ID: 1124136177

View in Genome Browser
Species Human (GRCh38)
Location 15:27038130-27038152
Sequence TGTAACAAATACCTTAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1245
Summary {0: 1, 1: 5, 2: 50, 3: 227, 4: 962}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124136171_1124136177 1 Left 1124136171 15:27038106-27038128 CCCCATCTCAGTCCGGTTGGCCA 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962
1124136172_1124136177 0 Left 1124136172 15:27038107-27038129 CCCATCTCAGTCCGGTTGGCCAC 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962
1124136168_1124136177 10 Left 1124136168 15:27038097-27038119 CCAGAACAGCCCCATCTCAGTCC 0: 1
1: 0
2: 0
3: 23
4: 193
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962
1124136166_1124136177 22 Left 1124136166 15:27038085-27038107 CCGTAACTAGTCCCAGAACAGCC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962
1124136167_1124136177 11 Left 1124136167 15:27038096-27038118 CCCAGAACAGCCCCATCTCAGTC 0: 1
1: 0
2: 2
3: 15
4: 221
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962
1124136165_1124136177 29 Left 1124136165 15:27038078-27038100 CCATGCTCCGTAACTAGTCCCAG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962
1124136173_1124136177 -1 Left 1124136173 15:27038108-27038130 CCATCTCAGTCCGGTTGGCCACT 0: 1
1: 0
2: 2
3: 6
4: 66
Right 1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG 0: 1
1: 5
2: 50
3: 227
4: 962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124136177 Original CRISPR TGTAACAAATACCTTAGACT GGG Intronic
901135667 1:6992531-6992553 AGAAAGAAATACCTGAGACTGGG + Intronic
902095353 1:13939682-13939704 ATGAACAAATACCTGAGACTGGG + Intergenic
902096159 1:13947627-13947649 CGTAACAAATACTTCAGACTGGG + Intergenic
902138991 1:14335686-14335708 TGTAAGAAATACCTGAGGCTGGG - Intergenic
902586395 1:17441084-17441106 TTGATCAAATACCTTAGATTTGG - Intergenic
903036576 1:20496850-20496872 AGAAAGAAATACCTGAGACTGGG - Intergenic
903839853 1:26231053-26231075 GGTAAGACATACCTGAGACTAGG - Intergenic
904293829 1:29505036-29505058 TATAACAAATACCATTGACTGGG + Intergenic
904553977 1:31345599-31345621 TATAAGAACTACCTGAGACTGGG + Intronic
905364143 1:37439605-37439627 TATAACTAATACCACAGACTGGG + Intergenic
905839660 1:41163763-41163785 TGTAACAAATATCATGGACTAGG - Intronic
906178682 1:43799374-43799396 TAACAAAAATACCTTAGACTGGG + Intronic
906651874 1:47518518-47518540 TATAACAAATGCCTTAGACCGGG - Intergenic
906885282 1:49638799-49638821 TGAAGAAAATACCTAAGACTGGG - Intronic
907574718 1:55515849-55515871 TATAACACACACCATAGACTGGG + Intergenic
907582608 1:55585420-55585442 ATTAAGAAATACCTGAGACTGGG + Intergenic
907632855 1:56101416-56101438 CATAACAAATACCACAGACTGGG + Intergenic
907785703 1:57610559-57610581 AATAACAAATACCCAAGACTGGG + Intronic
908388882 1:63667710-63667732 TGTAACAATTACCTGAGATATGG - Intergenic
908726807 1:67185110-67185132 CCATACAAATACCTTAGACTAGG - Intronic
908932944 1:69339587-69339609 TTTAAGAAATACCTAAGACTGGG - Intergenic
909129189 1:71714024-71714046 TGAAAAAAATACCAGAGACTGGG + Intronic
909131571 1:71743165-71743187 TTTTACAAATGCCATAGACTGGG - Intronic
909301684 1:74020730-74020752 TGCTATAAATACCATAGACTTGG + Intergenic
909354017 1:74686345-74686367 TGGAAGAAATAGCTCAGACTTGG + Intergenic
909369893 1:74871246-74871268 TATTAAAAATACCTGAGACTGGG - Intergenic
909664957 1:78122395-78122417 TGTAAAGAATACCTGAGACTGGG + Intronic
910041403 1:82856007-82856029 TATAACAAATACTTTAAACTGGG - Intergenic
910138101 1:83996623-83996645 ATTAACAAATAACTTAGAATTGG - Intronic
910186197 1:84543350-84543372 TATAAAAAATACCTGAGACTGGG + Intergenic
910414499 1:86983264-86983286 TGTAAAGAATACCTGAGACTGGG + Intronic
910462126 1:87458749-87458771 TGTAACAAATACCTAAAACGTGG + Intergenic
910611085 1:89142833-89142855 TGCTACAAATACCTGAGACTGGG + Intronic
910705696 1:90127201-90127223 TATAAAAAATACCTGAAACTGGG - Intergenic
910723687 1:90315225-90315247 TGTAACAAGTACCATGGACTGGG + Intergenic
910785682 1:90995976-90995998 TGTAACAAGTACTATAGACTGGG - Intronic
910846033 1:91605582-91605604 CATAATAAATACCTTAGACTAGG - Intergenic
910988086 1:93026157-93026179 CATAACAAATACCATAGACTGGG + Intergenic
911317725 1:96375582-96375604 TATAATAAATACCTTAGACTGGG - Intergenic
911348618 1:96725275-96725297 TGTAACCAATACATTACACCTGG - Intronic
911541494 1:99163231-99163253 TGTTATAAATATCTGAGACTGGG + Intergenic
911669949 1:100596671-100596693 TGTAACTACTACCTTAGTCTTGG + Intergenic
911765748 1:101672538-101672560 TATAACAAATATCATAGACTAGG - Intergenic
911864151 1:102994576-102994598 TATAAGAAATACCTGAGACTGGG - Intronic
911889771 1:103353474-103353496 TATAACAAATACCATAAACTGGG - Intergenic
912039518 1:105370414-105370436 TACAACAACTACCTGAGACTGGG + Intergenic
912222905 1:107698690-107698712 AGGAAGAAATACCTGAGACTGGG + Intronic
912453336 1:109781114-109781136 TGTAACAAATACCTAAAATGTGG - Intergenic
912975041 1:114321753-114321775 TATATCAAATACCTTAGAATGGG - Intergenic
913101906 1:115575544-115575566 TAAAAAAAATACCTGAGACTGGG + Intergenic
913286474 1:117231246-117231268 AGAAAGAAATACCTGAGACTGGG - Intergenic
913348377 1:117830362-117830384 TATAAAAAATACCTGTGACTGGG - Intergenic
913365155 1:118029363-118029385 TAAAAAAAATACCTTAGACTAGG - Intronic
915379564 1:155428104-155428126 TGCTATAAATACCTGAGACTGGG - Intronic
916910423 1:169340429-169340451 TGTAAAGAATACCTGAAACTGGG - Intronic
917694421 1:177507060-177507082 TGTAACAAATACCTAAAAATGGG - Intergenic
918121354 1:181543699-181543721 TTTAAAAAATACCATACACTGGG - Intronic
918491592 1:185087179-185087201 TATAAAAAATACTTTAGGCTGGG + Intronic
918791387 1:188834702-188834724 TATAACAAATATCTGAGATTGGG - Intergenic
918823514 1:189291327-189291349 TATAAAAAATACTTGAGACTGGG + Intergenic
918880586 1:190114347-190114369 TATTATAAATACCTGAGACTGGG - Intronic
919006620 1:191907913-191907935 TGAAAAAACTACCTGAGACTAGG + Intergenic
919177102 1:194032970-194032992 TGTAAGAAAAACATGAGACTTGG - Intergenic
919317338 1:195988637-195988659 TTAAAGAAATACCTAAGACTGGG - Intergenic
919520257 1:198580021-198580043 TGTAACAAATATATTGGTCTGGG - Intergenic
919536587 1:198795958-198795980 ATAAAGAAATACCTTAGACTAGG + Intergenic
919597479 1:199581566-199581588 ATTAAGAAATACCTGAGACTGGG - Intergenic
919772413 1:201171086-201171108 TGTAACCAATCCCCGAGACTCGG + Intronic
920169674 1:204063767-204063789 TTAACAAAATACCTTAGACTAGG + Intergenic
920265887 1:204722342-204722364 TAACAAAAATACCTTAGACTGGG + Intergenic
920533358 1:206721343-206721365 ATTAAGAAATACCTGAGACTGGG - Intronic
920830449 1:209460217-209460239 TATAACAAAAACCATAAACTGGG - Intergenic
920890860 1:209984678-209984700 TGCTATAAATACCTGAGACTGGG + Intronic
921125309 1:212172427-212172449 TATAAAAAATACCACAGACTGGG + Intergenic
921541189 1:216417793-216417815 TATAAAAAATACCGGAGACTGGG - Intronic
921674477 1:217962932-217962954 TGTAATAAGTACCATAGACTGGG + Intergenic
921741201 1:218687212-218687234 TATAACAAATACCACAGACTGGG + Intergenic
922131978 1:222788870-222788892 TATAACAAATACCATAAACTAGG - Intergenic
922439329 1:225639653-225639675 TATAACAGATACCACAGACTGGG - Intronic
922594448 1:226803176-226803198 TTAATGAAATACCTTAGACTGGG - Intergenic
922704912 1:227785468-227785490 TCTAAGAAATACCTGAGACTAGG + Intergenic
923104627 1:230844495-230844517 TTAAAGAAATACCTGAGACTGGG - Intronic
923176730 1:231474181-231474203 ATTAAGAAATACCTGAGACTGGG + Intergenic
923253045 1:232194700-232194722 TGTTGGAAAGACCTTAGACTTGG + Intergenic
923964055 1:239116450-239116472 TGCTATAAATACCTGAGACTGGG - Intergenic
924105559 1:240645739-240645761 TGTAATAATTAACGTAGACTAGG + Intergenic
924240163 1:242032688-242032710 TATAACAAAGATCTTAAACTGGG + Intergenic
924610004 1:245565788-245565810 TATAAAAAATACCTAAGGCTGGG + Intronic
1063544317 10:6965305-6965327 TGTAACAAATACCACACGCTGGG + Intergenic
1064012858 10:11749187-11749209 TGTATAAAATACCTTCGCCTTGG + Intronic
1064235724 10:13572846-13572868 CGTAAAAAATATCTTAGGCTGGG - Intergenic
1064286490 10:13995959-13995981 TATAACAAATCCCATAAACTGGG + Intronic
1064352235 10:14586718-14586740 TGTAACAAATACCACAGACGGGG - Intronic
1064716955 10:18186434-18186456 AGAAAGAAATACCTGAGACTGGG + Intronic
1064868786 10:19913431-19913453 TATAAAAAATACCTAATACTGGG - Intronic
1065016841 10:21469985-21470007 AATAAGAAATACCTGAGACTGGG - Intergenic
1065304463 10:24355306-24355328 TGCAACCAATACCATCGACTTGG + Intronic
1065317613 10:24479621-24479643 TATAAAAAATACCTGAGACTGGG + Intronic
1065667173 10:28074918-28074940 TATAAAGAATACCTGAGACTGGG + Intronic
1065871968 10:29963386-29963408 TTGAAGAAATACCTGAGACTGGG - Intergenic
1065912526 10:30321456-30321478 TGGAAGAAATAATTTAGACTGGG + Intronic
1066041165 10:31549094-31549116 TATAAAAAATACCTGAGACTGGG - Intergenic
1066224600 10:33369973-33369995 TTGAATAAATACCTGAGACTGGG + Intergenic
1066235127 10:33478567-33478589 TCTATCAAATACCTAATACTTGG + Intergenic
1066249615 10:33619944-33619966 TGTGAGACATACCTGAGACTGGG + Intergenic
1066253040 10:33652704-33652726 TATAACAAATACCTGAGACTGGG + Intergenic
1066483991 10:35826098-35826120 AGGAAGAAATACCTGAGACTGGG + Intergenic
1066601861 10:37117794-37117816 TAAAAGAAATACCTAAGACTGGG + Intergenic
1066646008 10:37609781-37609803 GTAAAAAAATACCTTAGACTAGG - Intergenic
1067291859 10:44949548-44949570 CATAACAAATACCATACACTGGG + Intergenic
1067822346 10:49540990-49541012 CATAACAAATGCCATAGACTGGG + Intergenic
1067826975 10:49583179-49583201 TGTAAAGAATACCTGAGACTGGG + Intergenic
1068153729 10:53168896-53168918 TATAACAAATACCTGAAAATAGG + Intergenic
1068355936 10:55908206-55908228 TATAAAGAATACCTTGGACTGGG + Intergenic
1068385311 10:56318458-56318480 TATAACAAATACTGTTGACTGGG - Intergenic
1068445424 10:57115872-57115894 TGTAAGAAATACCTAAGAGCAGG - Intergenic
1068484882 10:57645083-57645105 TCTAAGAACTACCTGAGACTGGG - Intergenic
1068580018 10:58729551-58729573 TTAAAGAAATACCTGAGACTGGG + Intronic
1068590490 10:58848025-58848047 TGTACAAAATACCTGAGACTGGG - Intergenic
1068639167 10:59382633-59382655 TATAACAAATATCATACACTGGG - Intergenic
1069188221 10:65453711-65453733 TATAACAAACACCATAAACTAGG - Intergenic
1069336759 10:67360543-67360565 TATAAAGAATACCTGAGACTGGG + Intronic
1069361930 10:67652992-67653014 TATAAGAAATACCTGAGATTGGG + Intronic
1069789555 10:71010949-71010971 TGTAAAGAATACCTGAGACTGGG + Intergenic
1069801031 10:71081632-71081654 TAACAAAAATACCTTAGACTGGG + Intergenic
1069803807 10:71104180-71104202 CGTAACAAGTACCAAAGACTGGG + Intergenic
1070243658 10:74709426-74709448 TATAACAAATATCTTATACTTGG - Intergenic
1070487093 10:76941777-76941799 TGTAACAAACACCATAATCTGGG + Intronic
1070865926 10:79708130-79708152 CGTAACGAATGCCGTAGACTGGG + Intronic
1070879720 10:79846261-79846283 CGTAACGAATGCCGTAGACTGGG + Intronic
1070937594 10:80313506-80313528 TATAAAAAATACCTGAGGCTGGG + Intergenic
1071302141 10:84263914-84263936 TGTAACAAAATACATAGACTGGG - Intergenic
1071400864 10:85269371-85269393 ATTAAGAAATACCTGAGACTGGG + Intergenic
1071632826 10:87230351-87230373 CGTAACGAATGCCGTAGACTGGG + Intronic
1071646275 10:87362569-87362591 CGTAACGAATGCCGTAGACTGGG + Intronic
1071877093 10:89853475-89853497 TCTAAAGAATACCTGAGACTGGG - Intergenic
1071880058 10:89887673-89887695 TATAATAAATACCATAGACTGGG + Intergenic
1071888654 10:89978450-89978472 TGAAACAAATACCACAGACAGGG - Intergenic
1071989982 10:91092323-91092345 TAAAACAAATACCTGAGACTGGG + Intergenic
1072382524 10:94890106-94890128 AGAAAGAAATACCTGAGACTGGG - Intergenic
1073547150 10:104360268-104360290 TTAAAGAAATACCTGAGACTGGG + Intronic
1073629211 10:105131605-105131627 TGTTATAAATACCTGAGACTGGG + Intronic
1073676720 10:105655411-105655433 TAGAAGAAATACCTGAGACTGGG - Intergenic
1073934802 10:108618666-108618688 TATGACAAATACCTTATATTCGG - Intergenic
1074409597 10:113214800-113214822 TATAAGAAATACCTGAGTCTCGG - Intergenic
1074411786 10:113234998-113235020 AATAACACATACCTAAGACTGGG - Intergenic
1074689011 10:115987175-115987197 TATAAAGAATACCTGAGACTGGG + Intergenic
1074804147 10:117030204-117030226 TGCTATAAATACCTGAGACTAGG - Intronic
1074889608 10:117724481-117724503 GCTAACACATACCTGAGACTGGG + Intergenic
1074939158 10:118217894-118217916 TACAATAAATACCTTAGACTGGG + Intergenic
1075053148 10:119198228-119198250 TGTAACAAGTTCCATAGACTGGG + Intergenic
1075107949 10:119554714-119554736 TTTAAAAAATATCTTTGACTGGG - Intergenic
1075217759 10:120553535-120553557 TATAACAAATACCATACACTGGG - Intronic
1075608453 10:123833105-123833127 TAACAAAAATACCTTAGACTGGG - Intronic
1075628586 10:123984981-123985003 TAAAAAAAATACCTGAGACTGGG + Intergenic
1075662468 10:124207591-124207613 TGTAACAAATACCACACACTTGG + Intergenic
1076290326 10:129340756-129340778 AATAACAAATACCACAGACTGGG + Intergenic
1076309910 10:129497965-129497987 GGAATAAAATACCTTAGACTGGG - Intronic
1076638221 10:131897156-131897178 AGTAACATATTCCTGAGACTGGG - Intergenic
1076842308 10:133051783-133051805 TATAAGAAATACCTAAGACTGGG + Intergenic
1077594190 11:3517454-3517476 TATAAAAAATACCTGAGACTGGG - Intergenic
1077730611 11:4725230-4725252 TGCTATAAATACCTGAGACTGGG - Intronic
1078193092 11:9109576-9109598 TGAAAAAAATACCCGAGACTGGG - Intronic
1078780071 11:14429770-14429792 TTTAAAAGATAGCTTAGACTGGG - Intergenic
1078918964 11:15809058-15809080 TTTAAAAAATACCATAGACGGGG - Intergenic
1079299788 11:19267777-19267799 TGCTATAAATACCTGAGACTGGG + Intergenic
1079585018 11:22114854-22114876 TGTAAATAATATCTTGGACTTGG + Intergenic
1079795928 11:24803004-24803026 TATAACAAATACCACAGACTGGG - Intronic
1079861279 11:25674709-25674731 TGTAAGAAATACCTGAGACTAGG - Intergenic
1079992539 11:27261735-27261757 ATAAAGAAATACCTTAGACTGGG + Intergenic
1080083149 11:28245644-28245666 TATAACAAATACCTGAGACTTGG + Intronic
1080178198 11:29392589-29392611 ATAATCAAATACCTTAGACTTGG + Intergenic
1080222946 11:29927521-29927543 TATAACAAATATCATAGAGTGGG - Intergenic
1080306550 11:30843352-30843374 TGCTATAAATACCTGAGACTGGG + Intronic
1080480717 11:32647111-32647133 TTAAAGAAATACCTGAGACTGGG + Intronic
1080577409 11:33612574-33612596 TATAAAAAATACCTGAGACTGGG + Intronic
1080881848 11:36328631-36328653 TTAAAGAAATACCTGAGACTGGG - Intronic
1080946528 11:36980585-36980607 ATAAAGAAATACCTTAGACTGGG + Intergenic
1081010462 11:37805025-37805047 TGAAATAAATAGATTAGACTTGG + Intergenic
1081068480 11:38578025-38578047 TTAAAGAAATACCTGAGACTGGG + Intergenic
1081234105 11:40625284-40625306 TGTAAGAAATACCCAAGACTGGG + Intronic
1081376302 11:42362653-42362675 TATAACAAATACCATAGACTAGG - Intergenic
1081439124 11:43061122-43061144 TGAAAACAATACCTTAGACTGGG + Intergenic
1081783734 11:45731957-45731979 TGCTATAAATACCTGAGACTCGG + Intergenic
1082041333 11:47687762-47687784 AGAAAGAAATACCTTAGACTGGG - Intronic
1082222292 11:49654027-49654049 TTTTACAAACACCTTAGACAGGG - Intergenic
1084027194 11:66458500-66458522 AGAAAGAAATACCTGAGACTAGG + Intronic
1084104634 11:66973323-66973345 AATAAGAAATACCTGAGACTGGG - Intergenic
1084759624 11:71261231-71261253 TGGACTAAATACCATAGACTGGG - Intergenic
1085698606 11:78726880-78726902 TGTTATAAATACCTGAGACTGGG - Intronic
1085788596 11:79476315-79476337 AGAAATAAATACCTGAGACTGGG - Intergenic
1085832641 11:79917837-79917859 CATAACAAATACCACAGACTGGG + Intergenic
1085911473 11:80832104-80832126 TATAAAAAATGCCATAGACTGGG + Intergenic
1085959978 11:81450338-81450360 TTAAAGAAATACCTCAGACTGGG + Intergenic
1086235714 11:84627644-84627666 TGCCATAAATACCTGAGACTGGG + Intronic
1086268865 11:85035334-85035356 TATAAAGAATACCTGAGACTAGG + Intronic
1086314232 11:85573217-85573239 ATAAACAAATACCTGAGACTGGG - Intronic
1086601875 11:88643059-88643081 ATTAAAAAATACCTAAGACTGGG + Intronic
1086626750 11:88965172-88965194 TTTTACAAATACCTTAGACAGGG + Intronic
1086744719 11:90410701-90410723 AACAAAAAATACCTTAGACTGGG + Intergenic
1087186556 11:95204782-95204804 TATAACAAAAACCAAAGACTGGG - Intronic
1087433489 11:98082182-98082204 TGTTAAAAATACTTGAGACTGGG - Intergenic
1087625511 11:100591420-100591442 TATAAAAAATACCTTGAACTTGG - Intergenic
1087670030 11:101095069-101095091 ATAAAAAAATACCTTAGACTGGG - Intronic
1087732736 11:101797134-101797156 GTTAAGAAATACCTGAGACTGGG - Intronic
1087827498 11:102782403-102782425 TATCAAAAATACCTGAGACTGGG - Intergenic
1088132980 11:106517924-106517946 AGTACAAAATACCTTAGACTTGG - Intergenic
1088875138 11:113929299-113929321 CGTAACAAATACCACAGACTAGG + Intronic
1088942670 11:114476490-114476512 TATAAAGAATACCTGAGACTGGG + Intergenic
1089394002 11:118123089-118123111 TGCTCTAAATACCTTAGACTGGG - Intergenic
1089668838 11:120038020-120038042 AATAAGAAATACCTGAGACTGGG - Intergenic
1090410378 11:126503962-126503984 TATAACAAATACTATAGACTGGG - Intronic
1090490732 11:127158527-127158549 TGTAAAGAATACCTGAGACCGGG + Intergenic
1090544520 11:127748172-127748194 TATAAAAAATACCTGTGACTGGG + Intergenic
1091460301 12:639134-639156 TGTAACAAATGTCTGCGACTAGG - Intronic
1091860275 12:3775076-3775098 TATAAAGAATACCTGAGACTGGG - Intergenic
1091933263 12:4414455-4414477 TGTAACAAATATCATACACTGGG - Intergenic
1092128962 12:6095205-6095227 TATAACAAATGCCTGAGACTGGG - Intronic
1092202889 12:6597800-6597822 TGTCACCAGTAACTTAGACTTGG - Intronic
1092325670 12:7528521-7528543 TTAAACATATACCTGAGACTGGG - Intergenic
1092892140 12:12978924-12978946 TGTAAAAATCTCCTTAGACTTGG + Intronic
1093120388 12:15264271-15264293 TGTAACAAAGACCACAAACTGGG - Intronic
1093280208 12:17184891-17184913 AGAAAGAAATACCTGAGACTGGG - Intergenic
1093725144 12:22498244-22498266 TGTAAGAATTACCCTAGACTGGG + Intronic
1093879207 12:24384151-24384173 TGAAAAAAATATCTGAGACTGGG - Intergenic
1094031117 12:26011854-26011876 TATAATAAATACCATAAACTGGG - Intronic
1094378957 12:29821891-29821913 TATAACAAATTCATTAGACTGGG + Intergenic
1094432814 12:30388628-30388650 ATTAAAAAATACCTGAGACTGGG + Intergenic
1094471473 12:30805415-30805437 TGCTACAAATACCTGAGACTAGG + Intergenic
1095199192 12:39362236-39362258 TGCCATAAATACCTGAGACTGGG - Intronic
1095208118 12:39461509-39461531 CATAGCAAATACCTTAGATTGGG - Intergenic
1095226835 12:39687288-39687310 TATAAAAAATACTTGAGACTGGG + Intronic
1095344295 12:41131189-41131211 TAAAAAAAATACCTGAGACTGGG - Intergenic
1095928106 12:47599431-47599453 TGCTATAAATACCTGAGACTGGG + Intergenic
1096350822 12:50899559-50899581 TGTAAGAAATAACTTGCACTAGG + Intergenic
1097152092 12:56986723-56986745 TATAATAAATACCTGAGACTGGG - Intergenic
1097308895 12:58097398-58097420 TATAAAAGATACCTTAGATTGGG + Intergenic
1097326314 12:58281357-58281379 TGCTATAAATACCTGAGACTGGG + Intergenic
1097606589 12:61762163-61762185 AGAAAGAAATACCTGAGACTGGG - Intronic
1097979683 12:65725057-65725079 AATAATAAATACCTTAGACTGGG - Intergenic
1098069861 12:66661611-66661633 TGTAACACATATCTTACCCTTGG + Intronic
1098152491 12:67561464-67561486 CGTAACAAGTACCATAGACTGGG + Intergenic
1098325735 12:69299599-69299621 AGAAAGAAATACCTGAGACTGGG - Intergenic
1098462676 12:70750208-70750230 TGTAACAACAACATAAGACTTGG - Intronic
1098487671 12:71040266-71040288 TTAAAGAAATACCTGAGACTGGG - Intergenic
1098558934 12:71851008-71851030 AGAAAGAAATACCTGAGACTTGG + Intronic
1098571101 12:71988325-71988347 TATAAAAAATACCCGAGACTGGG + Intronic
1098771391 12:74558310-74558332 TATAAAAAATACCTGAGACTGGG + Intergenic
1099032084 12:77539278-77539300 TATGACAAATGCCATAGACTAGG + Intergenic
1099432514 12:82604726-82604748 TATAACAAATACTTGAGATTGGG - Intergenic
1099553602 12:84080030-84080052 TGAAACAATTACCCAAGACTGGG + Intergenic
1099626715 12:85085170-85085192 TGTGATAAATACCCGAGACTGGG + Intronic
1099734452 12:86550253-86550275 TGTAAAGAATACCTGAGACAGGG - Intronic
1099911554 12:88839890-88839912 ATTAAGAAATACCTGAGACTGGG + Intergenic
1100038646 12:90283451-90283473 TGTAGCAAAGACCACAGACTGGG + Intergenic
1100107428 12:91192801-91192823 TCAAAGAAATACCTGAGACTGGG - Intergenic
1100130636 12:91489177-91489199 AGAAAGAAATACCTGAGACTGGG + Intergenic
1100188786 12:92167868-92167890 TGTAACAGATACCATAAACTGGG + Intergenic
1100333818 12:93610877-93610899 TTAAAAAAACACCTTAGACTGGG - Intergenic
1100591838 12:96036769-96036791 TGCTATAAATACCTGAGACTGGG + Intronic
1100692693 12:97055955-97055977 ATGAAGAAATACCTTAGACTGGG + Intergenic
1100959457 12:99946297-99946319 TGCACAAAATACCATAGACTGGG + Intronic
1101376960 12:104179517-104179539 TGCTATAAATACCTGAGACTGGG + Intergenic
1102163694 12:110789297-110789319 AGGAAGAAATACCTGAGACTGGG - Intergenic
1102525618 12:113510462-113510484 TGTAACAAATGCCACACACTGGG + Intergenic
1102622077 12:114204057-114204079 TATAAAAAATACCTGAGGCTGGG - Intergenic
1102877951 12:116462287-116462309 TCTAATGAATACCTGAGACTGGG + Intergenic
1103131273 12:118470669-118470691 TATAAGAAGTACCTGAGACTGGG - Intergenic
1103293188 12:119864030-119864052 GATAATAGATACCTTAGACTTGG - Intronic
1104115820 12:125748139-125748161 TATAAGGAATACCTGAGACTGGG - Intergenic
1104170290 12:126274102-126274124 TGTAACAAATGACTAAAACTTGG + Intergenic
1104200094 12:126580354-126580376 TATACAAAATACCTGAGACTGGG + Intergenic
1104205908 12:126638259-126638281 TGCAATAAACACCTGAGACTGGG + Intergenic
1104722130 12:131050416-131050438 TATAAGAAATACCTGAGGCTGGG + Intronic
1104780544 12:131417158-131417180 TATAAGAAATGCCTGAGACTGGG - Intergenic
1105408871 13:20153112-20153134 TGTACCAAACACCATAGGCTAGG - Intronic
1105950179 13:25223253-25223275 GCTAAAAAATACCTTAGATTGGG + Intergenic
1106362463 13:29045219-29045241 TATAACAAATACCATAGATTGGG + Intronic
1106392658 13:29350655-29350677 TATAACAAATACCATAGATTGGG + Intronic
1106478417 13:30117734-30117756 TATAAAGAATACCTGAGACTGGG + Intergenic
1106633679 13:31504543-31504565 ATTAAGAAATACCTGAGACTGGG - Intergenic
1106714276 13:32372346-32372368 TATAAAGAATACCTGAGACTGGG + Intronic
1106714638 13:32374903-32374925 TATAAAAAATACCTGAGACTGGG + Intronic
1107237980 13:38196588-38196610 TGTAATGACTACCTAAGACTTGG + Intergenic
1107298736 13:38942712-38942734 CATAAAAAATACCTGAGACTGGG - Intergenic
1107342907 13:39428129-39428151 AGAAAGAAATACCTGAGACTGGG - Intronic
1107344397 13:39443438-39443460 TGTAACAAATACCTGAAAAGTGG + Intronic
1107735839 13:43397840-43397862 TGTAACAAATACTACAGACTAGG + Intronic
1107744272 13:43488476-43488498 TATAACAAATACCATTGATTAGG - Intronic
1107907365 13:45073796-45073818 TGCTATAAATACCTGAGACTGGG + Intergenic
1108054740 13:46474367-46474389 TAACAAAAATACCTTAGACTGGG - Intergenic
1108504759 13:51102732-51102754 TTAAAGAAATACCTGAGACTGGG + Intergenic
1108680232 13:52773782-52773804 TAAAAAAAATACCTGAGACTGGG + Intergenic
1108697724 13:52917505-52917527 TATAACAAATACCACAGACTGGG + Intergenic
1108715897 13:53077554-53077576 GGAAAGAAATACCTGAGACTGGG + Intergenic
1108893483 13:55293749-55293771 TATAAAAAAAACCTGAGACTGGG - Intergenic
1108957669 13:56181933-56181955 TTTAACATATATCTTAGAATTGG - Intergenic
1109091654 13:58053352-58053374 TATAAAAAATACCTGAGACTGGG - Intergenic
1109549667 13:63876918-63876940 TATAAAAAATACCTGAGACTGGG - Intergenic
1109656196 13:65393755-65393777 TATTACAAATACTTTATACTGGG + Intergenic
1109668839 13:65576835-65576857 TGTAAAAAATACCATTGCCTTGG - Intergenic
1109925647 13:69135013-69135035 TGTTACAAATACCTTGAATTTGG - Intergenic
1110297729 13:73887629-73887651 ATTAAGAAATACCTGAGACTGGG - Intronic
1110562251 13:76921901-76921923 TTTTAAAAATACCATAGACTGGG + Intergenic
1110752577 13:79132301-79132323 TATAACAAATACCGTATAGTGGG + Intergenic
1110933488 13:81253056-81253078 TGTAACAAATGTCATAGATTGGG + Intergenic
1111098258 13:83543317-83543339 TGTAAAAAATACCATATATTTGG - Intergenic
1111388309 13:87559638-87559660 ACTAATAAATACCCTAGACTGGG + Intergenic
1111420013 13:87999512-87999534 TGTAAAAAATAACTTAGGCTGGG - Intergenic
1111480077 13:88812272-88812294 TGTGAAGAATACCTCAGACTGGG - Intergenic
1111635978 13:90903939-90903961 TTAAAGAAATACCTAAGACTGGG - Intergenic
1111813330 13:93119564-93119586 TACAATAAATACCTGAGACTGGG + Intergenic
1111956673 13:94766568-94766590 TTTAAGAAATACTTGAGACTAGG + Intergenic
1112068092 13:95816151-95816173 ATTAAGAAATACCTGAGACTGGG - Intronic
1112121804 13:96420440-96420462 TATAACATATCACTTAGACTCGG + Intronic
1112235753 13:97634707-97634729 TATAAGAAATGCCTGAGACTGGG + Intergenic
1112436343 13:99393800-99393822 TTAAAGAAATACCCTAGACTGGG - Intergenic
1112652056 13:101410128-101410150 TGTAACAAATAGCACAGACTAGG - Intronic
1112860041 13:103819174-103819196 GCTAATAAATACCTGAGACTGGG + Intergenic
1113528436 13:111000936-111000958 AGTAACAAACACCACAGACTGGG - Intergenic
1114178071 14:20341788-20341810 TGACACAAATAAATTAGACTAGG - Intergenic
1114225093 14:20730888-20730910 TGTAACAACTACCCTAGAATTGG - Intergenic
1114829724 14:26126102-26126124 TGTAACAGAAACGTTAGACTGGG + Intergenic
1115197522 14:30817311-30817333 TATAACTAATACCATAGACTGGG - Intergenic
1115821984 14:37222921-37222943 TATAACAAATACCACAGGCTGGG + Intronic
1116112472 14:40604559-40604581 CATAACAAATACCATAGACTGGG + Intergenic
1116520374 14:45839536-45839558 TATAAAAAATACCATAGACTGGG + Intergenic
1116526673 14:45915214-45915236 TATAAGAAATACCTGAGATTAGG + Intergenic
1116686470 14:48045792-48045814 TGAAACAAATACCTTGCACTTGG + Intergenic
1116779061 14:49215667-49215689 AGAAATAAATACCTGAGACTGGG - Intergenic
1116809368 14:49524485-49524507 AAAAAAAAATACCTTAGACTGGG - Intergenic
1116902003 14:50370573-50370595 TGCTATAAATACCTGAGACTGGG + Intronic
1117498665 14:56330772-56330794 CGTAACAAATACCACAAACTGGG + Intergenic
1117743319 14:58841804-58841826 TATAAAAAATACAATAGACTGGG + Intergenic
1118530070 14:66694372-66694394 TTTAAAAAATACCATGGACTGGG - Intronic
1118764834 14:68902769-68902791 TGTAGCAAGTTCCTTATACTGGG - Intronic
1118935582 14:70284899-70284921 TTAAAGAAATACCTGAGACTGGG + Intergenic
1119018927 14:71089430-71089452 TGTAAGGAATACCCGAGACTGGG + Intronic
1119094485 14:71816383-71816405 TGCTATAAATACCTGAGACTGGG + Intergenic
1119147030 14:72326691-72326713 AGAAAAAAATACCTGAGACTGGG - Intronic
1119611719 14:76069021-76069043 TGAGAGAAATACCTGAGACTGGG + Intronic
1119635798 14:76272255-76272277 CATAACAAATACTATAGACTAGG + Intergenic
1120057482 14:79941745-79941767 TGTAACAAAGACCATGAACTGGG - Intergenic
1120287329 14:82520508-82520530 TACAAAAAATACCTTAGACTGGG - Intergenic
1120447113 14:84612889-84612911 ATAAAGAAATACCTTAGACTGGG - Intergenic
1120468338 14:84890528-84890550 TATTACAGATACCATAGACTGGG + Intergenic
1120628359 14:86857244-86857266 AGTAAGAAATACCCAAGACTGGG - Intergenic
1120674338 14:87403500-87403522 CATAACAAATACCATAGACCAGG + Intergenic
1120712365 14:87806326-87806348 TATAAGGAATACCTGAGACTGGG + Intergenic
1120963984 14:90151171-90151193 AGAAAGAAATACCTGAGACTGGG - Intronic
1121236250 14:92393212-92393234 TTAACCAAATACCTTAGGCTGGG - Intronic
1121596581 14:95167980-95168002 TGTAAGAAAGACGTAAGACTCGG + Intergenic
1121734269 14:96206806-96206828 TATAAGAAATACTTTAGACTGGG + Intronic
1122085996 14:99305265-99305287 TATAAAGAATACCTGAGACTGGG - Intergenic
1122171181 14:99877039-99877061 TGTAACAAAGTCCATAGACTGGG + Intronic
1122260145 14:100513483-100513505 AGGACAAAATACCTTAGACTGGG - Intronic
1122822039 14:104352544-104352566 TGTAACAAAATCTTTAGACATGG - Intergenic
1122868736 14:104623875-104623897 TCTAACAAATACCTACAACTGGG + Intergenic
1123101466 14:105804757-105804779 TGACAAAAATACCATAGACTGGG + Intergenic
1123181110 14:106470878-106470900 TGTAACAGATGCCTCAGAGTGGG + Intergenic
1123207920 14:106731397-106731419 TGTAACAAAGACCACAGAGTAGG + Intergenic
1123504353 15:20924749-20924771 AGTAAAAGGTACCTTAGACTGGG + Intergenic
1123561599 15:21498448-21498470 AGTAAAAGGTACCTTAGACTGGG + Intergenic
1123597843 15:21935729-21935751 AGTAAAAGGTACCTTAGACTGGG + Intergenic
1123965743 15:25455537-25455559 TGCTACAAATACCTGAGACTGGG + Intergenic
1124086814 15:26558858-26558880 AGAAAGAAATACCTGAGACTGGG + Intronic
1124136177 15:27038130-27038152 TGTAACAAATACCTTAGACTGGG + Intronic
1125906204 15:43394919-43394941 TGTAAAGAATACCTTAGACTGGG - Intronic
1125969614 15:43901288-43901310 TGTAACAAGTATCACAGACTGGG - Intronic
1126232028 15:46338538-46338560 TGTACCAAATACCTCAGGCAAGG + Intergenic
1126238062 15:46408736-46408758 TGTAACAAATCTCTTATATTAGG - Intergenic
1126772184 15:52069417-52069439 TGTAACAAATATCTTACAGAAGG + Intergenic
1126989514 15:54356429-54356451 TAACAAAAATACCTTAGACTGGG + Intronic
1127176073 15:56359011-56359033 TATAAAAAATACCTGAGACTGGG - Intronic
1127321978 15:57855765-57855787 ACCACCAAATACCTTAGACTCGG - Intergenic
1127920458 15:63490420-63490442 TGTAACATATACCACAGATTGGG - Intergenic
1128505424 15:68267508-68267530 TATAACAAATGCTTTAGAATGGG - Intergenic
1128616198 15:69111934-69111956 CATAACAAATACCATAAACTGGG - Intergenic
1128930021 15:71696132-71696154 TTTTAAAAATACCTGAGACTGGG + Intronic
1129130453 15:73488890-73488912 TATAACAAATACCTGAAAATGGG - Intronic
1129314698 15:74734437-74734459 GGTAAGGAATACCTGAGACTGGG - Intergenic
1129774215 15:78224103-78224125 TGTAACAATTACCACAAACTTGG - Intronic
1129970945 15:79777456-79777478 TTAAATAAATACCTGAGACTGGG + Intergenic
1130050096 15:80477212-80477234 ATAAACAAATACCTGAGACTGGG - Intronic
1130687437 15:86051195-86051217 TATAACAAATAGCATAAACTGGG + Intergenic
1130731394 15:86496364-86496386 TATAAAGAATACCTGAGACTGGG - Intronic
1130804148 15:87301030-87301052 TCTAACAAATACCATAAACCAGG + Intergenic
1131199022 15:90380780-90380802 AGAAAGAAATACCTGAGACTGGG + Intergenic
1131267374 15:90924835-90924857 TGACAAAAATACCTGAGACTGGG - Intergenic
1132202208 15:99962784-99962806 TATAACAAACACCTTAGCCTGGG - Intergenic
1132221129 15:100106313-100106335 TCTAACGAATACCCTAGACTGGG - Intronic
1202969944 15_KI270727v1_random:225573-225595 AGTAAAAGGTACCTTAGACTGGG + Intergenic
1133045306 16:3085025-3085047 TGTAAAAAATACCTGAGACTGGG + Intergenic
1133358981 16:5158613-5158635 TGCTATAAATACCTGAGACTGGG - Intergenic
1133405038 16:5516927-5516949 ATTAAGAAATACCTGAGACTGGG - Intergenic
1133537134 16:6713108-6713130 TGTAAGAAATACCTGAGACTGGG - Intronic
1134904387 16:17967475-17967497 TATAAAAAATACCTGAGACTAGG - Intergenic
1135052971 16:19207358-19207380 TATAAGAAATACCTGAGACTGGG + Intronic
1135128548 16:19832685-19832707 TATAAAGAATACCTGAGACTGGG + Intronic
1136717586 16:32296292-32296314 TAAAACAAATAACTAAGACTGGG + Intergenic
1136835962 16:33502556-33502578 TAAAACAAATAACTAAGACTGGG + Intergenic
1137490466 16:48928163-48928185 TGGAAGAAATACCCAAGACTGGG + Intergenic
1137523726 16:49215528-49215550 TGTAAAAAATACCTAAAACGTGG - Intergenic
1137652126 16:50129749-50129771 TATAAAAAATACCTGAGGCTAGG + Intergenic
1137683602 16:50371180-50371202 TGTGACAAAGACCTGAGGCTGGG + Intergenic
1137968029 16:52956043-52956065 TTAAAGAAATACCTGAGACTGGG - Intergenic
1138239195 16:55412739-55412761 TATAAAAAATACCCAAGACTGGG - Intronic
1138292057 16:55856189-55856211 ATTAAGAAATACCTGAGACTGGG - Intronic
1138546884 16:57725009-57725031 TTGAAGAAATACCTGAGACTGGG + Intronic
1138603897 16:58074903-58074925 TGTAACAAATACCTAAAATGAGG + Intergenic
1138630348 16:58289309-58289331 TATAACAAATATCACAGACTGGG - Intronic
1138697657 16:58830446-58830468 ATTAAAAAATACCTGAGACTGGG - Intergenic
1138730255 16:59186212-59186234 TGTAACAAATACCTAAAATGTGG - Intergenic
1138997781 16:62475378-62475400 TGCTACAAAGACCTGAGACTGGG - Intergenic
1139212095 16:65088291-65088313 ATTAAAAAATACCTTAGAGTGGG - Intronic
1139316575 16:66076334-66076356 TGCAAAGAATACCTGAGACTGGG + Intergenic
1139974477 16:70797990-70798012 ATAAACAAATACCTGAGACTGGG - Intronic
1140507555 16:75483329-75483351 GGTAACAAATACCTTGGCTTGGG - Intronic
1140514637 16:75533067-75533089 GGTAACAAACACCTTAGCTTGGG - Exonic
1140596379 16:76419693-76419715 TATAACCAATACCATAGACTGGG + Intronic
1140878736 16:79177852-79177874 TATAACAGATACCATAAACTAGG + Intronic
1141024535 16:80532843-80532865 TGTCACATATATCCTAGACTAGG - Intergenic
1141064812 16:80905541-80905563 TCTAAAAAATACCTGAGGCTGGG - Intergenic
1141225593 16:82111824-82111846 TGTAAAATATACCCTAGATTTGG - Intergenic
1141368817 16:83468488-83468510 TGTAACAAATACCACGAACTGGG - Intronic
1141782433 16:86172373-86172395 TATAACAAATATCATAGACTGGG - Intergenic
1203008842 16_KI270728v1_random:221482-221504 TAAAACAAATAACTAAGACTGGG - Intergenic
1203146139 16_KI270728v1_random:1802877-1802899 TAAAACAAATAACTAAGACTGGG + Intergenic
1142907781 17:3057105-3057127 TATAACAAATACCATACACTGGG - Intergenic
1142926782 17:3247154-3247176 TATAACAAATACCATACACTGGG + Intergenic
1142991538 17:3734520-3734542 AGTAAAAATTAGCTTAGACTGGG - Intronic
1143394936 17:6586302-6586324 TGCTATAAATACCTGAGACTGGG - Intronic
1143928939 17:10400246-10400268 TTTAAAAAATACCATAGAATGGG + Intronic
1144241581 17:13318009-13318031 TATAAAGAATACCTGAGACTGGG + Intergenic
1144498146 17:15763266-15763288 TCTAAAGAATACCTGAGACTGGG - Intergenic
1144528914 17:16017111-16017133 CGTAACAAATACCTTAAATAGGG - Intronic
1145161523 17:20578307-20578329 TCTAAAGAATACCTGAGACTGGG - Intergenic
1146383224 17:32346899-32346921 TGTAACAAACACCACAGACTGGG + Intronic
1146452124 17:32982881-32982903 AGGAAGAAATACCTGAGACTGGG + Intronic
1146567697 17:33927618-33927640 TCTAACAAATACCATAGATTGGG - Intronic
1149218914 17:54391519-54391541 TGTAAAAAGAACCTTGGACTTGG - Intergenic
1149338262 17:55659943-55659965 TGTAACAAATAGCTGAGTCTTGG - Intergenic
1150117833 17:62569829-62569851 TGTAACAAATACCATAAACTGGG + Intronic
1150155958 17:62853341-62853363 TGTAAGAACTGCCTGAGACTGGG + Intergenic
1150978960 17:70120445-70120467 TGCTATAAATACCTGAGACTGGG + Intronic
1151841444 17:76621033-76621055 TGTAACAAATAGCCAAGTCTTGG + Intergenic
1153076660 18:1169722-1169744 TGTAATAAATACCTTTGTCCGGG - Intergenic
1153138383 18:1943333-1943355 TGTAAAGAATACCTGAGGCTGGG - Intergenic
1154372390 18:13775861-13775883 TGCTATAAATACCTGAGACTGGG + Intergenic
1154392029 18:13945824-13945846 ATAAAAAAATACCTTAGACTGGG - Intergenic
1154408274 18:14117588-14117610 TGCTATAAATACCTGAGACTGGG + Intronic
1154474419 18:14742185-14742207 TAAAACAAATACCTAAGACTGGG + Intronic
1155788273 18:29930080-29930102 ATGAAGAAATACCTTAGACTCGG - Intergenic
1156169114 18:34460897-34460919 TATAAGAAATACTTGAGACTGGG - Intergenic
1156521735 18:37727601-37727623 CGTAACAAATACCACAGAATGGG + Intergenic
1156640223 18:39086111-39086133 TGTAAAGAATACTTGAGACTGGG + Intergenic
1156789597 18:40954860-40954882 TCTAAAAAATACCTGAGACTGGG - Intergenic
1156924963 18:42564802-42564824 TGTGAAGAATACCTGAGACTGGG - Intergenic
1156960406 18:43021824-43021846 TATAAAAAATACCTGAGACTGGG - Intronic
1157433793 18:47651878-47651900 TGTAACAAAGTCCTAAGACTGGG + Intergenic
1157940614 18:51924837-51924859 TTTAACAAATCCCTTAGTGTTGG - Intergenic
1158061606 18:53349550-53349572 TGTAAGACATACCCAAGACTGGG + Intronic
1158172336 18:54613874-54613896 TATAACAAATACCATAGACTAGG - Intergenic
1158190477 18:54822278-54822300 TGAAAAAAATACCTTATAATTGG + Intronic
1158564238 18:58541103-58541125 TGCTATAAATACCTGAGACTGGG + Intronic
1158682927 18:59584830-59584852 ATTAAGAAATACCTGAGACTGGG - Intronic
1159031068 18:63232938-63232960 TAACACAAATACCATAGACTGGG + Intronic
1159151940 18:64533046-64533068 TATAAGAAATACCCAAGACTAGG - Intergenic
1159319553 18:66829748-66829770 TGTAAGAAATACATGAGATTTGG - Intergenic
1159357552 18:67357502-67357524 TGAAAAAAATACCCAAGACTGGG - Intergenic
1159603568 18:70452083-70452105 AGGAAGAAATACCTGAGACTGGG + Intergenic
1159606155 18:70477469-70477491 TGGAAGAAATACCTGAGACTGGG - Intergenic
1159703823 18:71662181-71662203 TATAAAAAATACCCAAGACTGGG - Intergenic
1159791017 18:72778867-72778889 TCTAACAAATACCTCAAAATAGG - Intronic
1160053600 18:75459311-75459333 TGAAAGACATACCTGAGACTGGG + Intergenic
1160261066 18:77294768-77294790 GCTAAAAAATACCTGAGACTAGG - Intergenic
1160342028 18:78097526-78097548 TATAAGACATACCTGAGACTGGG + Intergenic
1161573414 19:5042519-5042541 GGAAACAAACACCTGAGACTGGG + Intronic
1162254043 19:9473075-9473097 AGAAAGAAATACCTGAGACTGGG - Intronic
1162416372 19:10540523-10540545 TGTGACAAATACCATAGCCTTGG - Intergenic
1162609075 19:11735451-11735473 AGTAACAAAGACCTCAGACAGGG + Intronic
1164560504 19:29288835-29288857 TGTAGCACACACCTTAGACCAGG - Intergenic
1164795920 19:31029892-31029914 TGTATCTAATACTTTATACTGGG + Intergenic
1164871411 19:31647415-31647437 TTAAAGAAATACCTAAGACTGGG + Intergenic
1166416776 19:42601035-42601057 TATAACAAACACCATAGCCTGGG + Intronic
1166436295 19:42768591-42768613 CATAACAAACACCTTAGCCTGGG + Intronic
1166446167 19:42858619-42858641 CATAACAAACACCTTAGCCTGGG + Intronic
1166449155 19:42882568-42882590 TATAACAAACACCTTAGCCTGGG + Intronic
1166456042 19:42940080-42940102 CATAACAAACACCTTAGCCTGGG + Intronic
1166465830 19:43029349-43029371 CATAACAAATGCCTTAGCCTGGG + Intronic
1166471970 19:43085549-43085571 CATAACAAACACCTTAGCCTGGG + Intronic
1166483109 19:43189375-43189397 CATAACAAACACCTTAGCCTGGG + Intronic
1166485577 19:43208471-43208493 CATAACAAACACCTTAGCCTGGG + Intergenic
1166496601 19:43307364-43307386 TGTAACAAACACCTTAGTCTGGG + Intergenic
1168383614 19:55944622-55944644 CATAACAAATACCATACACTGGG - Intergenic
925510217 2:4617207-4617229 TATAAAAAATATATTAGACTGGG + Intergenic
925559953 2:5180933-5180955 ATTAAAAAATACCTAAGACTGGG + Intergenic
925749180 2:7072100-7072122 TGTAACAAATGCCTAAAAATGGG + Intergenic
926248524 2:11139238-11139260 TATAAATAATACCTGAGACTGGG - Intronic
926350889 2:11993412-11993434 TCTAACAAATACCTAAAACTCGG + Intergenic
926391137 2:12394149-12394171 TGTAACAAAAACCATAAACTGGG + Intergenic
926490819 2:13524202-13524224 TATATCAAATACCATAGACTGGG + Intergenic
926564380 2:14453714-14453736 TATAACAAATACCACAGCCTTGG + Intergenic
926879810 2:17532182-17532204 TGTAACAAATACCACAGTCTTGG + Intergenic
926908543 2:17828500-17828522 AATAGAAAATACCTTAGACTGGG - Intergenic
927079645 2:19614882-19614904 TTAAAGAAATACCTGAGACTGGG + Intergenic
927178555 2:20427519-20427541 AGGAAGAAATACCTGAGACTGGG - Intergenic
927329290 2:21842818-21842840 TATAAAGAATACCTGAGACTGGG - Intergenic
927762891 2:25775738-25775760 TGCTATAAATACCTGAGACTGGG - Intronic
927831185 2:26351845-26351867 TTTAACAAATACCTCAGGCCAGG + Intronic
927831959 2:26359124-26359146 TGCAACAAATACATAACACTTGG - Intronic
927988602 2:27431003-27431025 TGTAAGAAATAACCTAGGCTGGG + Intronic
928292257 2:30049683-30049705 TGTAACAAATAGCTGAGTCTCGG + Intergenic
928538658 2:32263772-32263794 TGTTTAAAATACCATAGACTGGG - Intronic
929081479 2:38126730-38126752 TATAAAAACTACCTGAGACTGGG - Intergenic
929286609 2:40142029-40142051 TGTAATAAATACCACAGACTGGG - Intronic
929766207 2:44845971-44845993 ATTAAAAAATACCTTAGACTGGG + Intergenic
930260553 2:49141266-49141288 ATTAAAAAATACCTAAGACTGGG + Intronic
930553905 2:52870757-52870779 AGTAAGAAAGACCTGAGACTGGG - Intergenic
930578110 2:53177090-53177112 TATAAAGAATACCATAGACTGGG - Intergenic
930673487 2:54176122-54176144 TAAACAAAATACCTTAGACTGGG - Intronic
930828358 2:55716777-55716799 GTTAACAAGTACCTCAGACTTGG - Intergenic
930878055 2:56242268-56242290 TGCTATAAATACCTGAGACTGGG + Intronic
931071722 2:58659073-58659095 CTTAAAAAATACCATAGACTAGG + Intergenic
931096011 2:58942096-58942118 TGAAGAAAATACCTAAGACTGGG - Intergenic
931110401 2:59104651-59104673 CATAACAAATACCATAGACTAGG + Intergenic
931154837 2:59616158-59616180 TATAAAGAATACCTGAGACTGGG + Intergenic
931774880 2:65531968-65531990 CATAACAAATGCCATAGACTGGG - Intergenic
931906236 2:66846629-66846651 TGAAACAAATCCCTTAGCTTTGG + Intergenic
932013278 2:67999520-67999542 TGTAACAAATACAACAGACTGGG + Intergenic
932315236 2:70776412-70776434 CTTAACAAATACCATAGACTGGG - Intergenic
932877993 2:75473493-75473515 TATAATAACTACCCTAGACTAGG + Intronic
932879625 2:75489119-75489141 TATAAGAACTACCTGAGACTGGG + Intronic
932926738 2:75984785-75984807 TGCATCAAATACATTAGACTAGG - Intergenic
933074181 2:77902518-77902540 TCTAACAAATACCTTAAAGGAGG + Intergenic
933290836 2:80436583-80436605 GGAACAAAATACCTTAGACTGGG + Intronic
933446393 2:82385183-82385205 TTGAAGAAATACCTGAGACTAGG - Intergenic
933878428 2:86643889-86643911 AGAAAGAAATACCTGAGACTGGG - Intronic
934700721 2:96437868-96437890 TTAAAGAAATACCTGAGACTGGG - Intergenic
934784068 2:96991935-96991957 TATAAAAACTACCTGAGACTGGG + Intronic
934817948 2:97346589-97346611 TATAACAAAATACTTAGACTGGG + Intergenic
934819748 2:97361895-97361917 TATAACAAAATACTTAGACTGGG - Intergenic
934995793 2:98958157-98958179 TGAAATAAATACCTTTGGCTGGG - Intergenic
935151771 2:100443354-100443376 TATAAAAAATACCTGAGACTGGG - Intergenic
935189344 2:100763474-100763496 TATAACAACTGCCTGAGACTGGG - Intergenic
935660005 2:105458527-105458549 TATAACAACTATCATAGACTAGG + Intergenic
935798885 2:106672317-106672339 TATAAAAAATACCTGATACTGGG - Intergenic
936407670 2:112221508-112221530 ATAAAGAAATACCTTAGACTGGG - Intronic
936866594 2:117081845-117081867 TATAAAAAATACCCAAGACTGGG + Intergenic
936908205 2:117562004-117562026 TTAAAAAAATACTTTAGACTGGG + Intergenic
937037040 2:118790732-118790754 TGCAACAAATATTGTAGACTGGG - Intergenic
937332974 2:121043691-121043713 TGTAACAAATACCACAGACAGGG - Intergenic
937487924 2:122335100-122335122 TATAATAAATACCATAGACAAGG - Intergenic
937522449 2:122728624-122728646 TGTAACAAACACATTAGATTGGG + Intergenic
937590163 2:123603888-123603910 TCGAACAAATACATTAGAATGGG + Intergenic
937942276 2:127295240-127295262 TGTAACAAATACCTAACAATGGG + Intergenic
938123740 2:128655050-128655072 TATAAAAAATATCTGAGACTGGG - Intergenic
938316641 2:130333966-130333988 TGTAACAAATAACTAAAACGTGG + Intergenic
938744998 2:134269114-134269136 TGTAAAAAATACCTGAGCCTGGG + Intronic
938994876 2:136667842-136667864 TGTAAAAAATACCTGAGACTGGG + Intergenic
939053631 2:137335072-137335094 TGAAGAAAATACCTGAGACTGGG - Intronic
939174112 2:138729906-138729928 TGTAACAAATACCACAGACTGGG + Intronic
939209046 2:139147689-139147711 TATAAAAAATACCTAAGACTGGG - Intergenic
939219181 2:139280347-139280369 TATAACAAATACCACAGACTAGG - Intergenic
939506754 2:143055971-143055993 TATGAAAAATACCTGAGACTGGG + Intergenic
939687290 2:145214966-145214988 ATAAATAAATACCTTAGACTGGG + Intergenic
939834524 2:147112289-147112311 TGTTATAAATACCTGAAACTAGG - Intergenic
939857619 2:147378854-147378876 TGAAACAAATACAGTAGACCTGG - Intergenic
939920941 2:148112458-148112480 TGTACCAAATACTTTATACTTGG + Intronic
940729899 2:157376515-157376537 TGCTATAAATACCTGAGACTGGG + Intergenic
940735549 2:157447406-157447428 CATAACAAATACCATAGACTGGG - Intronic
941033856 2:160544532-160544554 TAACAAAAATACCTTAGACTGGG - Intergenic
941301551 2:163808750-163808772 TTAAAGAAATACCTGAGACTGGG - Intergenic
941478764 2:165979993-165980015 TACGACAAATACCATAGACTGGG - Intergenic
941647878 2:168060544-168060566 TAAAAAAAATACCATAGACTAGG - Intronic
941735933 2:168977621-168977643 TATAAAGAATACCTGAGACTGGG + Intronic
941754593 2:169171457-169171479 TGTAGTCAATACCTTCGACTGGG + Intronic
942256988 2:174112832-174112854 TGTAACAGATACCACAGACTAGG - Intronic
942288716 2:174448484-174448506 TGTAACAAAAACACTATACTGGG + Intronic
942595483 2:177588118-177588140 TGTAACAAATACATTAAATCAGG + Intergenic
942819338 2:180093137-180093159 TACAACAAATATCCTAGACTGGG + Intergenic
943251819 2:185531787-185531809 TTTAAAAAATACCTAATACTTGG - Intergenic
943343424 2:186708918-186708940 TGCTATAAATACCTGAGACTTGG + Intronic
943474918 2:188342133-188342155 TATAACAAATACCATACACTTGG + Intronic
943487350 2:188502774-188502796 TATAACAAAAACCTGAGATTGGG + Intronic
943651125 2:190458513-190458535 TGTAACAAATACCACAGACTGGG - Intronic
943828034 2:192420938-192420960 ATAAAGAAATACCTTAGACTGGG - Intergenic
943829821 2:192446325-192446347 TATAAAGAATACCTGAGACTGGG - Intergenic
943999744 2:194818556-194818578 AGTAACAAAGAGCATAGACTTGG + Intergenic
944150710 2:196555164-196555186 TATAACAAATACCATAAACTGGG + Intronic
944294609 2:198048417-198048439 TGTAAAAAATGCCTGAGACTGGG + Intronic
944384499 2:199149504-199149526 GGGAAGAAATACCTGAGACTGGG - Intergenic
944467352 2:200016726-200016748 TATAACAAATGCAGTAGACTGGG + Intergenic
944817853 2:203397645-203397667 TGCTATAAATACCTGAGACTGGG + Intronic
945229976 2:207577304-207577326 TGTAATAAATACATTACATTGGG + Intronic
945316876 2:208378763-208378785 TAACAAAAATACCTTAGACTGGG - Intronic
945469548 2:210211751-210211773 TATAAAAAATACCTGAAACTGGG - Intronic
945617419 2:212089761-212089783 GTAAACAAATACCTGAGACTGGG - Intronic
945649845 2:212543441-212543463 TATATCAAATACCATTGACTGGG + Intergenic
946013055 2:216582020-216582042 TGCAACAAATACCACAAACTGGG + Intergenic
946145405 2:217726807-217726829 TATAACAAATATCATAGACTGGG + Intronic
946531384 2:220574093-220574115 TATAAAAAATACCTGAGACTGGG + Intergenic
946830753 2:223726082-223726104 TATAATGAATACCATAGACTGGG + Intergenic
946918643 2:224553850-224553872 TGTAACAAATCCCATAAACCAGG - Intronic
947110945 2:226719180-226719202 TATAAAGAATACCTGAGACTGGG + Intergenic
947145077 2:227056933-227056955 TCTACCAAATACCTTAAACTAGG - Intronic
947197513 2:227583608-227583630 TGTAAAGAAAACCTGAGACTGGG + Intergenic
948319469 2:237058056-237058078 TACAAAAAATACCTGAGACTGGG - Intergenic
948321650 2:237074436-237074458 TGCTATAAATACCTGAGACTGGG - Intergenic
948332147 2:237178146-237178168 TGTAACAAATACCATAGGCTGGG - Intergenic
948342265 2:237263246-237263268 TATAAAAAATACCTAAGACTGGG - Intergenic
1168844980 20:938188-938210 AGAAAGAAATACCTGAGACTGGG - Intergenic
1168931114 20:1624798-1624820 TAAAAGAAATACCTGAGACTGGG + Intergenic
1169164866 20:3414522-3414544 TATAAAAAATACCTTGGACTGGG + Intergenic
1169281153 20:4267947-4267969 TGTAACAAGTACCATAGACTGGG + Intergenic
1169303118 20:4463139-4463161 TATAAAAAATACCCAAGACTGGG - Intergenic
1169458746 20:5776251-5776273 TATCACAAATACCATACACTGGG + Intronic
1169497965 20:6132999-6133021 TGTAACAAAGACCATGGACTGGG - Intergenic
1169524485 20:6408528-6408550 TATAAAAAATACCAGAGACTGGG - Intergenic
1169852761 20:10070515-10070537 TATTAAAAATACCTGAGACTGGG + Intergenic
1169918140 20:10704162-10704184 TATAAAAAATACCTGAGTCTGGG - Intergenic
1170275694 20:14584359-14584381 TATAATAAATACCATCGACTGGG + Intronic
1170313685 20:15019028-15019050 TGTAAAGAATACTTGAGACTGGG - Intronic
1170421340 20:16196524-16196546 ATTAAAAAATACCTGAGACTAGG + Intergenic
1170560258 20:17551132-17551154 TGCTATAAATACCTTAGACTGGG + Intronic
1171105239 20:22427031-22427053 TATAAAAAATACCACAGACTAGG - Intergenic
1171309088 20:24131720-24131742 TATAACAAATACCTGATACAGGG + Intergenic
1171437019 20:25131697-25131719 TATAACAAATACCTTAGCCTGGG + Intergenic
1171497979 20:25570592-25570614 ATAAAGAAATACCTTAGACTGGG - Intronic
1173427629 20:42956607-42956629 TGAAAGAAATACCTGAGGCTGGG - Intronic
1173921683 20:46750892-46750914 TAAAAAAAATACCTGAGACTGGG + Intergenic
1174810991 20:53645568-53645590 TGTACTAAATACTTTAGATTAGG - Intergenic
1176078887 20:63261801-63261823 TGTAACAAATGCCTTGGACTGGG + Intronic
1176919072 21:14664595-14664617 TATAAAGAATACCTGAGACTGGG + Intergenic
1176920260 21:14679663-14679685 TATAAGAAATACCTGAGACTGGG + Intergenic
1177084122 21:16680922-16680944 TGAAAGATATACCTGAGACTGGG - Intergenic
1177180400 21:17738822-17738844 TGTAACAAATAGCTGAGTCTCGG - Intergenic
1177222773 21:18216633-18216655 TATAAAAAATACCTGAGACTGGG + Intronic
1177342291 21:19819165-19819187 TATAAAAAATACCTGGGACTTGG - Intergenic
1177470423 21:21553962-21553984 TGGTATAAATACCTGAGACTGGG - Intergenic
1177515569 21:22147307-22147329 AAAAAGAAATACCTTAGACTGGG - Intergenic
1177532259 21:22375228-22375250 TATAAAGAATACCTGAGACTGGG + Intergenic
1177561025 21:22753800-22753822 TTGAAGAAATACCTAAGACTGGG - Intergenic
1177774372 21:25551581-25551603 TTAAAGAAATACCTGAGACTGGG + Intergenic
1177869680 21:26556479-26556501 AGGAAGAAATACCTGAGACTGGG + Intronic
1177872906 21:26595080-26595102 TGTAACAAATGCCATAGACTGGG + Intergenic
1177883165 21:26718238-26718260 TATAAAAAATACCTGAGACTGGG + Intergenic
1177892490 21:26823266-26823288 TGAAAAAAATACCCAAGACTGGG - Intergenic
1177935984 21:27347157-27347179 TATAAAAAATACCTGAGACTGGG + Intergenic
1178017204 21:28361865-28361887 TATAACAAATATTTTAGATTGGG + Intergenic
1178205070 21:30455613-30455635 TGCCATAAATACCTGAGACTGGG + Intergenic
1178374059 21:32051784-32051806 TATAAGGAATACCTGAGACTGGG - Intergenic
1178730210 21:35095056-35095078 TATAAAAAATACCTGAGGCTGGG + Intronic
1179004357 21:37497479-37497501 TGTAACCAAAAACTTAGTCTGGG + Intronic
1179083189 21:38192466-38192488 TGTAACAAATACCACAGATGGGG + Intronic
1179181329 21:39047589-39047611 TATAAGACATACCTGAGACTGGG + Intergenic
1179313619 21:40220446-40220468 TGTAAGAATAACCTTAGCCTGGG + Intronic
1179432903 21:41336570-41336592 TTAAAAAAATACCTTAGGCTAGG - Intronic
1179560698 21:42214403-42214425 TGTAACAAATATCGTAGACTGGG - Intronic
1179877796 21:44280062-44280084 TGTAATAAAATCCTTAGAGTGGG + Intergenic
1182251000 22:29000631-29000653 TCTAAGGAATACCTGAGACTGGG + Intronic
1182936099 22:34223145-34223167 ATAAACAAATACCTGAGACTGGG - Intergenic
1182951918 22:34384140-34384162 TATAAAGAATACCTGAGACTGGG - Intergenic
1182974065 22:34605956-34605978 TATAAGAAATATCTGAGACTGGG - Intergenic
1183044534 22:35209183-35209205 AGAAAGAAATACCTGAGACTGGG + Intergenic
1183261017 22:36796012-36796034 GTAAAAAAATACCTTAGACTGGG + Intergenic
1184179365 22:42809690-42809712 TGTAAATAATACCTTAAAATTGG + Intronic
1184472791 22:44705100-44705122 TGTAACAAAGACCACAAACTCGG + Intronic
1184532922 22:45068169-45068191 TGAAAAAAATACCTGAGACTGGG + Intergenic
1184894584 22:47399684-47399706 TGAAAAAAATACCCGAGACTGGG + Intergenic
1185201907 22:49512156-49512178 TGTAAAAAATACCATAGGCTGGG - Intronic
949128304 3:472077-472099 AGAAAGAAATACCTAAGACTGGG - Intergenic
949404880 3:3703652-3703674 AGAAAGAAATACCTGAGACTGGG + Intronic
949481575 3:4499018-4499040 TGTAGCACACACCTTGGACTCGG + Intronic
950318245 3:12024950-12024972 TGTAACAAAGACCTTAGACTGGG + Intronic
950837973 3:15938742-15938764 CATAACAAATACCATAGCCTGGG - Intergenic
951091357 3:18577225-18577247 TGTAGCAAATATCTTAGACTGGG - Intergenic
951180480 3:19653595-19653617 TATAAAGAATACCTGAGACTGGG + Intergenic
951227417 3:20136901-20136923 ACAAACAAATACATTAGACTGGG - Intronic
951351814 3:21615407-21615429 ATTAACAAATACCTGAGCCTGGG - Intronic
951384064 3:22023907-22023929 TCTAAAGAATACCTGAGACTGGG + Intronic
951430509 3:22601503-22601525 TATAACAAATACCATAGACTTGG - Intergenic
951809998 3:26688420-26688442 TATAAAAAATACCTGAGACTGGG + Intronic
951864277 3:27289884-27289906 TGTAACAAATTCCATAAACAAGG - Intronic
951949002 3:28177680-28177702 ATAAACAAATACCTAAGACTGGG + Intergenic
952480346 3:33754636-33754658 TTGAAGAAATACCTGAGACTGGG + Intergenic
952510406 3:34047897-34047919 TATAAAAAATACCTTAGACTGGG - Intergenic
952669591 3:35950012-35950034 TATAGCAAATATCTGAGACTGGG - Intergenic
952726475 3:36591792-36591814 TATCAGAAATACCATAGACTGGG + Intergenic
953195995 3:40733951-40733973 TTAAAGAAATACCTGAGACTGGG + Intergenic
953437865 3:42894024-42894046 ATAAAAAAATACCTTAGACTGGG + Intronic
953660748 3:44889896-44889918 TCTAAAGAATACCTGAGACTGGG + Intronic
953972523 3:47358101-47358123 TAAAAAAAATACCTGAGACTGGG - Intergenic
954329829 3:49883988-49884010 AGAAAGAAATACCTGAGACTAGG - Intergenic
954502528 3:51032007-51032029 TGTAACAAAATACTTATACTTGG - Intronic
956239631 3:67115313-67115335 TATAAGAAATACCTGAGACTGGG - Intergenic
956261248 3:67344198-67344220 GTAAACAAATACCTGAGACTGGG - Intergenic
956347683 3:68298838-68298860 TATAAGAAATATCTGAGACTGGG - Intronic
956877445 3:73477743-73477765 TCTAAGAAATACCCAAGACTGGG + Intronic
956991874 3:74775988-74776010 TGTAACAAATATCTTGTATTTGG + Intergenic
957400764 3:79710009-79710031 TATAACAAATTTCATAGACTGGG - Intronic
957453501 3:80411220-80411242 TATAAAAAATATCTGAGACTGGG + Intergenic
957549381 3:81684333-81684355 TATAACAAATACCACAGACTGGG + Intronic
957558520 3:81791939-81791961 TATAACTAATACCGTAGGCTGGG + Intergenic
957770165 3:84680293-84680315 TGGAGCAATTACCTTAGGCTAGG - Intergenic
957772751 3:84715564-84715586 TGAAATAAAGACCTGAGACTGGG - Intergenic
958018246 3:87967802-87967824 TGATACACATACCTGAGACTGGG - Intergenic
958043736 3:88257659-88257681 TGTAACAAATACCACCAACTTGG + Intergenic
958537423 3:95423089-95423111 TGCTATAAATACCTGAGACTGGG + Intergenic
958659091 3:97042448-97042470 AGAAAGAAATACCTGAGACTGGG - Intronic
958740983 3:98071181-98071203 ATTAAAAAATACCATAGACTGGG - Intergenic
958770111 3:98415574-98415596 TATAAAGAATACCTGAGACTGGG - Intergenic
958799445 3:98738257-98738279 AGAAAGAAATACCTGAGACTAGG - Intronic
958841224 3:99208345-99208367 TGTAAAACATAACTGAGACTGGG + Intergenic
958897485 3:99844983-99845005 TATAAAGAATACCTGAGACTGGG - Intronic
959119094 3:102211697-102211719 TGTAAGAAATACATGAGATTTGG - Intronic
959169574 3:102828831-102828853 TATAACAAATACCATAGTCTGGG - Intergenic
959171726 3:102852314-102852336 TGCTATAAATACCTAAGACTGGG - Intergenic
959461841 3:106636632-106636654 TGTAACAAATACCACAGACTGGG + Intergenic
959814871 3:110663174-110663196 TCTAAGGAATACCTGAGACTGGG - Intergenic
959915317 3:111810335-111810357 CATAACAAATACTATAGACTGGG + Intronic
960121248 3:113950286-113950308 TAAAATAAATACCTGAGACTGGG + Intronic
960373932 3:116875428-116875450 CATAACAAATACCACAGACTGGG + Intronic
960542129 3:118872458-118872480 TTAAAGAAATACCTGAGACTGGG - Intergenic
961051141 3:123748003-123748025 TGTTATAAATACCTGAGGCTTGG + Intronic
961206310 3:125084859-125084881 TGTAAGTCATACCTTAGACATGG + Intronic
961908547 3:130288942-130288964 TTTAAAAAATACCATAAACTTGG - Intergenic
961925570 3:130476065-130476087 CATAACAAAGACCATAGACTGGG + Intronic
962098220 3:132314448-132314470 TTGAAGAAATACCTAAGACTGGG - Intergenic
962431338 3:135323277-135323299 TCCAACAAACACCTTAGACATGG - Intergenic
962888287 3:139648346-139648368 TATAAAGAATACCTGAGACTGGG - Intronic
962908130 3:139823839-139823861 TGTAGCAAATACCACAAACTGGG + Intergenic
963267171 3:143251147-143251169 TATAAAGAATACCTGAGACTTGG + Intergenic
963329565 3:143899030-143899052 TGTCATAAATACCATAGAATAGG - Intergenic
963533044 3:146495714-146495736 TGTAACAAATACCATAGACTGGG - Intronic
963823751 3:149929127-149929149 TATAAGAAATACCCAAGACTGGG + Intronic
964124867 3:153225873-153225895 TATAAAGAATACCTGAGACTGGG + Intergenic
964497779 3:157312762-157312784 TATAACAAATACCTGAGACTGGG + Intronic
964593779 3:158398222-158398244 ATTAAAAAATACCTGAGACTGGG + Intronic
965024945 3:163290711-163290733 TATAAAAAATACCCAAGACTGGG + Intergenic
965814484 3:172622471-172622493 TATAAAGAATACCTGAGACTGGG - Intergenic
965884723 3:173430935-173430957 TGTAAGAAATATCTGAGGCTGGG - Intronic
965928190 3:174008992-174009014 TGTAACGAATACCATACCCTGGG + Intronic
966673584 3:182559900-182559922 CATAACAAATACCGCAGACTGGG + Intergenic
967491506 3:190096529-190096551 TGTATGAACTACCTGAGACTGGG - Intronic
967571428 3:191033213-191033235 TGTAACAATTACCATAAATTTGG - Intergenic
967613416 3:191536069-191536091 ATTAAGAAATACCTGAGACTGGG + Intergenic
967992402 3:195141154-195141176 TGTAATAAACACCATAGATTAGG - Intronic
968385905 4:137256-137278 TGCTATAAATACCTGAGACTAGG - Intronic
968590571 4:1457260-1457282 TGTAAGAATTACCCAAGACTGGG + Intergenic
968673948 4:1866957-1866979 TGTAGCAAATACCACAGACTGGG + Intergenic
969095169 4:4727401-4727423 TATAAAAAATACCTGAGACTGGG - Intergenic
969118120 4:4886877-4886899 TATAAAGAATACCTGAGACTGGG - Intergenic
969231439 4:5834570-5834592 TGTAATAGATACCACAGACTGGG - Intronic
969546118 4:7829192-7829214 ATGAAGAAATACCTTAGACTGGG - Intronic
969928308 4:10606238-10606260 AGTAACACACACCTTAGCCTAGG + Intronic
969929651 4:10618559-10618581 ATAAAGAAATACCTTAGACTGGG + Intronic
969951959 4:10846242-10846264 TATAACAAATACCTTACAATGGG - Intergenic
969997218 4:11325201-11325223 TGCTATAAATACCTGAGACTGGG - Intergenic
970263345 4:14253084-14253106 TGCTATAAATACCTGAGACTGGG - Intergenic
970698289 4:18704312-18704334 TATAAAAAATACCTTAGACTGGG + Intergenic
970804684 4:20016979-20017001 AATAAAAAATACCTTAGATTAGG - Intergenic
970858533 4:20675895-20675917 TATAAAAAATACCACAGACTAGG + Intergenic
970991531 4:22218702-22218724 TGCTATAAATACCTGAGACTGGG + Intergenic
971640133 4:29120620-29120642 TATAAGAAATACCTGAGAGTGGG - Intergenic
971711007 4:30112730-30112752 TGTAAAAAATATCCAAGACTGGG + Intergenic
972079644 4:35135554-35135576 TATAAAAAATACCTCAGACTGGG + Intergenic
972109822 4:35543440-35543462 TGTAACAAAATCCATAGGCTTGG + Intergenic
972302002 4:37793227-37793249 ATGAAGAAATACCTTAGACTGGG - Intergenic
972367600 4:38390960-38390982 TATAAAAAATACCTAAAACTGGG - Intergenic
972413262 4:38814334-38814356 TGAAAAAAATACCTGAGACTAGG + Intronic
972585432 4:40433254-40433276 TTTAAAAAATATCTTAGGCTGGG - Intronic
972743729 4:41912875-41912897 AGAAAGAAATACCTGAGACTGGG - Intergenic
972776536 4:42246507-42246529 TGTAAAAAATACTTTAGGCTGGG - Intergenic
972822072 4:42713339-42713361 TGAAACAAATAACTTCCACTGGG + Intergenic
972859476 4:43149919-43149941 TATAAAAAATACCTGAGACTGGG + Intergenic
972986810 4:44774758-44774780 TTTAACCAATAACTTTGACTTGG + Intergenic
973047240 4:45549916-45549938 TATAACAGATACCACAGACTGGG - Intergenic
973079207 4:45968736-45968758 ACAAACAAATACCTGAGACTGGG - Intergenic
973732846 4:53839947-53839969 TGTAAAGAAAACCTGAGACTGGG - Intronic
974065796 4:57076013-57076035 TATAACAAATACCATGGACTTGG + Intronic
974623967 4:64398645-64398667 TATAAAAAATACCTGAGACTGGG - Intronic
974703920 4:65487161-65487183 TGCTATAAATACCTGAGACTGGG - Intronic
974724771 4:65784474-65784496 TATATCAAATACCGTAGACTGGG + Intergenic
975225499 4:71866547-71866569 TATAACAATTACCATACACTGGG - Intergenic
975776840 4:77796611-77796633 TGTAAAAAATACCTGAGACTGGG - Intronic
975860377 4:78670642-78670664 TATAAGAAATACCTGACACTGGG - Intergenic
975865993 4:78724116-78724138 CATAACAAATACCATAAACTGGG - Intergenic
976075967 4:81299124-81299146 TTGAAGAAATACCTGAGACTGGG - Intergenic
976129198 4:81866869-81866891 AATAAAAAATACCTGAGACTGGG + Intronic
976457484 4:85265290-85265312 TATAAAAACTACCTGAGACTGGG + Intergenic
976599449 4:86924819-86924841 TATAAAAAATACCTGAGATTGGG + Intronic
976982686 4:91251130-91251152 TATAACAAATACCATAGACTAGG + Intronic
976997651 4:91455618-91455640 TTTAACAAATTCCTTAGACTGGG - Intronic
977030639 4:91877612-91877634 ATGAACAAATACCTGAGACTGGG - Intergenic
977045635 4:92065514-92065536 TATAAAGAATACCTGAGACTGGG + Intergenic
977122803 4:93125012-93125034 TGTTAGAAATACTTTAGTCTGGG + Intronic
977189778 4:93985170-93985192 TACAACAAATACCTTAGACTGGG - Intergenic
977235833 4:94506337-94506359 TTGACAAAATACCTTAGACTGGG + Intronic
977422448 4:96819106-96819128 TTAAAGAAATACCTGAGACTGGG - Intergenic
978417049 4:108487912-108487934 TGCTATAAATACCTGAGACTGGG + Intergenic
978605287 4:110472919-110472941 TATAACATATACCTGAGGCTGGG - Intronic
978670036 4:111236898-111236920 TATAACAAATACGTCAGACTGGG + Intergenic
978933003 4:114339255-114339277 TATAACAAATATCATAGACTAGG - Intergenic
978970709 4:114801430-114801452 AGTATCAAATGCTTTAGACTTGG - Intergenic
979435661 4:120686235-120686257 TGTCATAAATACCTGAGCCTGGG - Intronic
979764940 4:124453179-124453201 TTAAACAAATACCTGAGACTGGG - Intergenic
979984232 4:127295055-127295077 TGGAAGAAATACCTGAGACCAGG + Intergenic
980279930 4:130706457-130706479 TGTAAGAAATACCTGAGACTGGG + Intergenic
980313350 4:131163832-131163854 CATAACAAATACCACAGACTAGG - Intergenic
980367948 4:131830879-131830901 TATAACAAATACCACAGACTGGG + Intergenic
980425955 4:132628318-132628340 TATAAAAAATACCCAAGACTGGG - Intergenic
980616206 4:135229052-135229074 TGCTATAAATACCTGAGACTGGG + Intergenic
980967794 4:139539990-139540012 TACAACAAATTCCATAGACTGGG - Intronic
981009700 4:139912904-139912926 CATAACAAATACCACAGACTAGG - Intronic
981135141 4:141202124-141202146 TATAACAAATACCTTAGACTGGG - Intronic
981294961 4:143121121-143121143 TATAAGAAATACCTGAGACTGGG - Intergenic
981977559 4:150749040-150749062 TATAAAAAATACCTGAGACTGGG - Intronic
982208072 4:153012208-153012230 TATAAGAAATATCTGAGACTGGG + Intergenic
982391025 4:154863905-154863927 ATTAAGAAATACCTGAGACTTGG + Intergenic
982610019 4:157561235-157561257 TCAGACAAATACCTAAGACTGGG + Intergenic
982629325 4:157812182-157812204 TATGAAAAATACCTGAGACTGGG + Intergenic
982738107 4:159027898-159027920 TGTTAGAAATACATTAGAATTGG - Intronic
982851614 4:160323884-160323906 TGTAACAAATACCATACACAGGG - Intergenic
983049860 4:163033479-163033501 TATAAAAAATACCATGGACTGGG - Intergenic
983154496 4:164329552-164329574 TGCTATAAATACCTGAGACTGGG + Intronic
983714829 4:170767957-170767979 TATAAAAAATACCTTAGGCTGGG + Intergenic
983780698 4:171666624-171666646 TCTTATAAATACCTGAGACTGGG - Intergenic
983985789 4:174059636-174059658 TAAAAAAAATACCTGAGACTGGG + Intergenic
984189032 4:176582562-176582584 TATAAAGAATACCTGAGACTGGG - Intergenic
984215597 4:176909918-176909940 TATAACAAAGACCATAGACTGGG + Intergenic
984256907 4:177400392-177400414 AGAAAGAAATACCTGAGACTGGG + Intergenic
984334347 4:178369808-178369830 TATAAGAACTACCTGAGACTGGG + Intergenic
985056093 4:186036750-186036772 TAAAAAAAATACCTGAGACTGGG - Intergenic
985164446 4:187078024-187078046 TTTCACAAATAACTTACACTCGG + Intergenic
986049061 5:4070214-4070236 GTAAAAAAATACCTTAGACTAGG + Intergenic
986500890 5:8398868-8398890 TGTAACAAATAATTAAGAGTTGG + Intergenic
986976296 5:13398178-13398200 CATAACCAATACCCTAGACTGGG - Intergenic
986988794 5:13527848-13527870 TAAAAGAAATACCTGAGACTGGG - Intergenic
987143529 5:14969051-14969073 TATAACAAATACCATAGATGGGG + Intergenic
987431714 5:17843047-17843069 AGGAATAAATACCTGAGACTGGG + Intergenic
987509591 5:18819390-18819412 TAAAAGAAATACCTAAGACTGGG + Intergenic
987533482 5:19151720-19151742 TGTAACAACTACATCACACTTGG - Intergenic
987542940 5:19278046-19278068 TATAAAAAATAACTGAGACTAGG - Intergenic
987719680 5:21617604-21617626 ATTAAAAAATACCTGAGACTGGG + Intergenic
988140883 5:27238828-27238850 TGTAACAAGTACCACAAACTGGG + Intergenic
988296395 5:29368570-29368592 TATAAAAAATACCTGAGACTGGG + Intergenic
988521650 5:31950871-31950893 ATTAAAAAATACCTTAGACTGGG + Intronic
988523794 5:31968856-31968878 TGTAACAATTACTGTAGGCTGGG - Intronic
988998878 5:36740822-36740844 CCTAACAAATACCATAGACTGGG + Intergenic
989805795 5:45602171-45602193 AGGAAGAAATACCTGAGACTGGG - Intronic
990124720 5:52499963-52499985 ATAAACAAATACCTGAGACTGGG - Intergenic
990228056 5:53678957-53678979 TGTAACAAACACCTTGGAGGAGG + Intronic
990242667 5:53831681-53831703 TGTAACAAATTCCACAAACTGGG - Intergenic
990504840 5:56433945-56433967 TATAAAGAATACCTGAGACTCGG + Intergenic
990548683 5:56850579-56850601 TGTAAAAACAAACTTAGACTGGG + Intronic
990680196 5:58234023-58234045 TGTAACAAATGCAATAAACTAGG - Intergenic
990807515 5:59682079-59682101 TGTAACAGATACCACAAACTGGG - Intronic
990874969 5:60474147-60474169 TATAACAAAAACCTTAGACTGGG + Intronic
990885695 5:60590376-60590398 TATAACAAGTACCATACACTGGG + Intergenic
991191117 5:63875306-63875328 TATAACAAACACCATATACTGGG + Intergenic
991261432 5:64672362-64672384 TATAACAAATACCACAAACTGGG - Intergenic
991355878 5:65768211-65768233 TATAAAGAATACCTGAGACTAGG + Intronic
991943311 5:71876025-71876047 TAACAAAAATACCTTAGACTGGG - Intergenic
992261222 5:74972229-74972251 TATAACAAATACCTTAAACTGGG - Intergenic
992519798 5:77538921-77538943 TATAACAAATACCATAGATTAGG + Intronic
992596267 5:78350541-78350563 ATTAAAAAATACCTTAGACTGGG - Intergenic
992780344 5:80121631-80121653 ATTAAGAAATACCTGAGACTGGG + Intronic
993003302 5:82404600-82404622 CGTAAAAAATACCTGAGGCTGGG + Intergenic
993072507 5:83182933-83182955 ATAACCAAATACCTTAGACTGGG - Intronic
993488461 5:88515945-88515967 TATAAAAAATACCATAGACTGGG + Intergenic
993618893 5:90145294-90145316 TGTAAGAAATGCCTGAGACTGGG - Intergenic
993755794 5:91728110-91728132 TATAAAAAATACTTGAGACTGGG + Intergenic
993876685 5:93315801-93315823 TGTAACAAATACCACAGATTGGG + Intergenic
994019139 5:95003183-95003205 TATAAGAAATACCCAAGACTGGG - Intronic
994062808 5:95499500-95499522 TATAAGAAATACCTGAGACTGGG - Intronic
994095665 5:95845334-95845356 TATAAAGAATACCTGAGACTGGG + Intergenic
994253550 5:97565850-97565872 TATAAAAAATACCTGAGATTGGG + Intergenic
994383450 5:99099452-99099474 TATAAAGAATACCTGAGACTGGG - Intergenic
994714452 5:103305080-103305102 TGTAACAGAATCCTAAGACTCGG + Intergenic
994747877 5:103701593-103701615 TATAACAATTACCATAGACTTGG - Intergenic
994764975 5:103904053-103904075 GATAAGAAATACCTGAGACTGGG + Intergenic
994786391 5:104169878-104169900 TGTAACATTTTCCATAGACTTGG - Intergenic
994884175 5:105537873-105537895 TGAAGAAAATACCTGAGACTGGG - Intergenic
995286592 5:110396015-110396037 TATAAAGAATACCTGAGACTGGG + Intronic
995396878 5:111696605-111696627 CGTAACAAATACCACAGTCTGGG + Intronic
995483979 5:112620359-112620381 TGTAAGAAATACCATTAACTTGG - Intergenic
995637833 5:114215419-114215441 TGAAACATATTCCTTATACTTGG + Intergenic
995761523 5:115566712-115566734 TGCAATAAATACCTGAGACTGGG - Intergenic
995860427 5:116635137-116635159 TATAACAAATACCATAGACTGGG + Intergenic
995883705 5:116869961-116869983 TGTAACAAATACCTGAAATGTGG + Intergenic
996073594 5:119162346-119162368 TATAACAAATATCTTAGACTGGG + Intronic
996235980 5:121129209-121129231 TCGAAGAAATACCTGAGACTGGG - Intergenic
996330908 5:122327719-122327741 TGTAAGAACTATCTGAGACTGGG - Intronic
996919966 5:128756615-128756637 TATAACAAATACCACAGATTAGG + Intronic
997183674 5:131859683-131859705 TTAAAAAAATACCTAAGACTGGG - Intronic
997671769 5:135680486-135680508 TTGAAAAAATACCTGAGACTGGG + Intergenic
997922916 5:137999605-137999627 TGTAACAAATACCTAAAATATGG - Intronic
998071454 5:139201048-139201070 TATAACAAACACCTTAGGCTGGG - Intronic
998311772 5:141139484-141139506 TGTAACAAATACCACAGACTGGG - Intronic
998327141 5:141291254-141291276 TAAAAGAAATACCTGAGACTGGG + Intergenic
998809654 5:145953521-145953543 TGCTATAAATACCTGAGACTGGG + Intronic
999633174 5:153592727-153592749 TATAACAAATACTATAGACTGGG + Intronic
999806918 5:155090084-155090106 TGTGTCAAACACATTAGACTGGG + Intergenic
999831464 5:155324179-155324201 TTTAAAAAATTCTTTAGACTGGG - Intergenic
999847836 5:155505100-155505122 TTGAAGAAATACCTGAGACTGGG + Intergenic
999933207 5:156456144-156456166 TGTAACAAATATCTAAAAATGGG + Intronic
1000298258 5:159931632-159931654 GTAACCAAATACCTTAGACTAGG + Intronic
1000375089 5:160573365-160573387 CATAACAAATACCATAGACTGGG - Intronic
1000687200 5:164265713-164265735 TGTAACAAATACTTGAGTCTTGG + Intergenic
1001243538 5:170088374-170088396 TGCAACAAATACCACAGACTGGG - Intergenic
1001471555 5:172017015-172017037 TATAAAAAATACCTGAAACTGGG - Intergenic
1001762909 5:174222598-174222620 TATAATTAATACCTGAGACTGGG + Intronic
1001767342 5:174261004-174261026 TGCTATAAATACCTGAGACTGGG + Intergenic
1001784125 5:174396993-174397015 TGTAACAAATATCTCAGACTGGG - Intergenic
1001836599 5:174837712-174837734 TTGAAGAAATACCTGAGACTGGG - Intergenic
1003000112 6:2324267-2324289 TATAAAAAATGCCTGAGACTGGG - Intergenic
1003031451 6:2604728-2604750 TGTATAAAACACCTTACACTGGG + Intergenic
1003466206 6:6382492-6382514 CATAACAAATACCATAGCCTGGG + Intergenic
1003486768 6:6586882-6586904 CATAACAAATACCTTAGACTGGG - Intergenic
1004004438 6:11626256-11626278 TAAAAAAAATACCTGAGACTGGG + Intergenic
1004084945 6:12437860-12437882 TCTAACAAATACTATAGACTGGG + Intergenic
1004110015 6:12708621-12708643 AGCAATAGATACCTTAGACTTGG + Intergenic
1004197059 6:13514712-13514734 TGAAAAAAATACCATAGACTGGG + Intergenic
1004233174 6:13851069-13851091 TATAAAGAATACCTGAGACTGGG - Intergenic
1004450623 6:15742064-15742086 TTTAAGACATACCTGAGACTGGG + Intergenic
1004455234 6:15785796-15785818 ATAAACAAATACCTGAGACTGGG - Intergenic
1004472519 6:15941845-15941867 AGAAAGAAATACCTGAGACTGGG + Intergenic
1004736334 6:18409900-18409922 CGTAACAAGTACTTTAGGCTTGG + Intronic
1004755609 6:18607559-18607581 TATAAAAAATACCTGAGACTGGG + Intergenic
1004777485 6:18864008-18864030 TATAAAAAATACCTGAGACAGGG - Intergenic
1004792121 6:19038306-19038328 TATAACAAATACCATAGACAGGG + Intergenic
1005112628 6:22300343-22300365 TGTAACAAGTAGCTGAGTCTTGG + Intergenic
1005149323 6:22730552-22730574 ATAAAGAAATACCTTAGACTGGG - Intergenic
1005321916 6:24663822-24663844 TGCTATAAATACCTGAGACTGGG - Intronic
1005487826 6:26318037-26318059 CATAACAAATACCATAGACTGGG - Intergenic
1005488119 6:26320412-26320434 TGTAACAAATACTACAGACTGGG + Intergenic
1005901973 6:30224533-30224555 TGACAAAAATACCATAGACTGGG - Intergenic
1005916092 6:30352729-30352751 TATAACAAATACCACAGACTGGG - Intergenic
1006462297 6:34168166-34168188 AGAAAGAAATACCTGAGACTGGG - Intergenic
1006891103 6:37429662-37429684 TGTAACAAGTATCTGAGTCTGGG - Intergenic
1007195855 6:40059640-40059662 TGTTATAAATACCCAAGACTGGG - Intergenic
1007720402 6:43881787-43881809 TATAACAGATTCCTGAGACTGGG - Intergenic
1007830925 6:44637643-44637665 TGTAACAGGTACCATAGACTGGG + Intergenic
1008553412 6:52654953-52654975 AGAAAGAAATACCTGAGACTGGG - Intergenic
1008934249 6:56972747-56972769 CATAACAAATACCATAGACTGGG + Intronic
1009349480 6:62656326-62656348 AGAAAAAAATACCTTAGACTGGG + Intergenic
1009381504 6:63036225-63036247 TATAACAAATACCACAGACTGGG + Intergenic
1009522756 6:64705546-64705568 TGTAACCAATAGCAAAGACTTGG + Intronic
1009608453 6:65905354-65905376 AGAAAGAAATACCTGAGACTGGG + Intergenic
1009902336 6:69822481-69822503 TATAACTAGTACCATAGACTGGG - Intergenic
1010005707 6:70992705-70992727 TATAAAGAATACCTGAGACTGGG - Intergenic
1010230464 6:73530243-73530265 ATTACAAAATACCTTAGACTAGG + Intergenic
1010341564 6:74759443-74759465 TATAAAAAATACCTGAGACTGGG - Intergenic
1010517515 6:76790909-76790931 TATAAGAAATACCTGAGAATGGG + Intergenic
1010525555 6:76895960-76895982 TATAAAAAATACCTGAGGCTGGG - Intergenic
1010835977 6:80587666-80587688 AGGAAGAAATACCTGAGACTGGG - Intergenic
1011072721 6:83403291-83403313 TGACAAAAATACCATAGACTAGG + Intronic
1011283944 6:85704538-85704560 ATTAAAAAATACCTGAGACTGGG - Intergenic
1012014959 6:93838436-93838458 CATAACAAATACCACAGACTGGG + Intergenic
1012091180 6:94899766-94899788 TGTAACCAACACATTAGACATGG + Intergenic
1012199388 6:96386493-96386515 TGCTATAAATACCTGAGACTGGG - Intergenic
1012254320 6:97015189-97015211 TGCAATAAATACCCAAGACTGGG - Intronic
1012413280 6:98984478-98984500 CGTAACAAATACCATCAACTGGG - Intergenic
1012767140 6:103382559-103382581 TAAAAAAAATACCTGAGACTGGG + Intergenic
1013300684 6:108802500-108802522 TGTTAAAAATTCCTTGGACTAGG - Intergenic
1013370143 6:109462306-109462328 CATAACAAATACCACAGACTGGG - Intergenic
1013489011 6:110626714-110626736 ATAAAAAAATACCTTAGACTGGG - Intronic
1013748559 6:113374376-113374398 TGTAACAATCACCTGAAACTTGG - Intergenic
1013867173 6:114712859-114712881 ATGAACAAATACCTGAGACTGGG + Intergenic
1014075409 6:117229494-117229516 TGCTATAAATACCTGAGACTGGG + Intergenic
1014129889 6:117818657-117818679 TGTAACAAATACCACAGCTTGGG - Intergenic
1014216472 6:118756794-118756816 TATAACAAGTACCACAGACTGGG + Intergenic
1014247588 6:119083935-119083957 TATAAAGAATACCTGAGACTGGG + Intronic
1014294830 6:119605543-119605565 TGACAAAAATATCTTAGACTAGG + Intergenic
1014520618 6:122438284-122438306 TGCAAAAAATACCTGAGGCTGGG - Intergenic
1014586563 6:123204395-123204417 TTAACAAAATACCTTAGACTGGG - Intergenic
1014619788 6:123652513-123652535 TATAAGAAGTACCTGAGACTGGG - Intergenic
1014938956 6:127416010-127416032 TTTAAAAAATACTTTAGGCTGGG + Intergenic
1015109567 6:129576017-129576039 AGGAAGAAATACCTGAGACTGGG - Intergenic
1015164595 6:130189449-130189471 CCAAACAAATACCATAGACTTGG - Intronic
1015670016 6:135677963-135677985 TATAAAGAATACCTGAGACTGGG - Intergenic
1015813984 6:137188921-137188943 TGTTAAAAATACACTAGACTGGG - Intergenic
1015869621 6:137762707-137762729 TGTAACAATTACCACAAACTTGG + Intergenic
1015928154 6:138330434-138330456 GTTAACAAATACCATAGACTGGG - Intronic
1016145419 6:140666171-140666193 CATAACAAATACCACAGACTGGG - Intergenic
1016210231 6:141523314-141523336 TGTAACAAATATCAAAGGCTGGG + Intergenic
1016695837 6:146994011-146994033 TGTTGCAAATATCTTAGATTGGG + Intergenic
1016983385 6:149874805-149874827 TATAACAAATACCTGAGATTGGG + Intergenic
1017174371 6:151489430-151489452 TAACAAAAATACCTTAGACTGGG + Intergenic
1017183147 6:151573586-151573608 TATAAGAAATACCCGAGACTGGG + Intronic
1017192356 6:151668076-151668098 TATAAAAAATACCTGAGACTGGG + Intronic
1017357202 6:153523740-153523762 TATTAAAAATACCTGAGACTGGG + Intergenic
1017371161 6:153710811-153710833 TGCAATAAATACCTGAGAATGGG + Intergenic
1017595674 6:156026055-156026077 TGTAACAGATACCATACGCTGGG - Intergenic
1017851734 6:158310114-158310136 TATAAGGAATACCTGAGACTGGG + Intronic
1017854090 6:158333482-158333504 CATATCAAATACCATAGACTGGG - Intronic
1018051834 6:160016051-160016073 TGCTATAAATACCTGAGACTGGG - Intronic
1018554239 6:165033911-165033933 TGTAAAGAATACCAGAGACTGGG - Intergenic
1018653774 6:166012469-166012491 TACAACAAATACTTTAGACCAGG + Intergenic
1019085486 6:169471765-169471787 TATAAAAAATACCTTAGACTGGG + Intronic
1019663320 7:2238133-2238155 TCTCCCAAATACCTTAGAGTAGG - Intronic
1019815844 7:3200022-3200044 TAAAAAAAATACCTGAGACTGGG + Intergenic
1019956751 7:4421089-4421111 TTTAAGAAAAACCTGAGACTGGG - Intergenic
1020033114 7:4946879-4946901 AGAAAGAAATACCTGAGACTGGG + Intronic
1020361910 7:7335836-7335858 TGTAACAAATACTACAGAATGGG - Intergenic
1020813800 7:12879222-12879244 TTTAAGAAATACCTCAGTCTAGG + Intergenic
1021338396 7:19432923-19432945 TGTAAAAAATACCCAAGACTGGG - Intergenic
1021893932 7:25215460-25215482 CACAACAAATACCATAGACTGGG - Intergenic
1021993421 7:26157760-26157782 CATAACAAATACCACAGACTGGG + Intronic
1022002238 7:26236832-26236854 TATAAGAAATACCTGGGACTGGG - Intergenic
1022060358 7:26787201-26787223 TATAAAAAATATCTTGGACTGGG + Intronic
1022082278 7:27034625-27034647 TTTTAAAAATACCTTAGACTGGG + Intergenic
1022211051 7:28209725-28209747 CATAACAAATACCCCAGACTGGG - Intergenic
1022251782 7:28615564-28615586 TGTAACAAATGCCTTGAACCTGG + Intronic
1022578550 7:31523757-31523779 TGTTATAAATACCCGAGACTGGG - Intronic
1022880696 7:34584097-34584119 ATAACCAAATACCTTAGACTGGG - Intergenic
1022891710 7:34707813-34707835 CGTAACAAATACCAAAGATTGGG + Intronic
1023262913 7:38376091-38376113 GATATCAAATACATTAGACTGGG - Intergenic
1023681189 7:42689208-42689230 TGTAACAAATACCATAGGCTGGG - Intergenic
1023791112 7:43754545-43754567 TATAACAAATACCTTGGACTGGG - Intergenic
1023979820 7:45062504-45062526 TATAACAGATACCACAGACTGGG + Intronic
1024028072 7:45431239-45431261 TGTAACAAATACCATGGACTGGG - Intergenic
1024196178 7:47061013-47061035 TGCAACAAATACCTAAAACATGG + Intergenic
1024202847 7:47124088-47124110 TGTACCAAGAACTTTAGACTTGG + Intergenic
1024378848 7:48671031-48671053 CATAACAAATACCATAGACAGGG + Intergenic
1024711837 7:52023817-52023839 TGTCAGAAATACCCTAGAATTGG - Intergenic
1026098838 7:67368338-67368360 TATAACACATACCACAGACTGGG - Intergenic
1026104609 7:67410922-67410944 TGACAAAAATACCATAGACTTGG - Intergenic
1026115291 7:67490789-67490811 TGCTATAAATACCTGAGACTGGG - Intergenic
1026431322 7:70350364-70350386 ATAAACAAATACCTGAGACTGGG + Intronic
1027463200 7:78481168-78481190 TATAACAACTTCCTGAGACTGGG + Intronic
1027534727 7:79383338-79383360 TGTTAGAAATACCATAGACATGG + Intronic
1027560081 7:79718617-79718639 TATAAAGAATACCTGAGACTGGG + Intergenic
1027696008 7:81411567-81411589 TGAAGGAAATACCTTAGACTGGG + Intergenic
1027704725 7:81514732-81514754 TTTAAAAAATGCCATAGACTAGG - Intergenic
1027769138 7:82384515-82384537 TATAAGAAAAACCATAGACTGGG - Intronic
1027941804 7:84691646-84691668 TATAACATATACCTGAGGCTGGG - Intergenic
1027950477 7:84808805-84808827 TTGAAAAAATACCTTAAACTGGG + Intergenic
1028017319 7:85732085-85732107 TGTAACAAATAACTGAAATTTGG + Intergenic
1028257162 7:88613437-88613459 GTTAAAAAATACCTGAGACTGGG + Intergenic
1028384500 7:90239403-90239425 TGTAACAAATACCACAGACTGGG - Intergenic
1028410880 7:90529236-90529258 TGCTATAAATACCTGAGACTCGG - Intronic
1028667996 7:93369393-93369415 TTAAAGAAATACCTGAGACTGGG + Intergenic
1028787671 7:94814327-94814349 TGTAACAAAATATTTAGACTGGG - Intergenic
1030656787 7:112177174-112177196 CTTAACAAATACCTCAGCCTAGG - Intronic
1031245761 7:119309308-119309330 TGTAACAAATATATTACACAGGG + Intergenic
1031284315 7:119844534-119844556 TATAAGAAATACGTAAGACTGGG + Intergenic
1031316747 7:120267966-120267988 TATAAAAAATACCATAAACTCGG - Intergenic
1031360511 7:120843931-120843953 TGTTATAAATACCTGAAACTGGG + Intronic
1031430814 7:121666792-121666814 TTTAACACATACCTTATATTAGG - Intergenic
1031636422 7:124106555-124106577 TAAAAAAAATACCTGAGACTGGG - Intergenic
1031645735 7:124222648-124222670 TATGAAAAATACCTGAGACTGGG - Intergenic
1031654164 7:124331804-124331826 CATAACAAATACCATAGGCTAGG + Intergenic
1031692839 7:124811867-124811889 TATAACAAAAACCATAGACTGGG - Intergenic
1031760272 7:125705423-125705445 TGTAAAGAATACATGAGACTGGG - Intergenic
1032248243 7:130231255-130231277 TTAAAGAAATACCTGAGACTGGG + Intergenic
1033028439 7:137800614-137800636 TGTAAAGAAAACCTGAGACTAGG - Intronic
1033542040 7:142366098-142366120 TATAAAGAATACCTGAGACTGGG + Intergenic
1033822133 7:145147553-145147575 TGCTATAAATACCTGAGACTGGG - Intergenic
1033955472 7:146842497-146842519 GTTAAGAAATACCTGAGACTGGG + Intronic
1034056889 7:148044739-148044761 CATAAAAAATATCTTAGACTGGG - Intronic
1034524649 7:151649873-151649895 TGCTATAAATACCTGAGACTGGG - Intronic
1034701307 7:153098652-153098674 TGTAACAAAGTACTCAGACTGGG + Intergenic
1034726352 7:153339793-153339815 TGTAACAAATACCACAGGCTGGG + Intergenic
1035639980 8:1177636-1177658 TGTCACAAATACCCCACACTAGG + Intergenic
1036130126 8:6102313-6102335 AGTAACAAAAACCTGAAACTGGG + Intergenic
1036576320 8:10030991-10031013 TATAACAAATGCCAGAGACTGGG + Intergenic
1036911733 8:12763229-12763251 TGACAAAAATACCCTAGACTGGG + Intergenic
1037690042 8:21173808-21173830 TATAACACATGCCATAGACTGGG - Intergenic
1037843099 8:22259580-22259602 TGTTACAAATACCACAGACTGGG - Intergenic
1038269877 8:26066473-26066495 TATAAAGAATACCTGAGACTGGG - Intergenic
1038662535 8:29509640-29509662 TCTAAAGAATACCTGAGACTGGG + Intergenic
1038966156 8:32574783-32574805 TGTAAAAAATAACTGAGACTGGG - Intronic
1039075507 8:33687587-33687609 TGAAATAAATAACATAGACTAGG + Intergenic
1039097972 8:33907335-33907357 TATAAAGAATACCTGAGACTGGG - Intergenic
1039148524 8:34478071-34478093 TAAAAGAAATACCTGAGACTGGG + Intergenic
1039690629 8:39861208-39861230 TTAAAAAAATACCATAGACTGGG + Intergenic
1039710338 8:40049772-40049794 ATTAAGAAATACCTGAGACTGGG - Intergenic
1039826424 8:41177956-41177978 AACAACAAATACCTGAGACTGGG + Intergenic
1040515644 8:48131922-48131944 TGTAACAATTACTTTCCACTGGG + Intergenic
1040801533 8:51346885-51346907 TATAAAAAATACCCAAGACTGGG - Intronic
1040859678 8:51986164-51986186 TTTAAAAAATACCACAGACTTGG - Intergenic
1040863353 8:52023289-52023311 TATAAAGAATACCTGAGACTGGG - Intergenic
1041633397 8:60114627-60114649 TTTAACAAATATTATAGACTTGG + Intergenic
1041825778 8:62095157-62095179 ATGAAGAAATACCTTAGACTGGG + Intergenic
1041927460 8:63251372-63251394 TATAAAGAATACCTGAGACTGGG - Intergenic
1041955312 8:63553051-63553073 TTGAAGAAATACCTGAGACTGGG + Intergenic
1042025938 8:64423583-64423605 TTAAATAAATACCTGAGACTGGG + Intergenic
1042169573 8:65978577-65978599 TTAAATAAATACCTGAGACTGGG + Intergenic
1042749241 8:72140105-72140127 AGAAAGAAATACCTGAGACTGGG - Intergenic
1042775866 8:72430635-72430657 TGTAACAAACACCAGAGACTGGG + Intergenic
1043011323 8:74885115-74885137 TATAACAAATATCTGAGACTGGG - Intergenic
1043030894 8:75131865-75131887 TGTAAAGAATACCTGAGGCTGGG - Intergenic
1043254155 8:78111618-78111640 TGCTATAAATACCTGAGACTGGG - Intergenic
1043274901 8:78380666-78380688 TATAACAGATACATGAGACTAGG + Intergenic
1043645360 8:82510595-82510617 TATAAAAAGTACCATAGACTAGG + Intergenic
1043845783 8:85162101-85162123 TATAAAGAATACCTGAGACTGGG + Intergenic
1043886113 8:85602749-85602771 ATTAAAAAATACCTGAGACTGGG + Intergenic
1043956348 8:86364263-86364285 TGTAACTAATAGTTTAGAGTAGG + Intronic
1044020189 8:87096157-87096179 CACAACAAATACCATAGACTGGG + Intronic
1044076959 8:87833574-87833596 TATAACAAATACCACAGACTGGG - Intergenic
1044323630 8:90834614-90834636 TCTAACAAATACTTCAGACTGGG - Intronic
1044345253 8:91097445-91097467 TTAAAGAAATACCTGAGACTGGG + Intergenic
1044345676 8:91101263-91101285 TGCTATAAATACCTGAGACTAGG - Intergenic
1044414365 8:91919509-91919531 AATAAAAAATACCTGAGACTGGG + Intergenic
1044749189 8:95400009-95400031 TGTAACAAATACCATAGACTGGG - Intergenic
1044777434 8:95705537-95705559 CATAACAAATACCACAGACTGGG - Intergenic
1045349083 8:101322094-101322116 TATAAAGAATACCTGAGACTGGG + Intergenic
1045731028 8:105240996-105241018 AGTAACAAATACCTGGGATTAGG - Intronic
1045817570 8:106294419-106294441 AGAAAGAAATACCTGAGACTGGG + Intronic
1046084075 8:109410287-109410309 ATAAAGAAATACCTTAGACTGGG + Intronic
1046229901 8:111340300-111340322 ATTAATAAATACCTCAGACTGGG - Intergenic
1046415145 8:113903582-113903604 TGTAACAATCATCCTAGACTAGG + Intergenic
1046623176 8:116549565-116549587 TATAACAAATACCTTATACTAGG - Intergenic
1046878296 8:119279593-119279615 TATAAAAAATATCTGAGACTGGG + Intergenic
1047012411 8:120686286-120686308 TATAAAAAATATCTTAGATTGGG + Intronic
1047141580 8:122146846-122146868 TGTAAGAACCACCTGAGACTGGG + Intergenic
1047160135 8:122369148-122369170 ATTAAAAAATACCATAGACTCGG - Intergenic
1047373347 8:124274254-124274276 TATAACAAATACCTTAGACTGGG - Intergenic
1047668669 8:127120579-127120601 TGTACAAAATACCTTAAACCTGG - Intergenic
1047688146 8:127322216-127322238 TGTAAAGAATACCTGAGGCTGGG - Intergenic
1047897947 8:129387292-129387314 TGTAACAGAAACCGAAGACTGGG - Intergenic
1047908470 8:129499414-129499436 TATAAAGAATACCTGAGACTGGG + Intergenic
1048087580 8:131200825-131200847 TATAAAAAATATCTGAGACTGGG - Intergenic
1048114601 8:131507533-131507555 TATAAAGAATACCTGAGACTGGG - Intergenic
1048243687 8:132769795-132769817 TTTAAAAAATACCAGAGACTGGG - Intergenic
1048473442 8:134723100-134723122 TGTAACGAATACCACAGACTGGG - Intergenic
1048602765 8:135935756-135935778 TAAAAAAAATACCTTAGACTGGG - Intergenic
1048619204 8:136113266-136113288 TGTAAAAAATACCATAGACTGGG - Intergenic
1048773415 8:137919652-137919674 TATAAAGAATACCTGAGACTGGG - Intergenic
1049567140 8:143346670-143346692 TGTAACAAATAGCACAGACTGGG + Intronic
1050759797 9:9053662-9053684 TGTAAAAAGTACCACAGACTTGG - Intronic
1051016056 9:12476447-12476469 TGTAAGAACTACCTGAGACTGGG - Intergenic
1051485172 9:17600597-17600619 AGCAACAGATACCTTAAACTAGG - Intronic
1051788221 9:20770277-20770299 ATTAAGAAATACCTGAGACTTGG + Intronic
1051989437 9:23133940-23133962 TGGAACAAATGCCTTTGAATTGG + Intergenic
1052078120 9:24170321-24170343 TATAGCAAATACTTTAGATTGGG + Intergenic
1052287217 9:26799833-26799855 AATAACAAATACCATAGACTGGG - Intergenic
1052556357 9:30023214-30023236 TATAAAAAAAACCTGAGACTGGG + Intergenic
1052587335 9:30446186-30446208 TGTAACAAATACATTATCCCTGG - Intergenic
1052605009 9:30688386-30688408 CATAACAAATGTCTTAGACTGGG + Intergenic
1053038055 9:34842729-34842751 TATAACAAATACCACAGATTGGG - Intergenic
1053233073 9:36428064-36428086 TGTAACAAATACCATAGTCTAGG - Intronic
1053632299 9:39956587-39956609 TATAACAAATACCACAAACTGGG + Intergenic
1053773461 9:41506943-41506965 TATAACAAATACCACAAACTGGG - Intergenic
1054211589 9:62294110-62294132 TATAACAAATACCACAAACTGGG - Intergenic
1054313398 9:63554737-63554759 TATAACAAATACCACAGACTGGG + Intergenic
1054833541 9:69652196-69652218 CATAACAAATACCATAGACTGGG - Intronic
1054836974 9:69685807-69685829 TGTTATAAATACCTGAGACCGGG - Intergenic
1054937032 9:70698967-70698989 TTAAAGAAATACCTGAGACTGGG - Intronic
1055468159 9:76585722-76585744 TGTAACAAATACCTAAAATGTGG - Intergenic
1055663931 9:78534466-78534488 TTTAACAAATACCATAAACTGGG - Intergenic
1055982240 9:82015572-82015594 AGAAAGAAATACCTGAGACTGGG - Intergenic
1056075939 9:83040177-83040199 TTGAAGAAATACCTGAGACTGGG - Intronic
1056490219 9:87098955-87098977 TGTAACAAATAGCAAAGACATGG + Intergenic
1056508299 9:87278548-87278570 TGTAAAGAATACCTGAGAGTGGG - Intergenic
1057059634 9:91991891-91991913 TGTAGAAAATGCCTAAGACTTGG + Intergenic
1057063065 9:92022668-92022690 TATAACAAATACTGTAGACTGGG + Intergenic
1057318824 9:93992800-93992822 ATTAAAAAATACCTGAGACTGGG - Intergenic
1057354551 9:94322884-94322906 CGTAACGAATCCCATAGACTGGG - Intronic
1057512942 9:95695930-95695952 AGAAAGAAATACCTGAGACTGGG - Intergenic
1057551195 9:96051933-96051955 TCTAACAAATACCACAGACTGGG - Intergenic
1057653206 9:96934751-96934773 CGTAACGAATCCCATAGACTGGG + Intronic
1057951293 9:99370799-99370821 TATAACAAATACTCTAGGCTGGG - Intergenic
1058076806 9:100659673-100659695 TGAAACAAATTCTTTGGACTTGG + Intergenic
1058221814 9:102312823-102312845 TTGAAGAAATACCTGAGACTGGG - Intergenic
1058250158 9:102684113-102684135 CATAACAAATACTATAGACTAGG + Intergenic
1058313002 9:103529371-103529393 TGTAAAAAATACCCCAAACTGGG - Intergenic
1058344631 9:103946610-103946632 TATAGGAAATACCTGAGACTGGG + Intergenic
1059001788 9:110356218-110356240 TAAAACAACTACCTGAGACTGGG - Intergenic
1059009797 9:110444446-110444468 TATAATAAATAGCATAGACTTGG - Intronic
1059082788 9:111267492-111267514 TGTACCAAGTACCATTGACTTGG + Intergenic
1059202606 9:112431853-112431875 AGAAAGAAATACCTGAGACTGGG - Intronic
1059206412 9:112471226-112471248 TGAAACAGAAACCTTAGAATAGG + Exonic
1059441921 9:114312619-114312641 TGTAACAAATACCACAAACTTGG + Intergenic
1059570193 9:115426046-115426068 TATAAAAAATACCCAAGACTGGG + Intergenic
1059775818 9:117474340-117474362 TATAAAGAATACCTGAGACTGGG + Intergenic
1059841823 9:118225905-118225927 TGTAACAACTACCTTAAAGCTGG + Intergenic
1059884818 9:118734157-118734179 TGTAATAAATTCCTTGTACTAGG - Intergenic
1186093877 X:6079116-6079138 TATAAAAAATACCTGAGACTGGG - Intronic
1186145914 X:6623334-6623356 TGAAAAAAATACCTGAGACTGGG - Intergenic
1186413252 X:9361924-9361946 TATAAGAAATACCTGAGACTGGG - Intergenic
1186451763 X:9679922-9679944 TATAACCAACACCTTAGACTGGG + Intronic
1186504593 X:10081106-10081128 TATGACAAATACCATAGACTGGG + Intronic
1186590424 X:10924810-10924832 TTTAAGAAACACCTGAGACTGGG + Intergenic
1186594347 X:10964812-10964834 AAAACCAAATACCTTAGACTGGG + Intergenic
1186642322 X:11469122-11469144 TCTAGCAAATGCCATAGACTGGG - Intronic
1186928743 X:14363802-14363824 TGTAACAAATTCCCTAATCTTGG + Intergenic
1187964953 X:24602560-24602582 TGTAACAAATGCATCAGGCTGGG + Intronic
1188032869 X:25283930-25283952 AGTAACAAATGCCACAGACTGGG + Intergenic
1188374681 X:29413270-29413292 GCTAATAAATACCTGAGACTGGG - Intronic
1188527919 X:31106348-31106370 TGTAACAGATATCTGAAACTAGG - Intronic
1188767250 X:34109372-34109394 TATAAAAAATACCTGAGAGTGGG - Intergenic
1189394912 X:40612751-40612773 ATTACAAAATACCTTAGACTGGG + Intergenic
1189933464 X:46039633-46039655 TATAAGAACTACCTGAGACTGGG + Intergenic
1189949375 X:46213268-46213290 ATAAAGAAATACCTTAGACTTGG + Intergenic
1189969069 X:46399708-46399730 TGCTATAAATACCTGAGACTGGG + Intergenic
1190003520 X:46712198-46712220 ATAAACAAATACCTGAGACTGGG + Intronic
1191661206 X:63653067-63653089 TGCTATAAATACCTGAGACTGGG - Intronic
1191987601 X:66999598-66999620 GTTAAGAAATACCTAAGACTGGG + Intergenic
1193442812 X:81564291-81564313 TGTTATAAATACCTGAGATTGGG - Intergenic
1193448774 X:81640862-81640884 AGAAAGAAATACCTGAGACTGGG + Intergenic
1193449977 X:81653642-81653664 TGCTATAAATACCTGAGACTGGG - Intergenic
1193499051 X:82250367-82250389 TGTAAAAAATACCAAAAACTGGG - Intergenic
1193728666 X:85075890-85075912 TGTAAAAAATACCATAGACTGGG + Intronic
1193797488 X:85893818-85893840 ATGAAAAAATACCTTAGACTGGG - Intronic
1194039121 X:88917995-88918017 TGCAATAAATACCTGAGACTGGG + Intergenic
1194103746 X:89740932-89740954 TCCAAAAAATACCTTAGACATGG - Intergenic
1194134363 X:90121527-90121549 TGCTATAAATACCTGAGACTGGG - Intergenic
1194163470 X:90484432-90484454 TATAAAAAATACCATATACTAGG + Intergenic
1194376218 X:93136902-93136924 TGTAACAAATACCTAAAATGTGG + Intergenic
1194529449 X:95026825-95026847 TGCTATAAATACCTGAGACTGGG - Intergenic
1194539556 X:95154246-95154268 GCTAAAAAATACCATAGACTGGG + Intergenic
1195164240 X:102202447-102202469 TATAACAAATACCATAGTCTGGG - Intergenic
1195194620 X:102484648-102484670 TATAACAAATACCATAGTCTGGG + Intergenic
1195472216 X:105243437-105243459 TGCCATAAATACCTGAGACTGGG - Intronic
1195511649 X:105722720-105722742 GTTAAAAAATACCTTAGACTGGG + Intronic
1195533497 X:105983801-105983823 TATAACAAATACCAAAGACTGGG + Intergenic
1195650470 X:107278224-107278246 TGCTATAAATACCTGAGACTGGG - Intergenic
1196184875 X:112735342-112735364 TATAACAAATACTATAGACTGGG - Intergenic
1196223348 X:113137744-113137766 GTTAAAGAATACCTTAGACTGGG + Intergenic
1196896225 X:120339573-120339595 TATAACAAATACCGTAGACTGGG + Intergenic
1196970337 X:121100969-121100991 TATCAAAAATACCTGAGACTGGG + Intergenic
1197049829 X:122045066-122045088 TGCTATAAATACCTGAGACTGGG - Intergenic
1197050822 X:122057388-122057410 TATAAAAAATACCTAAGTCTGGG + Intergenic
1197074598 X:122340038-122340060 TTGAAGAAATACCTGAGACTGGG + Intergenic
1197307012 X:124854966-124854988 TGTAATAAATATTTTATACTTGG + Intronic
1197472569 X:126881656-126881678 TGCTACAAATACCTGAAACTGGG - Intergenic
1197569298 X:128129719-128129741 TATAACAAATATCACAGACTGGG + Intergenic
1197908674 X:131455763-131455785 GGCTGCAAATACCTTAGACTGGG - Intergenic
1198055110 X:132986151-132986173 TTGAAGAAATACCTGAGACTGGG - Intergenic
1199333500 X:146589329-146589351 TATAACAAATACCCAAGACTGGG - Intergenic
1199407048 X:147474524-147474546 TCTAACAAATACCACAAACTAGG + Intergenic
1199407374 X:147478342-147478364 AATAACAAATACCACAGACTGGG + Intergenic
1199691132 X:150309789-150309811 TGTAACAAATACCATAGACCAGG + Intergenic
1199693121 X:150324228-150324250 CATAACAAATACCATAGGCTGGG - Intergenic
1200480143 Y:3691639-3691661 TGCTATAAATACCTGAGACTGGG - Intergenic
1200509737 Y:4062160-4062182 TATAAAAAATACCATATACTAGG + Intergenic
1200761028 Y:7039283-7039305 TGTAACCAACACCTTAGACTGGG + Intronic
1201015522 Y:9597991-9598013 TATACAAAATAACTTAGACTGGG + Intergenic
1201160840 Y:11165341-11165363 TGTAACAAATTTCTATGACTTGG + Intergenic
1201667468 Y:16474809-16474831 AGAAACAACTACCTGAGACTAGG + Intergenic
1201761561 Y:17545090-17545112 TGGAACACATGCCTTAGAATGGG + Intergenic
1201839991 Y:18360900-18360922 TGGAACACATGCCTTAGAATGGG - Intergenic