ID: 1124138791

View in Genome Browser
Species Human (GRCh38)
Location 15:27059114-27059136
Sequence CCTGAATGGCAGAGGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124138791_1124138797 -3 Left 1124138791 15:27059114-27059136 CCTGGTGCCCTCTGCCATTCAGG 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1124138797 15:27059134-27059156 AGGGAAGCAGAAGACAATGAAGG 0: 1
1: 0
2: 3
3: 61
4: 631
1124138791_1124138799 28 Left 1124138791 15:27059114-27059136 CCTGGTGCCCTCTGCCATTCAGG 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1124138799 15:27059165-27059187 CTCCCAACACGAGGCTGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 143
1124138791_1124138798 19 Left 1124138791 15:27059114-27059136 CCTGGTGCCCTCTGCCATTCAGG 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1124138798 15:27059156-27059178 GCTCTGTCACTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124138791 Original CRISPR CCTGAATGGCAGAGGGCACC AGG (reversed) Intronic
900484845 1:2917555-2917577 ACAGTAAGGCAGAGGGCACCTGG - Intergenic
901365943 1:8748344-8748366 AGTGAATGACAGAGGGCATCTGG - Intronic
901653242 1:10755093-10755115 CCTGAAGGGCAGAGAGCAAGCGG + Intronic
903368667 1:22820274-22820296 CCTGAAAGCCAGAGAGCAACAGG + Intronic
905232160 1:36521317-36521339 AGTGAAGGGCAGAGGGGACCTGG + Intergenic
905694498 1:39965010-39965032 CCGGAATGGCAGATGGGAACTGG - Intronic
906995800 1:50792826-50792848 CCAGAATGGCAGAGGTCAAATGG + Intronic
907252487 1:53149916-53149938 CCTTTATGGCAGCAGGCACCTGG + Intergenic
912345209 1:108957361-108957383 CCTGGTTGGGAGAGGGCAGCTGG - Intronic
915323109 1:155066870-155066892 CCTGCCAGGCAGAGGGCCCCCGG + Exonic
917938104 1:179889495-179889517 GCTGAATGACAGAGGGGACAGGG - Intronic
919071514 1:192761806-192761828 CATGCATTGCAGTGGGCACCAGG - Intergenic
919532101 1:198735149-198735171 CGTCAATGGAAGAGGGCACTCGG + Exonic
920380633 1:205532631-205532653 CCTGAATGGCACAGGCCAAGGGG + Intronic
921019044 1:211219829-211219851 CCTTAATGCCAGAGTGCCCCCGG + Intergenic
922860572 1:228812257-228812279 CCTCACTGGCAGAGGTCACTGGG + Intergenic
924708071 1:246513936-246513958 CCTGGAGGGCTGAGGTCACCTGG + Intergenic
1063400333 10:5737542-5737564 CCTGAAGGGCAGAGGTTGCCTGG - Intronic
1067282573 10:44883537-44883559 AATGAATGGAAGGGGGCACCGGG + Intergenic
1067575418 10:47405499-47405521 CCTGAATGGAGGAGGGTGCCAGG - Intergenic
1070343798 10:75522615-75522637 CGTGAGTGGTAGAGGGGACCTGG + Intronic
1071491205 10:86137753-86137775 CCTGATTAGCAGAGAGCATCAGG + Intronic
1071880860 10:89897142-89897164 CTTGAATGGCAGAGGTCTCATGG + Intergenic
1074052797 10:109895290-109895312 CCTGAATGGAAGAGTCCAGCCGG - Intronic
1074079764 10:110158213-110158235 CCTGACTGGCAGAAGGCATAGGG + Intergenic
1075667604 10:124242384-124242406 CCTGAAAGGTAGAGGGCCCGGGG + Intergenic
1076769367 10:132654604-132654626 TCTGACAGCCAGAGGGCACCTGG - Intronic
1077361031 11:2140134-2140156 CCTGCATGGCCGAGCTCACCGGG + Exonic
1078354598 11:10624576-10624598 GCTGTGTGGCAGAGGGCACTTGG + Intronic
1078907486 11:15701386-15701408 CCTAAATGGCAGAGAGCTCAAGG - Intergenic
1081361605 11:42187040-42187062 CCTGAATTCCAGATGGCACATGG + Intergenic
1083344704 11:61981191-61981213 TCTGAATGGCATTGGGCCCCAGG + Intergenic
1083455878 11:62778298-62778320 CCTGGATGGCAAAGGGAACCTGG + Exonic
1084544895 11:69810346-69810368 CCTGAACGTGAGAGGGCTCCAGG + Exonic
1088671427 11:112145142-112145164 TCTGGATGGCAGAGGTCACGGGG + Intronic
1089659796 11:119978474-119978496 CCTGAAGGGCAGGGGGCTCCAGG - Intergenic
1090406778 11:126480724-126480746 TCTGAATTTCAGAGGGCCCCAGG + Intronic
1090962780 11:131572124-131572146 TCTGCATGCGAGAGGGCACCCGG - Intronic
1091603344 12:1930864-1930886 CCTGAAATGCTGAGGGCAGCAGG - Intergenic
1092446894 12:8566536-8566558 CCTGAAGAGAAAAGGGCACCTGG + Intergenic
1093084373 12:14850728-14850750 ACTGAATTTCAGAGGGCAACAGG + Intronic
1093417551 12:18937110-18937132 CCAGAATGGCAGAGGGCAGTTGG + Intergenic
1094294871 12:28894014-28894036 CCTTACTGGCAGAGTGCACATGG + Intergenic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1096252261 12:50040779-50040801 CCTGGATGGCAGAGGACAGCGGG + Intergenic
1097686049 12:62691844-62691866 CCAGCAGGGCAGAGGGCCCCAGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1101196405 12:102387412-102387434 CCTGTATGGAAGAGGAAACCAGG + Intergenic
1101625523 12:106436923-106436945 CCTGGATTGCTGAGGACACCAGG - Intronic
1101990450 12:109479907-109479929 CCTCAATGGCAGAGGGTCCATGG - Intronic
1104221226 12:126786753-126786775 CCTGGAATGCACAGGGCACCTGG + Intergenic
1104700018 12:130895849-130895871 CCTCGAAGGCTGAGGGCACCTGG + Intergenic
1107439789 13:40415542-40415564 CCCCCATGGGAGAGGGCACCGGG + Intergenic
1107998015 13:45879860-45879882 CCAGAATAGCAGAAGCCACCTGG + Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1112140930 13:96641405-96641427 CCTGAAAGCCAGAAGGCTCCTGG - Intronic
1112480011 13:99766779-99766801 CCTGAATGGGGGAGGTCCCCAGG + Intronic
1116040260 14:39677798-39677820 GCTGAGTCACAGAGGGCACCAGG - Intergenic
1117346472 14:54837863-54837885 ACAGAGTGACAGAGGGCACCTGG + Intergenic
1120838880 14:89065251-89065273 CCTGGATGGGAGATGGCAGCGGG + Intergenic
1121792800 14:96711713-96711735 CCTGAATGGAAACGGGCCCCTGG + Intergenic
1122674110 14:103396152-103396174 CCTGAGTGGGAGAGGAGACCCGG + Intronic
1123411656 15:20065991-20066013 CCTGGATGGCAGGGGCCCCCAGG + Intergenic
1123521002 15:21073110-21073132 CCTGGATGGCAGGGGCCCCCAGG + Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124658405 15:31526457-31526479 CCTGACTGGCAGAGGGGAGCCGG + Intronic
1125347835 15:38736900-38736922 CCTGACTGACAGAAGGGACCTGG + Intergenic
1127499880 15:59545658-59545680 ACAGAATGGAAGAGGGCCCCAGG - Intergenic
1129137794 15:73569869-73569891 CCTGAAAGGCAGATGGGACTAGG + Intronic
1129661196 15:77554036-77554058 CTTGAAGGGCAGTGGGCCCCAGG - Intergenic
1129687570 15:77695461-77695483 TCTGAGGGGCAGATGGCACCAGG - Intronic
1132198512 15:99931972-99931994 CCTGAACGGCAGAGGAGACCGGG - Intergenic
1132464388 16:71090-71112 CCTGAAAGGCAGGGGAGACCTGG + Intronic
1132513293 16:354299-354321 CCTGAAGGGCTGTGGGCAGCAGG - Intergenic
1132639542 16:971315-971337 CCTGGCTGGGGGAGGGCACCTGG - Intronic
1132725934 16:1338391-1338413 CCTGGATGGCGCTGGGCACCTGG - Intronic
1132936196 16:2482572-2482594 CCTGAAGGGCGGGGGACACCAGG + Intronic
1133052341 16:3124312-3124334 CCTGAATGGCTAAGGGCAGGGGG - Intergenic
1133213116 16:4273812-4273834 CCTGAACGGCAGCGGCCCCCGGG + Intergenic
1133922221 16:10163597-10163619 GCTGAGTGGCAGGGGGCACTTGG - Intronic
1135504199 16:23022073-23022095 CATTAGTGGCAGAGGCCACCAGG + Intergenic
1138012297 16:53393950-53393972 CATGAATGACAGAAGGGACCCGG + Intergenic
1138152832 16:54674828-54674850 CCAGAATAGCAGGGGCCACCAGG + Intergenic
1140736994 16:77907291-77907313 CCTGAAGGGCAGATTCCACCAGG + Intronic
1141726781 16:85794900-85794922 CCTGAGCGTGAGAGGGCACCGGG - Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1143757982 17:9080339-9080361 CCTGAAGTGTAGAGGGCTCCAGG - Intronic
1144849075 17:18235032-18235054 CATAGGTGGCAGAGGGCACCAGG - Intronic
1148478339 17:47943711-47943733 CCTGAATGGCAGACGGGGCTTGG - Intronic
1148733354 17:49851185-49851207 CCCGGGTGGCCGAGGGCACCGGG - Intergenic
1149951856 17:60996770-60996792 ACTTAATGTCAGAGGGCCCCAGG - Intronic
1150741271 17:67780768-67780790 CCAACATGGCAGAGGGCACTGGG + Intergenic
1151242400 17:72768449-72768471 TTTCAATGGCACAGGGCACCAGG + Intronic
1151346836 17:73507500-73507522 CATGCATGGCCGAGGGCAGCTGG - Exonic
1151404246 17:73876459-73876481 CCAGAATGGCAGCCAGCACCTGG - Intergenic
1151416540 17:73969847-73969869 CCTGAATTTCAGAGAGCACAGGG + Intergenic
1151974511 17:77476656-77476678 AGTGAATGGCAGAGGGGCCCTGG + Intronic
1152252960 17:79221256-79221278 CCTGAAGGCCAGAGCCCACCCGG + Intronic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1152467978 17:80476440-80476462 CCGGCATGGCTGCGGGCACCGGG + Exonic
1156290943 18:35748127-35748149 CCTGACAGGCAGAGGGCTCTGGG + Intergenic
1157579090 18:48763114-48763136 CCTGTCTGCCAGAGAGCACCCGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159926936 18:74277895-74277917 CCAGACTGGAAGAGAGCACCTGG + Intronic
1160487285 18:79305104-79305126 CCAGACTTGCAGAGGCCACCTGG + Intronic
1161456032 19:4370149-4370171 CTTGCCTGGCAGATGGCACCAGG - Intronic
1163087387 19:14992119-14992141 CCTGAAAAGCAGAAGGCACTGGG - Intronic
1163127624 19:15252815-15252837 CCTGGGAAGCAGAGGGCACCAGG + Intronic
1163797722 19:19346909-19346931 CCTTGATGGCAGTGGACACCTGG + Intronic
1164983731 19:32632890-32632912 CCTGCATGGCAGAGGACCCCAGG - Intronic
1167535715 19:50050178-50050200 CTTTACTGGCAGAGGACACCTGG + Intronic
1167948734 19:53009904-53009926 CCTGCATGGAAAAGGGGACCTGG - Intergenic
1168072043 19:53958808-53958830 CCTGGATGGCAGAAGGTACCTGG - Intergenic
925042821 2:746791-746813 CCAGAATGGCTGAGGTCACGAGG - Intergenic
925181258 2:1818318-1818340 ACTGAATCGCAGACAGCACCTGG - Intronic
925601419 2:5612022-5612044 CCAAGATGGCAGAGGACACCTGG + Intergenic
926272892 2:11379900-11379922 CCAAAAAGGCAGAGGCCACCAGG + Intergenic
926291849 2:11538033-11538055 CCTGAGTGGCAGAAGGCACGGGG + Intronic
926534819 2:14098839-14098861 CCTTCATCTCAGAGGGCACCAGG - Intergenic
927197383 2:20557963-20557985 TCTGCAAAGCAGAGGGCACCAGG + Intergenic
927343581 2:22010305-22010327 CACGGATGGCAGAGGGCACGGGG - Intergenic
927886472 2:26721606-26721628 GCTGGATGGCAGAGGGCAGCTGG - Intronic
931462549 2:62461493-62461515 ACTGACTGGCAGGGGGTACCAGG + Intergenic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG + Intergenic
933750089 2:85597662-85597684 CCTAAATCGCAGAAGGCACCAGG + Intergenic
934068265 2:88360000-88360022 CCAGAATGGCAGAGAGCAGGAGG + Intergenic
934559231 2:95303716-95303738 CTTGAGTGGCAGAGAGCAGCTGG + Intronic
934604918 2:95687340-95687362 CCTGAAGAGCAGAGACCACCAGG - Intergenic
936538371 2:113329879-113329901 CCTGAAGAGCAGAGACCACCAGG - Intergenic
937474933 2:122206825-122206847 CCTGAATGGAGAAGGGCCCCTGG + Intergenic
938012928 2:127843147-127843169 CCTGAATGGGAGATGGGACTAGG - Intergenic
938261681 2:129901038-129901060 CAGGAATGGTAGAGGGCAGCAGG + Intergenic
942229784 2:173849595-173849617 CCTGAATGGCAGTGTTCACACGG - Intergenic
945003101 2:205373106-205373128 CCTGAATAGCACATGGCAACTGG - Intronic
946025838 2:216671198-216671220 GCTCAATGGCTGAGGCCACCAGG - Intergenic
948687247 2:239677062-239677084 CATGAAGGGCAGGGAGCACCAGG + Intergenic
949079541 2:242085794-242085816 CCTGTGAGGCAGGGGGCACCTGG + Intergenic
1169260747 20:4136288-4136310 CCTGGAGGGCGCAGGGCACCTGG + Intronic
1172446038 20:34993922-34993944 CGGGAATTGCAGAGGCCACCAGG + Intronic
1172594913 20:36144281-36144303 CCTGTGTGGCAGAGGGCGCTGGG - Intronic
1173018741 20:39249503-39249525 CCTTAATGGTAGAGGTCACCAGG + Intergenic
1175305717 20:57974210-57974232 CCACAATGGCAGAGGGAACGTGG + Intergenic
1176951898 21:15057646-15057668 CCTGAATGTCAGATGGCAACTGG + Intronic
1179349247 21:40591982-40592004 TCTGAATGCCAGAAGGCAGCTGG - Intronic
1179875921 21:44267362-44267384 GCTGGAGGGCAGAGGGCACACGG - Intergenic
1179955982 21:44738869-44738891 CCTGAATGGCATAGGCCCCAAGG + Intergenic
1180068525 21:45424677-45424699 GCTGAAGGGCAGAAGCCACCAGG - Intronic
1182000886 22:26918963-26918985 CTTGCATGGCAGAGGAGACCTGG + Intergenic
1183318059 22:37147839-37147861 CCCCAATAGCAGAGGGCACAGGG + Intronic
1183323803 22:37180683-37180705 CATGAGGGGCAGAGAGCACCTGG + Exonic
1183522450 22:38303347-38303369 CCTCAAGGGCAGATGGCCCCGGG - Intronic
1183688414 22:39375025-39375047 TCTGAAGGGCAAAGGGCAGCAGG - Intronic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1184190745 22:42892753-42892775 CCTGATTGGCTGAGGACAGCTGG + Intronic
1184700820 22:46171511-46171533 CCAGAAGGGGTGAGGGCACCAGG + Intronic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG + Intronic
949311392 3:2702519-2702541 TCTGCATGCCAGAGGGCACAAGG - Intronic
952586275 3:34896533-34896555 CCTGAATTTCAGAGAGCACACGG + Intergenic
952669387 3:35947979-35948001 CCTGACTGACAGAGGGCAAAAGG - Intergenic
952982461 3:38748698-38748720 CCAGAATGGCAGAGAGGAGCTGG - Intronic
953735185 3:45488028-45488050 CCTCAGTGGCAGAGGGCAGTGGG - Intronic
959511399 3:107216893-107216915 CCTGTATGGCAGAGCACACTGGG + Intergenic
960255031 3:115502662-115502684 AGTGATTGGCAGAAGGCACCTGG - Intergenic
960593516 3:119387966-119387988 CCTGAATGACATGGGGAACCAGG + Intronic
961393494 3:126570403-126570425 CCTGGCCTGCAGAGGGCACCGGG + Intergenic
961457484 3:127031359-127031381 CCTGCATGGCCGAGGGCTTCTGG + Intronic
962344638 3:134610253-134610275 CCTGGAGGGAAGATGGCACCTGG - Exonic
963626293 3:147678250-147678272 CCTGAATAGGTGAGGGCACTAGG + Intergenic
963851589 3:150215661-150215683 CTTCAATGGAAGAGGGTACCTGG - Intergenic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
970007821 4:11427912-11427934 CCTGGCTGGTAGAGCGCACCTGG + Intronic
972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG + Intergenic
974970584 4:68821375-68821397 CCAGAATAGGAGAGGCCACCAGG - Intronic
974985206 4:69015023-69015045 CCAGAATAGAAGAGGCCACCAGG + Intronic
974999848 4:69209352-69209374 CCAGAATAGGAGAGGCCACCAGG + Intronic
975005927 4:69285858-69285880 CCAGAATAGAAGAGGCCACCAGG - Intronic
975014344 4:69394806-69394828 CCAGAATAGAAGAGGCCACCAGG - Intronic
975735173 4:77373609-77373631 CCTCACTGGCAGAGAGCACTAGG - Intronic
976708259 4:88041516-88041538 CCTCACTGGGAGAGGGCTCCTGG - Intronic
976851376 4:89550018-89550040 CATGAAGGGCAAAGGGCATCAGG - Intergenic
976961200 4:90977201-90977223 GCAGAAAGACAGAGGGCACCAGG + Intronic
979181349 4:117731920-117731942 CCTGAGTGACAGAGGTTACCTGG - Intergenic
982254855 4:153441884-153441906 CCTAAATGGCAATGAGCACCAGG - Intergenic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
985829073 5:2214495-2214517 CCTGAAGGAGAGAGGGCACATGG - Intergenic
990308241 5:54514879-54514901 GCTGGGTGGCAGAGGGCACCAGG + Intergenic
991379319 5:66003244-66003266 CCTGCCTGGCAGAGACCACCAGG + Intronic
991390605 5:66139527-66139549 CCTGAAAGGCAAAGGTCACGTGG + Intergenic
994190940 5:96868541-96868563 CCTGAATGGCTGAGTGGACTTGG - Intronic
994267243 5:97732622-97732644 CCTGATTGCCAGAGTTCACCTGG - Intergenic
996092058 5:119361170-119361192 CCTGACTCCCAGAGTGCACCGGG - Intronic
997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG + Intronic
999385033 5:151148014-151148036 CCTGAAGGGCTGGGGGCAGCTGG - Intronic
999738937 5:154534591-154534613 CCTAAAGGGCAGAGCCCACCTGG + Intergenic
1002661755 5:180796091-180796113 CCTGTGAGGCAGAGGGCAACTGG - Intronic
1003568876 6:7242948-7242970 CCTCAAGGGCAGAGGGGGCCAGG - Intronic
1004504917 6:16239537-16239559 CCTGAAAGGCAGAGTGCCCCGGG + Intronic
1005812472 6:29528139-29528161 CTGGAAAGGCAGAGGTCACCTGG - Intergenic
1005813512 6:29532914-29532936 CCTGAAAGGGAAGGGGCACCAGG + Intergenic
1006641446 6:35491708-35491730 CCTGAAAGGCTGAGGGCCCTGGG - Intronic
1006845596 6:37059395-37059417 CCTGACCGGCAGGGGGAACCAGG + Intergenic
1007082240 6:39115849-39115871 ACTGATTGGGAGAGGGCACAAGG - Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1011165802 6:84444409-84444431 CCTGAAGGGATGAGGACACCAGG - Intergenic
1013968425 6:115984713-115984735 TGTGAATGGCAGAGGGAAACAGG - Intronic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1018272869 6:162099244-162099266 CCTGAATGGTCAAGGTCACCAGG - Intronic
1018694604 6:166382295-166382317 CCAGAGTGGCAGTGGGGACCTGG - Intronic
1018997205 6:168719075-168719097 CCTGAATGCCTGAGAGCACAGGG - Intergenic
1019177267 6:170166519-170166541 CCTGCGGGGCAGCGGGCACCCGG - Intergenic
1019235470 6:170608867-170608889 ACTGGATGGGAGAGGGCAGCAGG + Intergenic
1021965585 7:25915143-25915165 CCTGGATGGCAGAAAACACCAGG + Intergenic
1023085035 7:36561884-36561906 CCTGAGTGGCAAAGGGACCCAGG - Intronic
1023809520 7:43901330-43901352 CATGGGTGGCAGAGTGCACCAGG - Intronic
1025251801 7:57356438-57356460 CCTGAATCTCAGGGGGCAACAGG - Intergenic
1026639545 7:72112084-72112106 CCTGATTCTCAGAGGGCACTAGG - Intronic
1026772845 7:73213160-73213182 CCTGGGTGGCAGAGGGCAACTGG + Intergenic
1027013709 7:74766557-74766579 CCTGGGTGGCAGAGGGCAACTGG + Intergenic
1027074329 7:75179475-75179497 CCTGGGTGGCAGAGGGCAACTGG - Intergenic
1032446624 7:131989804-131989826 CATGAAGGGCAGAAGGCACAAGG - Intergenic
1033329702 7:140407841-140407863 AGTGAAGGTCAGAGGGCACCGGG + Exonic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034825144 7:154255500-154255522 CGGGAATGGCAGAGCACACCTGG + Intronic
1034936216 7:155202639-155202661 CCTTGATGGCAGAGGGCCCCGGG + Intergenic
1035537611 8:404314-404336 CCTGTGAGGCAGGGGGCACCTGG + Intergenic
1035623271 8:1051131-1051153 CCTGGATGGGACAGGGCACAAGG + Intergenic
1036710975 8:11078418-11078440 GCAGAATGGCAGACGGTACCTGG - Intronic
1037484108 8:19331344-19331366 ACTGCATGGAAGAGGGCACCTGG - Intronic
1039010709 8:33089927-33089949 CCAGAACGACAGAAGGCACCTGG + Intergenic
1039474660 8:37833361-37833383 TCTGAATAGCAGAGGGCGGCTGG - Intronic
1039763713 8:40606506-40606528 CCTGCATGCCAGAAGGCACTGGG - Intronic
1040705533 8:50122102-50122124 TCTGTATGGCAGAGGACACTGGG - Intronic
1045062897 8:98424255-98424277 CTTGAATGGCAGAGTGAACTTGG - Intronic
1045259381 8:100559235-100559257 CCAGAATGGCACATGGCTCCGGG - Intronic
1047754628 8:127909019-127909041 CCTAAATGGCAGGGGCCACGTGG - Intergenic
1049179211 8:141212448-141212470 CCCCAAGGGCAGAGGCCACCAGG + Exonic
1052709756 9:32039056-32039078 CCTGAGAGGCAGAGGTCACAGGG + Intergenic
1053114449 9:35489520-35489542 CCTGAAGGGCAGGGGGCGCATGG + Intergenic
1053307795 9:36996172-36996194 CCGTCATGGCAGAGGGCAGCAGG - Intronic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1058985766 9:110207499-110207521 ACTTAATGGCTGAGGGCTCCAGG - Exonic
1060984996 9:127814829-127814851 GGTGAATGGCAGAGGGGAACTGG + Intergenic
1061343459 9:130002540-130002562 CCTGCATGGCAGAGGTCACGTGG - Intronic
1061689600 9:132315419-132315441 CCTCAAAGGAAGAGGGCTCCAGG - Intronic
1186077339 X:5895013-5895035 CCTGCATGGCAGAAGGCTGCAGG + Intronic
1186466864 X:9790147-9790169 CCTTGATTGCAGAGGGCACAGGG + Intronic
1190567498 X:51745160-51745182 CCAGAATGGCAGAGGTTACTAGG - Exonic
1190581686 X:51896787-51896809 CCTGGATGGCAGACTCCACCTGG + Exonic
1190581691 X:51896805-51896827 CCTGGATGGCAGACCCCACCGGG + Exonic
1192195390 X:69024399-69024421 CCAGCAGGGCAGGGGGCACCCGG + Intergenic
1192716184 X:73644770-73644792 CCTGGATGACAGACGGCACCTGG - Intronic
1193074888 X:77345329-77345351 TCTGGCTGCCAGAGGGCACCTGG - Intergenic
1196741425 X:119029273-119029295 CCTGAATGACTGGGGGCACAGGG - Intergenic
1196747627 X:119085785-119085807 TCTGATTTGCAGATGGCACCAGG - Intronic
1198116420 X:133549269-133549291 CCTGGATGGCAATGGGCCCCTGG - Intronic
1198744902 X:139879900-139879922 TTTGACTGGGAGAGGGCACCTGG + Intronic
1199847529 X:151701769-151701791 ACTGAATGGCAGAGTCCACGTGG - Exonic
1200393555 X:155968767-155968789 ACTGAATGGGAGAGGGGAGCAGG - Intergenic
1200966943 Y:9055551-9055573 ACTAAATGGGAGAGGGCAACAGG - Intergenic
1201517984 Y:14839022-14839044 CCTGTATGGCAGAAGGCTACAGG - Intronic