCTTAGCCTGG + Intronic
1166456041 19:42940079-42940101 CCATAACAAACACCTTAGCCTGG + Intronic
1166465829 19:43029348-43029370 CCATAACAAATGCCTTAGCCTGG + Intronic
1166471969 19:43085548-43085570 CCATAACAAACACCTTAGCCTGG + Intronic
1166483108 19:43189374-43189396 CCATAACAAACACCTTAGCCTGG + Intronic
1166485576 19:43208470-43208492 CCATAACAAACACCTTAGCCTGG + Intergenic
1166496600 19:43307363-43307385 CTGTAACAAACACCTTAGTCTGG + Intergenic
1167886815 19:52506950-52506972 CTGTTAGAAATAGCTTAGACTGG + Intronic
1167892385 19:52550918-52550940 CTGTCAGAAATAGCTTAGACTGG + Intronic
1167893529 19:52562007-52562029 CTGTTAGAAATAGCTTAGACTGG + Intronic
1167911916 19:52710663-52710685 CTGTTAGAAATAGCTTAGACTGG - Intronic
1167919576 19:52771911-52771933 CTGTCAGAAATAGCTTAGACTGG - Intronic
1167923571 19:52804803-52804825 CTGTTAGAAATAGCTTAGACTGG - Intronic
1167927067 19:52829810-52829832 CTGTCAGAAACAGCTTAGACTGG - Intronic
1167928602 19:52844837-52844859 CTGCTAGAAATAGCTTAGACTGG - Intronic
1167944111 19:52973690-52973712 CTGTCAAAAATAGCTTAGACTGG - Intergenic
1167989664 19:53347749-53347771 CTCTCAGAAATAGCTTAGACTGG + Intronic
1167993161 19:53378021-53378043 CTGTCAGAAATAGCTTAGACTGG + Intronic
1167996252 19:53404915-53404937 CTGTCAGAAATAGCTTAGACTGG + Intronic
1168001739 19:53452046-53452068 CTGTCAGAAATAGCTTAGACTGG + Intronic
1168383615 19:55944623-55944645 CCATAACAAATACCATACACTGG - Intergenic
925490925 2:4391907-4391929 CTGTAAAAAATACCTAAATCTGG + Intergenic
925527604 2:4820494-4820516 CTGAAAAAAATATTTTAGACAGG + Intergenic
925749179 2:7072099-7072121 CTGTAACAAATGCCTAAAAATGG + Intergenic
926248525 2:11139239-11139261 CTATAAATAATACCTGAGACTGG - Intronic
926391136 2:12394148-12394170 CTGTAACAAAAACCATAAACTGG + Intergenic
926490818 2:13524201-13524223 CTATATCAAATACCATAGACTGG + Intergenic
926705043 2:15831172-15831194 CTGTAACAAATACCACACACAGG - Intergenic
926798378 2:16637574-16637596 CTGTAACAGATTACATAGACTGG - Intronic
926908544 2:17828501-17828523 CAATAGAAAATACCTTAGACTGG - Intergenic
927329291 2:21842819-21842841 CTATAAAGAATACCTGAGACTGG - Intergenic
927762892 2:25775739-25775761 CTGCTATAAATACCTGAGACTGG - Intronic
929040143 2:37736792-37736814 CTATAAAGAATACCTGAGACTGG + Intronic
929081480 2:38126731-38126753 CTATAAAAACTACCTGAGACTGG - Intergenic
929286610 2:40142030-40142052 CTGTAATAAATACCACAGACTGG - Intronic
929326171 2:40614067-40614089 TTGTAACAGATACCATGGACTGG + Intergenic
929628019 2:43430212-43430234 CTGTAGCCAATACAGTAGACAGG - Exonic
929766206 2:44845970-44845992 TATTAAAAAATACCTTAGACTGG + Intergenic
930475020 2:51870939-51870961 TTCTACCAAATACCTTAGGCTGG - Intergenic
930578111 2:53177091-53177113 CTATAAAGAATACCATAGACTGG - Intergenic
930673488 2:54176123-54176145 CTAAACAAAATACCTTAGACTGG - Intronic
931154836 2:59616157-59616179 CTATAAAGAATACCTGAGACTGG + Intergenic
931325687 2:61219889-61219911 CAGTAAAAAAGATCTTAGACAGG - Intronic
931774881 2:65531969-65531991 CCATAACAAATGCCATAGACTGG - Intergenic
932013277 2:67999519-67999541 CTGTAACAAATACAACAGACTGG + Intergenic
932315237 2:70776413-70776435 CCTTAACAAATACCATAGACTGG - Intergenic
932879624 2:75489118-75489140 CTATAAGAACTACCTGAGACTGG + Intronic
933147280 2:78869511-78869533 ATACAACAAATACCTAAGACTGG - Intergenic
933158825 2:79002230-79002252 CTGTAAAAAATACTTAAGTCTGG + Intergenic
933352572 2:81173527-81173549 CTGTAACAAATACACTACTCTGG - Intergenic
934104517 2:88683217-88683239 CTTTAACAAATAACTTTAACCGG + Intergenic
934784067 2:96991934-96991956 CTATAAAAACTACCTGAGACTGG + Intronic
934817947 2:97346588-97346610 CTATAACAAAATACTTAGACTGG + Intergenic
934819749 2:97361896-97361918 CTATAACAAAATACTTAGACTGG - Intergenic
935151772 2:100443355-100443377 CTATAAAAAATACCTGAGACTGG - Intergenic
935798886 2:106672318-106672340 CTATAAAAAATACCTGATACTGG - Intergenic
935812480 2:106812310-106812332 CTATAAGAAATACCATAGACTGG - Intronic
936866593 2:117081844-117081866 CTATAAAAAATACCCAAGACTGG + Intergenic
936938022 2:117857040-117857062 CTATAACAAACACCTTAGACTGG + Intergenic
937037041 2:118790733-118790755 CTGCAACAAATATTGTAGACTGG - Intergenic
937332975 2:121043692-121043714 CTGTAACAAATACCACAGACAGG - Intergenic
937522448 2:122728623-122728645 ATGTAACAAACACATTAGATTGG + Intergenic
937942275 2:127295239-127295261 CTGTAACAAATACCTAACAATGG + Intergenic
938123741 2:128655051-128655073 CTATAAAAAATATCTGAGACTGG - Intergenic
938744997 2:134269113-134269135 CTGTAAAAAATACCTGAGCCTGG + Intronic
938994875 2:136667841-136667863 CTGTAAAAAATACCTGAGACTGG + Intergenic
939174111 2:138729905-138729927 CTGTAACAAATACCACAGACTGG + Intronic
939209047 2:139147690-139147712 CTATAAAAAATACCTAAGACTGG - Intergenic
939217003 2:139251262-139251284 CTTTAAAAAATATCTTAGATAGG + Intergenic
939243509 2:139593620-139593642 CTATAAAAAACACCTGAGACTGG - Intergenic
939506753 2:143055970-143055992 CTATGAAAAATACCTGAGACTGG + Intergenic
940729898 2:157376514-157376536 CTGCTATAAATACCTGAGACTGG + Intergenic
940735550 2:157447407-157447429 GCATAACAAATACCATAGACTGG - Intronic
940781396 2:157937534-157937556 CTATAACAAACACCATAGACTGG + Intronic
940781414 2:157937661-157937683 CTATAACAAACACCATAGACTGG + Intronic
940781432 2:157937788-157937810 CTATAACAAATACCATAGACTGG + Intronic
941478765 2:165979994-165980016 CTACGACAAATACCATAGACTGG - Intergenic
941735932 2:168977620-168977642 CTATAAAGAATACCTGAGACTGG + Intronic
942696480 2:178652445-178652467 CAGTGACAAATACCTTTAACAGG + Exonic
942696516 2:178652835-178652857 CAGTGACAAATACCTTTAACAGG + Exonic
942696535 2:178653028-178653050 CAGTGACAAATACCTTTAACAGG + Exonic
942696556 2:178653225-178653247 CAGTGACAAATACCTTTAACAGG + Exonic
942696995 2:178657485-178657507 CAGTGACAAATACCTTTAACAGG + Exonic
942697434 2:178661746-178661768 CAGTGACAAATACCTTTAACAGG + Exonic
942697631 2:178663614-178663636 CAGTGACAAATACCTTTAACAGG + Exonic
942697668 2:178664002-178664024 CAGTGACAAATACCTTTAACAGG + Exonic
942819337 2:180093136-180093158 CTACAACAAATATCCTAGACTGG + Intergenic
943487349 2:188502773-188502795 CTATAACAAAAACCTGAGATTGG + Intronic
943609317 2:190014212-190014234 CTGTAAAAAATGCCTGAGATTGG + Intronic
943651126 2:190458514-190458536 CTGTAACAAATACCACAGACTGG - Intronic
943829822 2:192446326-192446348 CTATAAAGAATACCTGAGACTGG - Intergenic
944150709 2:196555163-196555185 CTATAACAAATACCATAAACTGG + Intronic
944294608 2:198048416-198048438 CTGTAAAAAATGCCTGAGACTGG + Intronic
944369368 2:198963476-198963498 CTGTAAGAAATACCTGCCACAGG - Intergenic
944467351 2:200016725-200016747 CTATAACAAATGCAGTAGACTGG + Intergenic
945008467 2:205435929-205435951 CTATAACAAAACCCTGAGACAGG + Intronic
945229975 2:207577303-207577325 CTGTAATAAATACATTACATTGG + Intronic
945469549 2:210211752-210211774 CTATAAAAAATACCTGAAACTGG - Intronic
945609654 2:211983968-211983990 CTATAACAATTATCTTAGAATGG + Intronic
945649844 2:212543440-212543462 CTATATCAAATACCATTGACTGG + Intergenic
946013054 2:216582019-216582041 CTGCAACAAATACCACAAACTGG + Intergenic
946098301 2:217295227-217295249 CTGTAACAGATACCGTATATGGG - Intronic
946145404 2:217726806-217726828 CTATAACAAATATCATAGACTGG + Intronic
946531383 2:220574092-220574114 CTATAAAAAATACCTGAGACTGG + Intergenic
946600610 2:221356103-221356125 CTGTACCAAATAACTTTAACAGG - Intergenic
946830752 2:223726081-223726103 CTATAATGAATACCATAGACTGG + Intergenic
947110944 2:226719179-226719201 CTATAAAGAATACCTGAGACTGG + Intergenic
947197512 2:227583607-227583629 CTGTAAAGAAAACCTGAGACTGG + Intergenic
947889485 2:233604495-233604517 CTATAGAAAATACCTGAGACTGG + Intergenic
948312538 2:236999522-236999544 CTATAAAAAATACCTGAGACTGG - Intergenic
948321651 2:237074437-237074459 CTGCTATAAATACCTGAGACTGG - Intergenic
948332148 2:237178147-237178169 CTGTAACAAATACCATAGGCTGG - Intergenic
948342266 2:237263247-237263269 CTATAAAAAATACCTAAGACTGG - Intergenic
1168788435 20:559471-559493 CTGTAACAAATTACACAGACTGG - Intergenic
1168844981 20:938189-938211 CAGAAAGAAATACCTGAGACTGG - Intergenic
1168931113 20:1624797-1624819 CTAAAAGAAATACCTGAGACTGG + Intergenic
1169164865 20:3414521-3414543 TTATAAAAAATACCTTGGACTGG + Intergenic
1169281152 20:4267946-4267968 CTGTAACAAGTACCATAGACTGG + Intergenic
1169303119 20:4463140-4463162 CTATAAAAAATACCCAAGACTGG - Intergenic
1169474677 20:5920377-5920399 CTATATCAAATACCATAGATTGG + Intronic
1169497966 20:6133000-6133022 CTGTAACAAAGACCATGGACTGG - Intergenic
1169524486 20:6408529-6408551 CTATAAAAAATACCAGAGACTGG - Intergenic
1169852760 20:10070514-10070536 CTATTAAAAATACCTGAGACTGG + Intergenic
1169918141 20:10704163-10704185 CTATAAAAAATACCTGAGTCTGG - Intergenic
1170015298 20:11774563-11774585 CTATAATAAAGTCCTTAGACTGG - Intergenic
1170275693 20:14584358-14584380 CTATAATAAATACCATCGACTGG + Intronic
1170313686 20:15019029-15019051 CTGTAAAGAATACTTGAGACTGG - Intronic
1170560257 20:17551131-17551153 TTGCTATAAATACCTTAGACTGG + Intronic
1170750462 20:19140407-19140429 CTGTAAGAAATACCTGGGACTGG + Intergenic
1171309087 20:24131719-24131741 CTATAACAAATACCTGATACAGG + Intergenic
1171399565 20:24863892-24863914 CTATAAAGAATACCTGAGACTGG - Intergenic
1171437018 20:25131696-25131718 CTATAACAAATACCTTAGCCTGG + Intergenic
1172866362 20:38102031-38102053 CTGTAACAAATACCATAGACAGG - Intronic
1173068491 20:39737769-39737791 ATCTAACAAATACCATAGACAGG + Intergenic
1173427630 20:42956608-42956630 CTGAAAGAAATACCTGAGGCTGG - Intronic
1173921682 20:46750891-46750913 CTAAAAAAAATACCTGAGACTGG + Intergenic
1176078886 20:63261800-63261822 CTGTAACAAATGCCTTGGACTGG + Intronic
1176919071 21:14664594-14664616 CTATAAAGAATACCTGAGACTGG + Intergenic
1176920259 21:14679662-14679684 CTATAAGAAATACCTGAGACTGG + Intergenic
1176950689 21:15042780-15042802 CTGTAACAAATACCATAGATGGG - Intronic
1177084123 21:16680923-16680945 CTGAAAGATATACCTGAGACTGG - Intergenic
1177222772 21:18216632-18216654 CTATAAAAAATACCTGAGACTGG + Intronic
1177532258 21:22375227-22375249 CTATAAAGAATACCTGAGACTGG + Intergenic
1177872905 21:26595079-26595101 CTGTAACAAATGCCATAGACTGG + Intergenic
1177883164 21:26718237-26718259 CTATAAAAAATACCTGAGACTGG + Intergenic
1177935983 21:27347156-27347178 CTATAAAAAATACCTGAGACTGG + Intergenic
1178374060 21:32051785-32051807 CTATAAGGAATACCTGAGACTGG - Intergenic
1179083188 21:38192465-38192487 CTGTAACAAATACCACAGATGGG + Intronic
1179560699 21:42214404-42214426 CTGTAACAAATATCGTAGACTGG - Intronic
1179877795 21:44280061-44280083 CTGTAATAAAATCCTTAGAGTGG + Intergenic
1181981710 22:26771646-26771668 CTTTAAGAAAGACCTTAGAAAGG - Intergenic
1182250999 22:29000630-29000652 CTCTAAGGAATACCTGAGACTGG + Intronic
1182951919 22:34384141-34384163 CTATAAAGAATACCTGAGACTGG - Intergenic
1182974066 22:34605957-34605979 CTATAAGAAATATCTGAGACTGG - Intergenic
1184532921 22:45068168-45068190 ATGAAAAAAATACCTGAGACTGG + Intergenic
1185201908 22:49512157-49512179 CTGTAAAAAATACCATAGGCTGG - Intronic
1203292413 22_KI270736v1_random:8336-8358 CTATAAAGAATACCTGAGACTGG + Intergenic
949163546 3:910408-910430 CTATAAAACATACCTGAGACGGG - Intergenic
950318244 3:12024949-12024971 CTGTAACAAAGACCTTAGACTGG + Intronic
950837974 3:15938743-15938765 CCATAACAAATACCATAGCCTGG - Intergenic
951091358 3:18577226-18577248 CTGTAGCAAATATCTTAGACTGG - Intergenic
951180479 3:19653594-19653616 CTATAAAGAATACCTGAGACTGG + Intergenic
951384063 3:22023906-22023928 CTCTAAAGAATACCTGAGACTGG + Intronic
951809997 3:26688419-26688441 CTATAAAAAATACCTGAGACTGG + Intronic
952510407 3:34047898-34047920 CTATAAAAAATACCTTAGACTGG - Intergenic
952669592 3:35950013-35950035 CTATAGCAAATATCTGAGACTGG - Intergenic
953358025 3:42270895-42270917 CTATAACAAGTACCATGGACTGG + Intergenic
953660747 3:44889895-44889917 CTCTAAAGAATACCTGAGACTGG + Intronic
954541606 3:51396547-51396569 CTTTAAGCAACACCTTAGACAGG - Exonic
956239632 3:67115314-67115336 CTATAAGAAATACCTGAGACTGG - Intergenic
956347684 3:68298839-68298861 CTATAAGAAATATCTGAGACTGG - Intronic
956877444 3:73477742-73477764 CTCTAAGAAATACCCAAGACTGG + Intronic
957400765 3:79710010-79710032 CTATAACAAATTTCATAGACTGG - Intronic
957549380 3:81684332-81684354 CTATAACAAATACCACAGACTGG + Intronic
957558519 3:81791938-81791960 CTATAACTAATACCGTAGGCTGG + Intergenic
957694192 3:83613013-83613035 CTGCTATAAATACCTAAGACTGG + Intergenic
957910471 3:86614763-86614785 CTGTAAAAAATACCATAGACTGG + Intergenic
958018247 3:87967803-87967825 CTGATACACATACCTGAGACTGG - Intergenic
958537422 3:95423088-95423110 CTGCTATAAATACCTGAGACTGG + Intergenic
958740984 3:98071182-98071204 CATTAAAAAATACCATAGACTGG - Intergenic
958770112 3:98415575-98415597 CTATAAAGAATACCTGAGACTGG - Intergenic
958841223 3:99208344-99208366 CTGTAAAACATAACTGAGACTGG + Intergenic
958897486 3:99844984-99845006 CTATAAAGAATACCTGAGACTGG - Intronic
959169575 3:102828832-102828854 CTATAACAAATACCATAGTCTGG - Intergenic
959171727 3:102852315-102852337 CTGCTATAAATACCTAAGACTGG - Intergenic
959461840 3:106636631-106636653 CTGTAACAAATACCACAGACTGG + Intergenic
959814872 3:110663175-110663197 CTCTAAGGAATACCTGAGACTGG - Intergenic
959915316 3:111810334-111810356 CCATAACAAATACTATAGACTGG + Intronic
960085202 3:113583215-113583237 ATGTAACAATTATCTTAGAGTGG + Intronic
960904728 3:122589063-122589085 CTGTATCAAATATCATAGACTGG + Intronic
961925569 3:130476064-130476086 CCATAACAAAGACCATAGACTGG + Intronic
962229480 3:133649070-133649092 TTGTAACAAATACCTCTTACTGG - Intronic
962888288 3:139648347-139648369 CTATAAAGAATACCTGAGACTGG - Intronic
962908129 3:139823838-139823860 CTGTAGCAAATACCACAAACTGG + Intergenic
963533045 3:146495715-146495737 CTGTAACAAATACCATAGACTGG - Intronic
963823750 3:149929126-149929148 CTATAAGAAATACCCAAGACTGG + Intronic
964124866 3:153225872-153225894 CTATAAAGAATACCTGAGACTGG + Intergenic
964177396 3:153840638-153840660 CTATATCAAATATCATAGACTGG - Intergenic
964497778 3:157312761-157312783 CTATAACAAATACCTGAGACTGG + Intronic
964905608 3:161716597-161716619 CTATAACAGATACCACAGACTGG + Intergenic
965024944 3:163290710-163290732 CTATAAAAAATACCCAAGACTGG + Intergenic
965814485 3:172622472-172622494 CTATAAAGAATACCTGAGACTGG - Intergenic
965833380 3:172824203-172824225 CTGCTATAAATACCTGAGACTGG + Intergenic
965884724 3:173430936-173430958 CTGTAAGAAATATCTGAGGCTGG - Intronic
965928189 3:174008991-174009013 CTGTAACGAATACCATACCCTGG + Intronic
966673583 3:182559899-182559921 CCATAACAAATACCGCAGACTGG + Intergenic
967748147 3:193082945-193082967 CTTAAAGAAATACCTGAGACTGG - Intergenic
968590570 4:1457259-1457281 CTGTAAGAATTACCCAAGACTGG + Intergenic
968673947 4:1866956-1866978 CTGTAGCAAATACCACAGACTGG + Intergenic
969095170 4:4727402-4727424 CTATAAAAAATACCTGAGACTGG - Intergenic
969118121 4:4886878-4886900 CTATAAAGAATACCTGAGACTGG - Intergenic
969170831 4:5361686-5361708 CTGTAATAAAGAGCTTAAACTGG + Intronic
969231440 4:5834571-5834593 CTGTAATAGATACCACAGACTGG - Intronic
969951960 4:10846243-10846265 CTATAACAAATACCTTACAATGG - Intergenic
969954166 4:10871162-10871184 CTGTAAAAAGTACCACAGACAGG + Intergenic
970682556 4:18527522-18527544 CTGTAACAAATACCACAGACTGG + Intergenic
970698288 4:18704311-18704333 CTATAAAAAATACCTTAGACTGG + Intergenic
970991530 4:22218701-22218723 CTGCTATAAATACCTGAGACTGG + Intergenic
971520163 4:27539526-27539548 CTGTAATAAAAAACTTGGACTGG + Intergenic
971640134 4:29120621-29120643 CTATAAGAAATACCTGAGAGTGG - Intergenic
971711006 4:30112729-30112751 CTGTAAAAAATATCCAAGACTGG + Intergenic
971847954 4:31945042-31945064 CTATAAAAAATACCAGAGACGGG - Intergenic
972079643 4:35135553-35135575 CTATAAAAAATACCTCAGACTGG + Intergenic
972367601 4:38390961-38390983 CTATAAAAAATACCTAAAACTGG - Intergenic
972490948 4:39586717-39586739 CTATAACAAATACCTAAAAACGG - Intronic
972776537 4:42246508-42246530 ATGTAAAAAATACTTTAGGCTGG - Intergenic
972822071 4:42713338-42713360 CTGAAACAAATAACTTCCACTGG + Intergenic
972859475 4:43149918-43149940 CTATAAAAAATACCTGAGACTGG + Intergenic
973047241 4:45549917-45549939 CTATAACAGATACCACAGACTGG - Intergenic
973732847 4:53839948-53839970 CTGTAAAGAAAACCTGAGACTGG - Intronic
974623968 4:64398646-64398668 CTATAAAAAATACCTGAGACTGG - Intronic
974703921 4:65487162-65487184 CTGCTATAAATACCTGAGACTGG - Intronic
974724770 4:65784473-65784495 CTATATCAAATACCGTAGACTGG + Intergenic
975225500 4:71866548-71866570 CTATAACAATTACCATACACTGG - Intergenic
975776841 4:77796612-77796634 CTGTAAAAAATACCTGAGACTGG - Intronic
975865994 4:78724117-78724139 CCATAACAAATACCATAAACTGG - Intergenic
976454485 4:85229709-85229731 CTATAAAAAATACCTGAAACTGG + Intergenic
976457483 4:85265289-85265311 CTATAAAAACTACCTGAGACTGG + Intergenic
976510552 4:85904119-85904141 CTGTAAGAAATAACTGAGACTGG + Intronic
976599448 4:86924818-86924840 CTATAAAAAATACCTGAGATTGG + Intronic
976997652 4:91455619-91455641 CTTTAACAAATTCCTTAGACTGG - Intronic
977045634 4:92065513-92065535 CTATAAAGAATACCTGAGACTGG + Intergenic
977154368 4:93554783-93554805 CAGAAAGAAATACCTGAGACGGG + Intronic
977189779 4:93985171-93985193 CTACAACAAATACCTTAGACTGG - Intergenic
978417048 4:108487911-108487933 CTGCTATAAATACCTGAGACTGG + Intergenic
978605288 4:110472920-110472942 CTATAACATATACCTGAGGCTGG - Intronic
978670035 4:111236897-111236919 CTATAACAAATACGTCAGACTGG + Intergenic
979348116 4:119612808-119612830 CTATAACAAATAGCTTAGACTGG - Intronic
979764941 4:124453180-124453202 TTTAAACAAATACCTGAGACTGG - Intergenic
980011103 4:127595693-127595715 CTATAACAAATACCATCAACTGG + Intergenic
980279929 4:130706456-130706478 CTGTAAGAAATACCTGAGACTGG + Intergenic
980367947 4:131830878-131830900 TTATAACAAATACCACAGACTGG + Intergenic
980425956 4:132628319-132628341 CTATAAAAAATACCCAAGACTGG - Intergenic
980616205 4:135229051-135229073 CTGCTATAAATACCTGAGACTGG + Intergenic
980760780 4:137231208-137231230 CTATAAAAAATACCACAGACTGG - Intergenic
980967795 4:139539991-139540013 CTACAACAAATTCCATAGACTGG - Intronic
981135142 4:141202125-141202147 TTATAACAAATACCTTAGACTGG - Intronic
981294962 4:143121122-143121144 CTATAAGAAATACCTGAGACTGG - Intergenic
981778869 4:148401951-148401973 CTGTAACAGAGACCTTACAGTGG - Intronic
981977560 4:150749041-150749063 CTATAAAAAATACCTGAGACTGG - Intronic
982208071 4:153012207-153012229 CTATAAGAAATATCTGAGACTGG + Intergenic
982851615 4:160323885-160323907 CTGTAACAAATACCATACACAGG - Intergenic
983049861 4:163033480-163033502 CTATAAAAAATACCATGGACTGG - Intergenic
983119541 4:163864204-163864226 CTGAAAAACATACCTTAGCCAGG + Intronic
983124321 4:163931627-163931649 CTCTAACAAATACCATAGCCTGG - Intronic
983714828 4:170767956-170767978 CTATAAAAAATACCTTAGGCTGG + Intergenic
983780699 4:171666625-171666647 CTCTTATAAATACCTGAGACTGG - Intergenic
984166392 4:176307713-176307735 CTGTAACTACAACCTTAGTCCGG + Intergenic
984215596 4:176909917-176909939 TTATAACAAAGACCATAGACTGG + Intergenic
984334346 4:178369807-178369829 CTATAAGAACTACCTGAGACTGG + Intergenic
986164211 5:5259416-5259438 CTGTAAAAAGTATCTGAGACAGG + Intronic
986280774 5:6320683-6320705 CCATAACGAATACCGTAGACTGG + Intergenic
986482679 5:8204615-8204637 CTCTAACAAATGTCATAGACTGG + Intergenic
986609749 5:9554500-9554522 CTATAACAAAAACCTTAAGCTGG + Intergenic
986976297 5:13398179-13398201 CCATAACCAATACCCTAGACTGG - Intergenic
987143528 5:14969050-14969072 CTATAACAAATACCATAGATGGG + Intergenic
987442705 5:17976656-17976678 CCATAAAAAATACCTTAGATAGG + Intergenic
987629345 5:20447592-20447614 CTGTAAAAAATATGTGAGACTGG - Intronic
987743695 5:21943206-21943228 CTATAAAGAATACCTGAGACAGG - Intronic
988140882 5:27238827-27238849 CTGTAACAAGTACCACAAACTGG + Intergenic
988296394 5:29368569-29368591 CTATAAAAAATACCTGAGACTGG + Intergenic
988521649 5:31950870-31950892 TATTAAAAAATACCTTAGACTGG + Intronic
988523795 5:31968857-31968879 CTGTAACAATTACTGTAGGCTGG - Intronic
988645046 5:33085713-33085735 CTATAAAGAATACCTGAGACCGG + Intergenic
988998876 5:36740821-36740843 GCCTAACAAATACCATAGACTGG + Intergenic
989446717 5:41538151-41538173 CAGAAACAAATAACATAGACAGG + Intergenic
989963825 5:50445995-50446017 CTTTAACAAATCCCTCATACAGG + Intergenic
990242668 5:53831682-53831704 CTGTAACAAATTCCACAAACTGG - Intergenic
990498343 5:56370614-56370636 CTGCTATAAATACCTGAGACAGG - Intergenic
990807516 5:59682080-59682102 CTGTAACAGATACCACAAACTGG - Intronic
990874968 5:60474146-60474168 ATATAACAAAAACCTTAGACTGG + Intronic
990885694 5:60590375-60590397 CTATAACAAGTACCATACACTGG + Intergenic
991191116 5:63875305-63875327 CTATAACAAACACCATATACTGG + Intergenic
991261433 5:64672363-64672385 CTATAACAAATACCACAAACTGG - Intergenic
991432108 5:66559132-66559154 CTGCTATAAATACCTGAGACTGG + Intergenic
992261223 5:74972230-74972252 CTATAACAAATACCTTAAACTGG - Intergenic
992596268 5:78350542-78350564 TATTAAAAAATACCTTAGACTGG - Intergenic
993488460 5:88515944-88515966 CTATAAAAAATACCATAGACTGG + Intergenic
993618894 5:90145295-90145317 CTGTAAGAAATGCCTGAGACTGG - Intergenic
993755793 5:91728109-91728131 CTATAAAAAATACTTGAGACTGG + Intergenic
993876684 5:93315800-93315822 CTGTAACAAATACCACAGATTGG + Intergenic
994019140 5:95003184-95003206 CTATAAGAAATACCCAAGACTGG - Intronic
994062809 5:95499501-95499523 CTATAAGAAATACCTGAGACTGG - Intronic
994095664 5:95845333-95845355 CTATAAAGAATACCTGAGACTGG + Intergenic
994253549 5:97565849-97565871 CTATAAAAAATACCTGAGATTGG + Intergenic
994383451 5:99099453-99099475 CTATAAAGAATACCTGAGACTGG - Intergenic
995214950 5:109584456-109584478 CTGAAACAATTACCTTGCACAGG - Intergenic
995286591 5:110396014-110396036 CTATAAAGAATACCTGAGACTGG + Intronic
995338154 5:111026223-111026245 CTATAACAGATACCTTAGCTGGG - Intergenic
995761524 5:115566713-115566735 TTGCAATAAATACCTGAGACTGG - Intergenic
995860426 5:116635136-116635158 CTATAACAAATACCATAGACTGG + Intergenic
996001274 5:118367400-118367422 CTATAACAAATACCATAGACTGG + Intergenic
996073593 5:119162345-119162367 CTATAACAAATATCTTAGACTGG + Intronic
996235981 5:121129210-121129232 CTCGAAGAAATACCTGAGACTGG - Intergenic
996261576 5:121477286-121477308 TTGTAACAAATACCAGAGACTGG + Intergenic
996330909 5:122327720-122327742 CTGTAAGAACTATCTGAGACTGG - Intronic
996372967 5:122772813-122772835 CTGCAATAAATAACTTATACAGG + Intergenic
997901028 5:137764437-137764459 CTGTAACAAGTACCATATCCTGG - Intergenic
998071455 5:139201049-139201071 CTATAACAAACACCTTAGGCTGG - Intronic
998311773 5:141139485-141139507 CTGTAACAAATACCACAGACTGG - Intronic
998769245 5:145523444-145523466 CTGTAACAAATACCACACACTGG + Intronic
999633173 5:153592726-153592748 CTATAACAAATACTATAGACTGG + Intronic
999806917 5:155090083-155090105 CTGTGTCAAACACATTAGACTGG + Intergenic
999933206 5:156456143-156456165 CTGTAACAAATATCTAAAAATGG + Intronic
1000375090 5:160573366-160573388 TCATAACAAATACCATAGACTGG - Intronic
1001243539 5:170088375-170088397 CTGCAACAAATACCACAGACTGG - Intergenic
1001471556 5:172017016-172017038 CTATAAAAAATACCTGAAACTGG - Intergenic
1001784126 5:174396994-174397016 TTGTAACAAATATCTCAGACTGG - Intergenic
1003000113 6:2324268-2324290 CTATAAAAAATGCCTGAGACTGG - Intergenic
1003466205 6:6382491-6382513 CCATAACAAATACCATAGCCTGG + Intergenic
1003486769 6:6586883-6586905 CCATAACAAATACCTTAGACTGG - Intergenic
1004084944 6:12437859-12437881 TTCTAACAAATACTATAGACTGG + Intergenic
1004197058 6:13514711-13514733 ATGAAAAAAATACCATAGACTGG + Intergenic
1004233175 6:13851070-13851092 CTATAAAGAATACCTGAGACTGG - Intergenic
1004450622 6:15742063-15742085 CTTTAAGACATACCTGAGACTGG + Intergenic
1004755608 6:18607558-18607580 CTATAAAAAATACCTGAGACTGG + Intergenic
1004777486 6:18864009-18864031 CTATAAAAAATACCTGAGACAGG - Intergenic
1004792120 6:19038305-19038327 CTATAACAAATACCATAGACAGG + Intergenic
1004839571 6:19567817-19567839 CAGTAACAATAACCTGAGACAGG - Intergenic
1005487827 6:26318038-26318060 CCATAACAAATACCATAGACTGG - Intergenic
1005488118 6:26320411-26320433 CTGTAACAAATACTACAGACTGG + Intergenic
1005916093 6:30352730-30352752 CTATAACAAATACCACAGACTGG - Intergenic
1007195856 6:40059641-40059663 CTGTTATAAATACCCAAGACTGG - Intergenic
1007670737 6:43551454-43551476 CTGTAACAAAGACATAAAACAGG + Intronic
1007720403 6:43881788-43881810 CTATAACAGATTCCTGAGACTGG - Intergenic
1007830924 6:44637642-44637664 CTGTAACAGGTACCATAGACTGG + Intergenic
1008934248 6:56972746-56972768 CCATAACAAATACCATAGACTGG + Intronic
1009349479 6:62656325-62656347 AAGAAAAAAATACCTTAGACTGG + Intergenic
1009381503 6:63036224-63036246 CTATAACAAATACCACAGACTGG + Intergenic
1009582492 6:65554202-65554224 CTATAACAAGTACCATAGCCTGG - Intronic
1009757472 6:67957587-67957609 CTATAACAAAATCCTGAGACTGG - Intergenic
1010341565 6:74759444-74759466 TTATAAAAAATACCTGAGACTGG - Intergenic
1010517514 6:76790908-76790930 CTATAAGAAATACCTGAGAATGG + Intergenic
1010525556 6:76895961-76895983 CTATAAAAAATACCTGAGGCTGG - Intergenic
1010652949 6:78477522-78477544 CTATAAAAAATACCTTAGACTGG + Intergenic
1011055811 6:83202276-83202298 CAGTAACAACTTCTTTAGACGGG + Intergenic
1011998537 6:93623628-93623650 CTTAAAGAAATACCTGAGACTGG - Intergenic
1012014958 6:93838435-93838457 CCATAACAAATACCACAGACTGG + Intergenic
1012193152 6:96305892-96305914 CTGTTACAAAAACCTTCTACTGG + Intergenic
1012199389 6:96386494-96386516 CTGCTATAAATACCTGAGACTGG - Intergenic
1012254321 6:97015190-97015212 CTGCAATAAATACCCAAGACTGG - Intronic
1013370144 6:109462307-109462329 CCATAACAAATACCACAGACTGG - Intergenic
1013643738 6:112114369-112114391 CTGTAACATTTTCCTTAGAAAGG + Intronic
1013723442 6:113061208-113061230 CTGTAACAAATACCATAGACTGG + Intergenic
1014075408 6:117229493-117229515 CTGCTATAAATACCTGAGACTGG + Intergenic
1014129890 6:117818658-117818680 CTGTAACAAATACCACAGCTTGG - Intergenic
1014216471 6:118756793-118756815 CTATAACAAGTACCACAGACTGG + Intergenic
1014247587 6:119083934-119083956 CTATAAAGAATACCTGAGACTGG + Intronic
1015928155 6:138330435-138330457 CGTTAACAAATACCATAGACTGG - Intronic
1015975616 6:138787448-138787470 CTATAACAAACACCATAAACTGG - Intronic
1016145420 6:140666172-140666194 CCATAACAAATACCACAGACTGG - Intergenic
1016983384 6:149874804-149874826 GTATAACAAATACCTGAGATTGG + Intergenic
1017183146 6:151573585-151573607 CTATAAGAAATACCCGAGACTGG + Intronic
1017192355 6:151668075-151668097 CTATAAAAAATACCTGAGACTGG + Intronic
1017357201 6:153523739-153523761 CTATTAAAAATACCTGAGACTGG + Intergenic
1017595675 6:156026056-156026078 CTGTAACAGATACCATACGCTGG - Intergenic
1017851733 6:158310113-158310135 CTATAAGGAATACCTGAGACTGG + Intronic
1017854091 6:158333483-158333505 CCATATCAAATACCATAGACTGG - Intronic
1018051835 6:160016052-160016074 CTGCTATAAATACCTGAGACTGG - Intronic
1018554240 6:165033912-165033934 CTGTAAAGAATACCAGAGACTGG - Intergenic
1019085485 6:169471764-169471786 CTATAAAAAATACCTTAGACTGG + Intronic
1019819338 7:3230149-3230171 CTGTAACAATTACCACAAACTGG + Intergenic
1020003775 7:4770924-4770946 TTGTGAAAAATACTTTAGACAGG - Exonic
1020361911 7:7335837-7335859 CTGTAACAAATACTACAGAATGG - Intergenic
1021058179 7:16076854-16076876 CTGTAAGAACTGCCTGAGACTGG + Intergenic
1021338397 7:19432924-19432946 CTGTAAAAAATACCCAAGACTGG - Intergenic
1021864178 7:24938393-24938415 CTATAACAAATATCATAAACCGG - Intronic
1021893933 7:25215461-25215483 CCACAACAAATACCATAGACTGG - Intergenic
1021993420 7:26157759-26157781 CCATAACAAATACCACAGACTGG + Intronic
1022002239 7:26236833-26236855 CTATAAGAAATACCTGGGACTGG - Intergenic
1022060357 7:26787200-26787222 CTATAAAAAATATCTTGGACTGG + Intronic
1022082277 7:27034624-27034646 TTTTTAAAAATACCTTAGACTGG + Intergenic
1022211052 7:28209726-28209748 CCATAACAAATACCCCAGACTGG - Intergenic
1022891709 7:34707812-34707834 CCGTAACAAATACCAAAGATTGG + Intronic
1022947505 7:35302100-35302122 CTGGAAAGAATACCTGAGACTGG - Intergenic
1023048535 7:36231895-36231917 CTGAAATAAATACCATAAACTGG + Intronic
1023681190 7:42689209-42689231 CTGTAACAAATACCATAGGCTGG - Intergenic
1023791113 7:43754546-43754568 CTATAACAAATACCTTGGACTGG - Intergenic
1023979819 7:45062503-45062525 CTATAACAGATACCACAGACTGG + Intronic
1024028073 7:45431240-45431262 GTGTAACAAATACCATGGACTGG - Intergenic
1024378847 7:48671030-48671052 CCATAACAAATACCATAGACAGG + Intergenic
1024383037 7:48721832-48721854 CTATAAGAAATACCTGGGACTGG + Intergenic
1024595102 7:50926189-50926211 CTATACCAAATACCTTAGGCTGG + Intergenic
1026098839 7:67368339-67368361 CTATAACACATACCACAGACTGG - Intergenic
1027367098 7:77469768-77469790 CCATAATAAATACCATAGACTGG - Intergenic
1027463199 7:78481167-78481189 CTATAACAACTTCCTGAGACTGG + Intronic
1027560080 7:79718616-79718638 CTATAAAGAATACCTGAGACTGG + Intergenic
1027696007 7:81411566-81411588 CTGAAGGAAATACCTTAGACTGG + Intergenic
1027769139 7:82384516-82384538 CTATAAGAAAAACCATAGACTGG - Intronic
1027941805 7:84691647-84691669 CTATAACATATACCTGAGGCTGG - Intergenic
1028384501 7:90239404-90239426 CTGTAACAAATACCACAGACTGG - Intergenic
1028787672 7:94814328-94814350 CTGTAACAAAATATTTAGACTGG - Intergenic
1030787020 7:113674857-113674879 CTATAAAGAATACCTGAGACTGG + Intergenic
1031245760 7:119309307-119309329 GTGTAACAAATATATTACACAGG + Intergenic
1031284314 7:119844533-119844555 CTATAAGAAATACGTAAGACTGG + Intergenic
1031360510 7:120843930-120843952 CTGTTATAAATACCTGAAACTGG + Intronic
1031645736 7:124222649-124222671 CTATGAAAAATACCTGAGACTGG - Intergenic
1031692840 7:124811868-124811890 CTATAACAAAAACCATAGACTGG - Intergenic
1031760273 7:125705424-125705446 CTGTAAAGAATACATGAGACTGG - Intergenic
1033542039 7:142366097-142366119 CTATAAAGAATACCTGAGACTGG + Intergenic
1033904736 7:146188533-146188555 CTGCAACACATGGCTTAGACAGG + Intronic
1034056890 7:148044740-148044762 CCATAAAAAATATCTTAGACTGG - Intronic
1034701306 7:153098651-153098673 CTGTAACAAAGTACTCAGACTGG + Intergenic
1034726351 7:153339792-153339814 CTGTAACAAATACCACAGGCTGG + Intergenic
1034824956 7:154253761-154253783 CTGTGATAACTACCTGAGACTGG + Intronic
1035193528 7:157194484-157194506 CTGTAACAAATATCTAAAAATGG + Intronic
1035810842 8:2489809-2489831 CTGTAAGAAATACCTGAAATAGG + Intergenic
1036130125 8:6102312-6102334 CAGTAACAAAAACCTGAAACTGG + Intergenic
1036576319 8:10030990-10031012 CTATAACAAATGCCAGAGACTGG + Intergenic
1036595046 8:10204391-10204413 TTGTCATAAATACCCTAGACAGG + Intronic
1037843100 8:22259581-22259603 CTGTTACAAATACCACAGACTGG - Intergenic
1038269878 8:26066474-26066496 CTATAAAGAATACCTGAGACTGG - Intergenic
1038662534 8:29509639-29509661 CTCTAAAGAATACCTGAGACTGG + Intergenic
1038966157 8:32574784-32574806 CTGTAAAAAATAACTGAGACTGG - Intronic
1039097973 8:33907336-33907358 CTATAAAGAATACCTGAGACTGG - Intergenic
1039148523 8:34478070-34478092 CTAAAAGAAATACCTGAGACTGG + Intergenic
1039826423 8:41177955-41177977 CAACAACAAATACCTGAGACTGG + Intergenic
1040801534 8:51346886-51346908 CTATAAAAAATACCCAAGACTGG - Intronic
1041780869 8:61577543-61577565 CTATAAAAAATACCTGAGACTGG + Intronic
1041927461 8:63251373-63251395 CTATAAAGAATACCTGAGACTGG - Intergenic
1042715252 8:71765404-71765426 CTGTAACAAAAATCTTAAAGGGG - Intergenic
1042775865 8:72430634-72430656 CTGTAACAAACACCAGAGACTGG + Intergenic
1043011324 8:74885116-74885138 CTATAACAAATATCTGAGACTGG - Intergenic
1043030895 8:75131866-75131888 CTGTAAAGAATACCTGAGGCTGG - Intergenic
1043811061 8:84741362-84741384 CTGTAACAAATACCTCAGACTGG + Intronic
1043845782 8:85162100-85162122 CTATAAAGAATACCTGAGACTGG + Intergenic
1044020188 8:87096156-87096178 CCACAACAAATACCATAGACTGG + Intronic
1044076960 8:87833575-87833597 CTATAACAAATACCACAGACTGG - Intergenic
1044323631 8:90834615-90834637 CTCTAACAAATACTTCAGACTGG - Intronic
1044414364 8:91919508-91919530 CAATAAAAAATACCTGAGACTGG + Intergenic
1044749190 8:95400010-95400032 CTGTAACAAATACCATAGACTGG - Intergenic
1044777435 8:95705538-95705560 CCATAACAAATACCACAGACTGG - Intergenic
1045076382 8:98573781-98573803 CTGCTATAAATACCTGAGACTGG + Intronic
1045349082 8:101322093-101322115 CTATAAAGAATACCTGAGACTGG + Intergenic
1045395708 8:101758678-101758700 ATGTAATGAATACCATAGACAGG - Intronic
1046878295 8:119279592-119279614 CTATAAAAAATATCTGAGACTGG + Intergenic
1047012410 8:120686285-120686307 CTATAAAAAATATCTTAGATTGG + Intronic
1047141579 8:122146845-122146867 CTGTAAGAACCACCTGAGACTGG + Intergenic
1047373348 8:124274255-124274277 CTATAACAAATACCTTAGACTGG - Intergenic
1047688147 8:127322217-127322239 CTGTAAAGAATACCTGAGGCTGG - Intergenic
1047908469 8:129499413-129499435 CTATAAAGAATACCTGAGACTGG + Intergenic
1048087581 8:131200826-131200848 CTATAAAAAATATCTGAGACTGG - Intergenic
1048114602 8:131507534-131507556 CTATAAAGAATACCTGAGACTGG - Intergenic
1048121242 8:131583856-131583878 CTATAAAGAATACCTGAGACGGG + Intergenic
1048473443 8:134723101-134723123 CTGTAACGAATACCACAGACTGG - Intergenic
1048602766 8:135935757-135935779 ATAAAAAAAATACCTTAGACTGG - Intergenic
1048619205 8:136113267-136113289 CTGTAAAAAATACCATAGACTGG - Intergenic
1048773416 8:137919653-137919675 CTATAAAGAATACCTGAGACTGG - Intergenic
1048823759 8:138403111-138403133 CTATAACAAATACCATAGACAGG - Intronic
1049567139 8:143346669-143346691 CTGTAACAAATAGCACAGACTGG + Intronic
1050894868 9:10873542-10873564 CTATAAAAAATACCTGAGACTGG + Intergenic
1050996398 9:12224324-12224346 CTATAAAAAATACCTGAGGCTGG + Intergenic
1051016057 9:12476448-12476470 CTGTAAGAACTACCTGAGACTGG - Intergenic
1052027801 9:23593271-23593293 CTATAACAAATACCTGAGACTGG - Intergenic
1052078119 9:24170320-24170342 CTATAGCAAATACTTTAGATTGG + Intergenic
1052287218 9:26799834-26799856 TAATAACAAATACCATAGACTGG - Intergenic
1052556356 9:30023213-30023235 CTATAAAAAAAACCTGAGACTGG + Intergenic
1052605008 9:30688385-30688407 CCATAACAAATGTCTTAGACTGG + Intergenic
1053038056 9:34842730-34842752 CTATAACAAATACCACAGATTGG - Intergenic
1054313397 9:63554736-63554758 TTATAACAAATACCACAGACTGG + Intergenic
1054833542 9:69652197-69652219 CCATAACAAATACCATAGACTGG - Intronic
1054836975 9:69685808-69685830 TTGTTATAAATACCTGAGACCGG - Intergenic
1055663932 9:78534467-78534489 CTTTAACAAATACCATAAACTGG - Intergenic
1056508300 9:87278549-87278571 CTGTAAAGAATACCTGAGAGTGG - Intergenic
1057063064 9:92022667-92022689 CTATAACAAATACTGTAGACTGG + Intergenic
1057354552 9:94322885-94322907 CCGTAACGAATCCCATAGACTGG - Intronic
1057551196 9:96051934-96051956 CTCTAACAAATACCACAGACTGG - Intergenic
1057653205 9:96934750-96934772 CCGTAACGAATCCCATAGACTGG + Intronic
1057951294 9:99370800-99370822 CTATAACAAATACTCTAGGCTGG - Intergenic
1058313003 9:103529372-103529394 CTGTAAAAAATACCCCAAACTGG - Intergenic
1059324207 9:113493789-113493811 CTGGAGCATATACCTCAGACAGG + Intronic
1059570192 9:115426045-115426067 CTATAAAAAATACCCAAGACTGG + Intergenic
1059775817 9:117474339-117474361 CTATAAAGAATACCTGAGACTGG + Intergenic
1060936853 9:127521103-127521125 CCATAACAAATACCACAGACCGG - Intronic
1062058019 9:134478787-134478809 CCATAACAAATACCACAGACTGG - Intergenic
1186093878 X:6079117-6079139 CTATAAAAAATACCTGAGACTGG - Intronic
1186145915 X:6623335-6623357 GTGAAAAAAATACCTGAGACTGG - Intergenic
1186413253 X:9361925-9361947 CTATAAGAAATACCTGAGACTGG - Intergenic
1186451762 X:9679921-9679943 CTATAACCAACACCTTAGACTGG + Intronic
1186504592 X:10081105-10081127 CTATGACAAATACCATAGACTGG + Intronic
1186590423 X:10924809-10924831 CTTTAAGAAACACCTGAGACTGG + Intergenic
1186642323 X:11469123-11469145 CTCTAGCAAATGCCATAGACTGG - Intronic
1188032868 X:25283929-25283951 CAGTAACAAATGCCACAGACTGG + Intergenic
1188767251 X:34109373-34109395 CTATAAAAAATACCTGAGAGTGG - Intergenic
1188886649 X:35559754-35559776 CTATAAGGAATACCTGAGACAGG + Intergenic
1189933463 X:46039632-46039654 CTATAAGAACTACCTGAGACTGG + Intergenic
1189969068 X:46399707-46399729 CTGCTATAAATACCTGAGACTGG + Intergenic
1191769037 X:64735357-64735379 CTATAAAAAATACCTGAGATTGG + Intergenic
1192445171 X:71205784-71205806 CTGTATCAAACACCTCAGAGAGG + Intergenic
1193412607 X:81182754-81182776 CTATAAAGAATACCTGAGACTGG - Intronic
1193499052 X:82250368-82250390 CTGTAAAAAATACCAAAAACTGG - Intergenic
1193728665 X:85075889-85075911 CTGTAAAAAATACCATAGACTGG + Intronic
1194039120 X:88917994-88918016 TTGCAATAAATACCTGAGACTGG + Intergenic
1194134364 X:90121528-90121550 CTGCTATAAATACCTGAGACTGG - Intergenic
1194206144 X:91014297-91014319 CTGTAAAAAATACCAGAGACTGG + Intergenic
1195164241 X:102202448-102202470 ATATAACAAATACCATAGTCTGG - Intergenic
1195194619 X:102484647-102484669 ATATAACAAATACCATAGTCTGG + Intergenic
1195472217 X:105243438-105243460 CTGCCATAAATACCTGAGACTGG - Intronic
1195511648 X:105722719-105722741 TGTTAAAAAATACCTTAGACTGG + Intronic
1195533496 X:105983800-105983822 CTATAACAAATACCAAAGACTGG + Intergenic
1195650471 X:107278225-107278247 CTGCTATAAATACCTGAGACTGG - Intergenic
1196184876 X:112735343-112735365 CTATAACAAATACTATAGACTGG - Intergenic
1196896224 X:120339572-120339594 CTATAACAAATACCGTAGACTGG + Intergenic
1196970336 X:121100968-121100990 CTATCAAAAATACCTGAGACTGG + Intergenic
1197049830 X:122045067-122045089 CTGCTATAAATACCTGAGACTGG - Intergenic
1197050821 X:122057387-122057409 CTATAAAAAATACCTAAGTCTGG + Intergenic
1197534297 X:127667641-127667663 CTATAAAAAATACCTGACACCGG - Intergenic
1198054002 X:132975976-132975998 CTGTAAAGAATGCCTGAGACAGG - Intergenic
1198946737 X:142024491-142024513 CTATAAAAAATACCTGAGACTGG - Intergenic
1199333501 X:146589330-146589352 CTATAACAAATACCCAAGACTGG - Intergenic
1199407373 X:147478341-147478363 CAATAACAAATACCACAGACTGG + Intergenic
1199577423 X:149326368-149326390 ATGTAATAAGTTCCTTAGACTGG - Intergenic
1200480144 Y:3691640-3691662 CTGCTATAAATACCTGAGACTGG - Intergenic
1200551900 Y:4589113-4589135 CTGTAAAAAATACCAGAGACTGG + Intergenic
1200761027 Y:7039282-7039304 CTGTAACCAACACCTTAGACTGG + Intronic
1201015521 Y:9597990-9598012 CTATACAAAATAACTTAGACTGG + Intergenic
1201642385 Y:16193370-16193392 CTGTAACAGATACCATGAACTGG - Intergenic
1201660429 Y:16391950-16391972 CTGTAACAGATACCATGAACTGG + Intergenic
1202601819 Y:26601336-26601358 TTGTTACAAATAGCTTAGAAAGG + Intergenic