ID: 1124139541

View in Genome Browser
Species Human (GRCh38)
Location 15:27065064-27065086
Sequence AATGGGGTGCCTCAAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 10, 3: 89, 4: 642}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124139541_1124139550 28 Left 1124139541 15:27065064-27065086 CCCTCTCTTTGAGGCACCCCATT 0: 1
1: 0
2: 10
3: 89
4: 642
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139541_1124139551 29 Left 1124139541 15:27065064-27065086 CCCTCTCTTTGAGGCACCCCATT 0: 1
1: 0
2: 10
3: 89
4: 642
Right 1124139551 15:27065116-27065138 CGTTGGCTGCCACTCTCAATGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1124139541_1124139549 12 Left 1124139541 15:27065064-27065086 CCCTCTCTTTGAGGCACCCCATT 0: 1
1: 0
2: 10
3: 89
4: 642
Right 1124139549 15:27065099-27065121 GCTGGTGACTAGTCTCACGTTGG 0: 1
1: 0
2: 0
3: 2
4: 41
1124139541_1124139552 30 Left 1124139541 15:27065064-27065086 CCCTCTCTTTGAGGCACCCCATT 0: 1
1: 0
2: 10
3: 89
4: 642
Right 1124139552 15:27065117-27065139 GTTGGCTGCCACTCTCAATGGGG 0: 1
1: 0
2: 2
3: 4
4: 92
1124139541_1124139546 -6 Left 1124139541 15:27065064-27065086 CCCTCTCTTTGAGGCACCCCATT 0: 1
1: 0
2: 10
3: 89
4: 642
Right 1124139546 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124139541 Original CRISPR AATGGGGTGCCTCAAAGAGA GGG (reversed) Intronic
900692086 1:3987155-3987177 AACGGAGTGCTTCAAAGGGAGGG - Intergenic
901035963 1:6336455-6336477 AATGAGCTGCCTCAAAGGCAAGG + Intronic
901186809 1:7378928-7378950 GATGGGGTGCCTCGAGGAGCCGG - Intronic
901191762 1:7416378-7416400 ATTGGTGTGCCTGAAAGTGACGG - Intronic
906909860 1:49936360-49936382 ATTGGGGTACCTTAAAGTGACGG + Intronic
907139703 1:52175623-52175645 AATGGTGTACCTGAAAGTGACGG - Intronic
907431861 1:54416932-54416954 AATGGAGAACCTCAGAGAGATGG - Intergenic
908018461 1:59873152-59873174 AATGTGCTCCCTCAGAGAGATGG - Exonic
908818689 1:68059742-68059764 ATTGGTGTCCCTGAAAGAGAGGG + Intergenic
908866026 1:68549250-68549272 ATTGGGGTACTTGAAAGAGATGG + Intergenic
909261138 1:73490764-73490786 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
909270614 1:73618714-73618736 ATTGGGGTACCTAAAAGAGATGG + Intergenic
909503037 1:76356829-76356851 AAGGGAATGGCTCAAAGAGAGGG - Intronic
909677973 1:78258661-78258683 ATTGGGGTACCTGAAAGAGATGG + Intergenic
910064738 1:83139973-83139995 ATTGGCGTCCCTGAAAGAGAGGG - Intergenic
910166709 1:84336163-84336185 ACTGGTGTCCCTGAAAGAGAGGG - Intronic
910190498 1:84590167-84590189 ATTGGGGTACCTGAAAGACATGG + Intergenic
910627071 1:89318130-89318152 ATTGGGGTCCCTGAAAGTGATGG + Intergenic
911284464 1:95973574-95973596 ATTGGAGTACCTGAAAGAGATGG - Intergenic
911794657 1:102060154-102060176 ATTGGAGTACCTGAAAGAGATGG + Intergenic
911835323 1:102611640-102611662 ATTAGGGTACCTGAAAGAGATGG + Intergenic
912314696 1:108657182-108657204 AATGGGGAGCCTTAAGGAGGGGG - Intronic
912633584 1:111270762-111270784 GATGGGGTGCTTTGAAGAGAGGG - Intergenic
912860893 1:113212955-113212977 AATGAAGTACCCCAAAGAGAAGG - Intergenic
912887459 1:113489913-113489935 ATTGGTGTTCCTGAAAGAGATGG + Intronic
913020893 1:114788935-114788957 ATTGGGGTACCTGAAAGTGACGG - Intergenic
913253570 1:116933581-116933603 AAGGGGGTTCTTCAAATAGAGGG - Intronic
913349733 1:117843996-117844018 ACTGGTGTTCCTGAAAGAGACGG + Intergenic
914293235 1:146294525-146294547 AATTGGGTGTTTCAAAGACAGGG - Intergenic
914554279 1:148745308-148745330 AATTGGGTGTTTCAAAGACAGGG - Intergenic
915995560 1:160559005-160559027 ATTGGGGTAGCTGAAAGAGATGG + Intronic
917181571 1:172303405-172303427 ATTGGTGTGCCTGAAAGTGATGG + Intronic
917207773 1:172595895-172595917 AATGGTGTACCTGAAAGTGACGG - Intronic
917305362 1:173618661-173618683 ATTGGGGTACCTGAAAAAGACGG + Intronic
917424578 1:174900910-174900932 ACTGGGGTACCTGAAAGAGATGG - Intronic
918324614 1:183397436-183397458 ACTGGTGTGCCTAAAAGTGATGG + Intronic
918614651 1:186530770-186530792 ATTGGAGTACCTGAAAGAGATGG - Intergenic
919065365 1:192687336-192687358 ATTGGGGTACCTGAAAGTGATGG - Intergenic
919578267 1:199338364-199338386 ATTGGTGTACCTGAAAGAGATGG + Intergenic
920835072 1:209502953-209502975 ATAGCTGTGCCTCAAAGAGAAGG - Intergenic
920956430 1:210623849-210623871 TATGGGGTACCTCAAAAACAGGG - Intronic
921404418 1:214763754-214763776 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
921881153 1:220255806-220255828 ATTGGGGTACCTGAAAGAGATGG + Intronic
922384812 1:225072158-225072180 ATTGGTGTACCTGAAAGAGATGG - Intronic
922390478 1:225136768-225136790 ACTGGGGTACCTGAAACAGATGG - Intronic
922399470 1:225237725-225237747 ATTGGGGTTCTTGAAAGAGATGG - Intronic
924253240 1:242156971-242156993 ATTGGTGTGCCTGAAAGTGACGG - Intronic
924331869 1:242947688-242947710 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
924412542 1:243820807-243820829 ATTAGGGTACCTGAAAGAGATGG + Intronic
924629721 1:245725217-245725239 ATTGGGGTAGCTGAAAGAGATGG + Intergenic
924652374 1:245941190-245941212 ATTGGGGTACCTGAAAGAGCTGG + Intronic
924788709 1:247223280-247223302 AATGGGGTGCCCGAAAGAGATGG + Intergenic
1062865172 10:846469-846491 AATGGGGAGCCTCAAGCACAGGG + Intronic
1064370322 10:14746909-14746931 ACTGGGGTACTTGAAAGAGACGG - Intronic
1064913200 10:20426330-20426352 AATGGCATTCCTCAAAGAGAGGG - Intergenic
1065546661 10:26828164-26828186 AATAGGGAGGCCCAAAGAGAGGG + Intronic
1066159828 10:32715926-32715948 ACTGGTGTACCTGAAAGAGACGG + Intronic
1066236020 10:33485505-33485527 AATGGTGTGCCTCACAGACCAGG + Intergenic
1067333522 10:45342986-45343008 ATTGGTGTACCTGAAAGAGACGG + Intergenic
1067923353 10:50482045-50482067 ATTGGGGTACCTAAAAGAGATGG + Intronic
1068285476 10:54928555-54928577 ATTGGTGTCCCTGAAAGAGATGG - Intronic
1068311947 10:55290197-55290219 AATTGTGTCCCTCAAGGAGATGG + Intronic
1068410223 10:56645249-56645271 ATTGGAGTACCTGAAAGAGATGG - Intergenic
1068483681 10:57628555-57628577 AATGAGGAGACTCAGAGAGAAGG + Intergenic
1069072147 10:63999852-63999874 ATTGGTGTTCCTGAAAGAGATGG + Intergenic
1070054505 10:72922296-72922318 ATTGGGGTACCTGAAAGAGCTGG - Intronic
1070486628 10:76938139-76938161 AAAGGAGAGCCTCAGAGAGAGGG - Intronic
1071035317 10:81237919-81237941 ATTGGGGTACCTGAAAGGGACGG - Intergenic
1071066596 10:81643563-81643585 ACTGGTGTACCTGAAAGAGACGG - Intergenic
1071357911 10:84817001-84817023 ATTGGTGTCCCTAAAAGAGAGGG - Intergenic
1072304034 10:94089304-94089326 AATTGGGTACCTCAGAGAGCGGG - Intronic
1072402585 10:95120883-95120905 ATTGGAGTACCTAAAAGAGACGG - Intergenic
1072834631 10:98697531-98697553 ACTGGAGTACCTGAAAGAGACGG + Intronic
1073127499 10:101160721-101160743 AATAGGGTGCCTAAGAGAGGGGG + Intergenic
1073698290 10:105894964-105894986 ACTGGGGTCCCTGAAAGTGATGG + Intergenic
1073816448 10:107213118-107213140 ATTGGTGTCCCTGAAAGAGAGGG - Intergenic
1074015704 10:109531561-109531583 ATTGGGGTCCCTGAAAGTGACGG + Intergenic
1074022139 10:109595102-109595124 TTTGGGGTACCTGAAAGAGATGG + Intergenic
1074201495 10:111240099-111240121 AATGGGGAGGCCCAAAGAGAGGG + Intergenic
1075186146 10:120259720-120259742 AATAGGGAGGCTCAAGGAGAGGG + Intergenic
1075899210 10:126025563-126025585 ATTGGGGTACCCAAAAGAGACGG + Intronic
1075963508 10:126589231-126589253 ATTGGGGTACCTGAAAGAGATGG + Intronic
1076070085 10:127482319-127482341 GATGAGGTCCCTCAAAGGGAAGG - Intergenic
1077064970 11:637081-637103 AATGCGGCGGCCCAAAGAGACGG - Intergenic
1077306212 11:1869772-1869794 AATGGGGCGCCCCACAGAGGAGG + Intronic
1077855223 11:6117118-6117140 ATTGGGGTACCTGAAGGAGATGG + Intergenic
1078686036 11:13533279-13533301 ACTGGTGTACCTCAAAGTGATGG - Intergenic
1078690132 11:13571348-13571370 ATTGGTGTACCTGAAAGAGATGG + Intergenic
1078694622 11:13619015-13619037 ATTGGTGTCCCTGAAAGAGAGGG - Intergenic
1078975854 11:16475484-16475506 AACAGGGTGGCTCAAGGAGAGGG + Intronic
1079558699 11:21794190-21794212 AATGTGCTGCCTTGAAGAGAAGG - Intergenic
1079654605 11:22972855-22972877 ACTGGGGTACCTGAAAAAGATGG - Intergenic
1079956837 11:26876583-26876605 AATGGCATTCCTGAAAGAGAAGG + Intergenic
1079977121 11:27105616-27105638 ATTGGGGTACCTGAAAGTGACGG + Intronic
1080209558 11:29770286-29770308 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1080600276 11:33815989-33816011 AATGGGGTGTGTCAGAGAGCGGG - Intergenic
1080818061 11:35778074-35778096 ATTGGTGTACCTCAAAGTGATGG - Intronic
1081026477 11:38020709-38020731 ATTGGTGTTCCTGAAAGAGATGG + Intergenic
1081382528 11:42433882-42433904 ATTGGGGTACCTGAAAGTGATGG - Intergenic
1081442336 11:43094097-43094119 AATGGCTTACCTCAGAGAGATGG - Intergenic
1082204807 11:49420316-49420338 ACTGGGGTTCCTCGAAGAAACGG + Intergenic
1082314107 11:50695953-50695975 ATTGGTGTACCTCAAAGTGATGG + Intergenic
1083040128 11:59677859-59677881 AATAGGGAGGCCCAAAGAGAGGG + Intergenic
1083096407 11:60255557-60255579 ACTGTGGTACCTCAAAGAAATGG - Intergenic
1083345378 11:61986477-61986499 ATTAGGGTACCTGAAAGAGACGG + Intergenic
1083375328 11:62215637-62215659 AAAGAGGTGCCACAAGGAGATGG + Intergenic
1083512811 11:63227383-63227405 AATCTGCTGCCTTAAAGAGAAGG - Intronic
1083521205 11:63314508-63314530 ATTGGTGTGCCTGAAAGTGACGG + Intronic
1083523242 11:63335936-63335958 ACTGGAGTACCTGAAAGAGACGG - Intronic
1084718460 11:70889040-70889062 AATGGTGGTCCTCAAAAAGATGG + Intronic
1085255141 11:75168399-75168421 AATGGAGGGCCGCAGAGAGAAGG + Intronic
1085335016 11:75686747-75686769 ATTGGAGTACCTGAAAGAGATGG - Intergenic
1085683638 11:78602062-78602084 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1085844426 11:80049355-80049377 AATGGAGAGCCACAAAAAGAGGG - Intergenic
1086021681 11:82238505-82238527 ATTGGGGTAACTGAAAGAGATGG - Intergenic
1086650280 11:89280206-89280228 ACTGGGGTTCCTCGAAGAAACGG - Intronic
1086868939 11:92014141-92014163 ATTGGGGTACCTGAAAGTGACGG - Intergenic
1087095395 11:94313121-94313143 ACTGGGTTGCCTCCAGGAGAAGG - Intergenic
1087154052 11:94883950-94883972 ACTGGGGTGGCTCAAAGACCAGG + Intergenic
1087374504 11:97324996-97325018 ATTGGTGTACCTGAAAGAGATGG - Intergenic
1088383234 11:109220311-109220333 ATTGGAGTACCTAAAAGAGATGG - Intergenic
1090004865 11:122992708-122992730 AATTGGGTGGCTGGAAGAGAGGG - Intergenic
1090321318 11:125846001-125846023 ACTGGGGTACCAAAAAGAGATGG + Intergenic
1090734579 11:129599847-129599869 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1091208902 11:133840295-133840317 AAAGGAGTTCTTCAAAGAGAAGG + Intergenic
1092123977 12:6063132-6063154 AATGGGGTGTCTCAAAAGGATGG + Intronic
1092691051 12:11110192-11110214 ACTGGTGTACCTGAAAGAGATGG + Intronic
1092997668 12:13965044-13965066 AATGGGGTGGGTTAAATAGATGG - Intronic
1094307382 12:29036042-29036064 AAGGGGGTGTCTGAAAGCGATGG + Intergenic
1094632642 12:32191876-32191898 AATAGGGAGGCTCAATGAGAGGG - Intronic
1094734676 12:33221670-33221692 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1095518420 12:43033285-43033307 AATGGAGAGCCCCAAGGAGAGGG + Intergenic
1095611353 12:44132305-44132327 AATGAGGTACCTTAATGAGAAGG - Intronic
1096051574 12:48614194-48614216 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1097455855 12:59797411-59797433 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1097498636 12:60374834-60374856 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1097890676 12:64774315-64774337 ATTGGTGTACCTGAAAGAGATGG + Intergenic
1098047180 12:66412004-66412026 ATTGGGGTACCTGAAGGAGAAGG + Intronic
1098844758 12:75522053-75522075 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1099106911 12:78507945-78507967 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
1099502531 12:83431615-83431637 ATTGGAGTGCCTGAAAGTGATGG - Intergenic
1099807019 12:87532450-87532472 AATGGTGTACCTGAAAGTGATGG + Intergenic
1099877604 12:88428567-88428589 ATTGGAGTCCCTCAATGAGAAGG + Intergenic
1100256991 12:92894250-92894272 AATAGGGAGGCTCAAGGAGAAGG - Intronic
1100563964 12:95776684-95776706 ATTGGTGTGCCTGAAAGTGATGG + Intronic
1104156186 12:126135233-126135255 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1105316629 13:19271354-19271376 ATTGGTGTACCTCAAAGTGATGG + Intergenic
1105316988 13:19274372-19274394 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1105338634 13:19498171-19498193 ATTGGTGTGCCTGAAAGTGATGG + Intronic
1105396556 13:20042174-20042196 ACTGGTGTCCCTGAAAGAGATGG - Intronic
1105800258 13:23896856-23896878 AATGGTCTGCCTGGAAGAGATGG - Exonic
1105848756 13:24316112-24316134 AATGGTCTGCCTGGAAGAGATGG + Exonic
1106387701 13:29303661-29303683 ATTGGGGTACCTGAAAAAGATGG + Intronic
1107776784 13:43852510-43852532 ATTGGAGTCCCTAAAAGAGATGG + Intronic
1108812705 13:54248400-54248422 AAAGGGGTGCCTTTTAGAGAAGG + Intergenic
1109307774 13:60660381-60660403 ACTGGAGTACCTGAAAGAGATGG - Intergenic
1109369323 13:61400611-61400633 ACTGGGGTTCTACAAAGAGATGG - Intergenic
1109968897 13:69738775-69738797 ATAGGGGTACCTGAAAGAGATGG + Intronic
1110074916 13:71228105-71228127 AATAAAGTACCTCAAAGAGATGG - Intergenic
1110698293 13:78517825-78517847 ATTGGTGTACCTCAAAGTGACGG - Intergenic
1110836777 13:80092706-80092728 ATTGGAGTACCTAAAAGAGATGG - Intergenic
1111605936 13:90539128-90539150 ATTGGTGTCCCTGAAAGAGAAGG + Intergenic
1112152081 13:96774705-96774727 ATTGGGGTACCTGAAAGTGACGG + Intronic
1112387078 13:98949768-98949790 AGTGGGCTTCCTCAAGGAGATGG - Intronic
1114034372 14:18608623-18608645 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1114079175 14:19187801-19187823 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
1115048542 14:29027997-29028019 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
1115477209 14:33826991-33827013 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1115890680 14:38024692-38024714 ATTGGTGTCCCTGAAAGAGAGGG + Intronic
1116771307 14:49130388-49130410 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1117121229 14:52569816-52569838 ATTGGTGTGCCTGAAAGTGAAGG + Intronic
1117577468 14:57113598-57113620 ATTGGGGTACCTGAAAGCGATGG + Intergenic
1117638902 14:57776172-57776194 ACTGGTGTTCCTGAAAGAGATGG + Intronic
1117751203 14:58925265-58925287 ATTGGGGTACCTGAAAGAAACGG + Intergenic
1117794951 14:59383087-59383109 AATGGCGTTCCTCACAGAAATGG - Intergenic
1117829400 14:59734760-59734782 ATTAGGGTACCTGAAAGAGATGG + Intronic
1117849913 14:59957244-59957266 ATTGGGGTCCCTGAAAGTGATGG - Intronic
1117857370 14:60049873-60049895 ATTGGGGTACCTGAAAGAGATGG - Intronic
1118558390 14:67051484-67051506 ATTGGGGTACCTGAAAGAGATGG + Intronic
1121142561 14:91556181-91556203 ATTGGGGCACCTGAAAGAGATGG + Intergenic
1121706952 14:96003481-96003503 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1123506685 15:20948021-20948043 ATTGGGGTACCTCAAAGAGATGG - Intergenic
1123563910 15:21521766-21521788 ATTGGGGTACCTCAAAGAGATGG - Intergenic
1123600164 15:21959050-21959072 ATTGGGGTACCTCAAAGAGATGG - Intergenic
1123837367 15:24209811-24209833 CATGAGGTGTCTCACAGAGATGG + Intergenic
1123846579 15:24309566-24309588 CATGAGGTGTCTCACAGAGATGG + Intergenic
1123872495 15:24591234-24591256 CATGAGGTGTCTTAAAGAGATGG + Intergenic
1123875547 15:24620601-24620623 ATTGGTGTCCCTGAAAGAGAAGG - Intergenic
1124139541 15:27065064-27065086 AATGGGGTGCCTCAAAGAGAGGG - Intronic
1124719256 15:32097769-32097791 AAGGGGGTTCCTGCAAGAGAGGG - Intronic
1125216507 15:37281898-37281920 ATTGGGGTACCTGAAAAAGATGG - Intergenic
1125235040 15:37503171-37503193 ATTGGAGTACCTGAAAGAGACGG + Intergenic
1125381793 15:39093512-39093534 AATGGGGTCCCTCAATAATAAGG + Intergenic
1126219468 15:46196266-46196288 ATAGGGGTACCTGAAAGAGATGG - Intergenic
1126956396 15:53937408-53937430 ATTGGGGTACATGAAAGAGATGG + Intergenic
1127836175 15:62792943-62792965 AATGGGGTGCATCAGGGAGCTGG + Intronic
1129959245 15:79668398-79668420 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
1130805440 15:87316267-87316289 ACTGGAGTGGCTCAAAGACAGGG + Intergenic
1131872289 15:96775410-96775432 AAGGGGGTGCGGCAGAGAGAGGG - Intergenic
1202972270 15_KI270727v1_random:248861-248883 ATTGGGGTACCTCAAAGAGATGG - Intergenic
1133070691 16:3244776-3244798 ACTGGGGTGCTTTAAAGACATGG + Intronic
1133081361 16:3323242-3323264 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
1134035528 16:11027686-11027708 AGTGGGCTTCCTCAAGGAGATGG + Intronic
1134907312 16:17991309-17991331 TAAGAGGGGCCTCAAAGAGAAGG + Intergenic
1135643662 16:24142816-24142838 CAAGGGGATCCTCAAAGAGATGG + Intronic
1136480283 16:30537257-30537279 AGTGGGCTTCCTCAAGGAGATGG - Intronic
1136643356 16:31587663-31587685 ATTGGGGTACCTGAAAGCGATGG - Intergenic
1137234122 16:46599382-46599404 AATAGGGTAGCCCAAAGAGAAGG + Intronic
1137544352 16:49390338-49390360 ATCAGGGTGCCTGAAAGAGAGGG - Intronic
1139039902 16:62986801-62986823 AATGCGGTCACTGAAAGAGATGG + Intergenic
1139617966 16:68112233-68112255 ACTGGGGTACCTGAAAGAGACGG - Intronic
1140669932 16:77268339-77268361 ACTGGGGTACCTGAAAGAGATGG - Intronic
1141071211 16:80956191-80956213 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1141926593 16:87174105-87174127 AAGGGGGTGCCAGGAAGAGAAGG - Intronic
1144060115 17:11575606-11575628 AATGTGGGGCCTCCAAGAGAGGG - Intergenic
1144120971 17:12151988-12152010 ATTGGGGTACCTAAAAGAGAGGG + Intergenic
1145040200 17:19572261-19572283 AATGGGGTCCATGAAAGGGAAGG - Intronic
1145718255 17:27044281-27044303 ACTGGGGTACCTGAAAGTGATGG - Intergenic
1145724303 17:27103772-27103794 ACTGGGGTACCTGAAAGCGATGG - Intergenic
1146758894 17:35458380-35458402 ATTGGGGTACCTGAAAGAGGTGG - Intergenic
1146761097 17:35479708-35479730 ACTGGAGTTCCTCAAAGACATGG - Exonic
1147461203 17:40570340-40570362 ATTGGGGTATCTGAAAGAGATGG + Intergenic
1147996964 17:44365070-44365092 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
1149372027 17:56003905-56003927 ATTGGTGTGCCTGAAAGGGACGG + Intergenic
1150866676 17:68857925-68857947 AATGGGGAGGCTGAAGGAGAAGG - Intergenic
1151345986 17:73501528-73501550 AATGAGGTGGCTCTAAGAGCTGG - Intronic
1153430014 18:5005516-5005538 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1155117348 18:22782857-22782879 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1155429988 18:25744947-25744969 GTTGGGGTACCTGAAAGAGAAGG + Intergenic
1155464758 18:26121966-26121988 ACTGGGGTACCTGAAAGAGATGG + Intergenic
1156587246 18:38444919-38444941 AATGGGGTTCCTGAAGCAGAGGG - Intergenic
1157068243 18:44376361-44376383 ATTGGGGTACCTGAAAGTGACGG + Intergenic
1157123289 18:44932557-44932579 ATTGGTGTACCTCAAAGTGATGG - Intronic
1157622401 18:49024058-49024080 TCTGGGGTGCCGCAGAGAGATGG + Intergenic
1158098788 18:53805693-53805715 ACTGGGGTCCCTGAAAGTGATGG + Intergenic
1158676830 18:59528095-59528117 ATTGGGGTACCTGAAAGAGAAGG - Intronic
1158834367 18:61315192-61315214 AATGGTGTACCTGAAAGTGACGG - Intergenic
1159466406 18:68789448-68789470 ATTGGGGTACCTGAAAGCGATGG - Intronic
1159629923 18:70737359-70737381 ATTGGTGTACCTCAAAGTGATGG + Intergenic
1160419419 18:78733962-78733984 AATGGGGTGCCTCACAGATAAGG + Intergenic
1162686442 19:12388902-12388924 GATGGAATACCTCAAAGAGAAGG + Intronic
1162690762 19:12428411-12428433 GATGGAATACCTCAAAGAGAAGG + Intronic
1163265103 19:16215783-16215805 ATTGGTGTCCCTGAAAGAGATGG - Intronic
1163736805 19:18986521-18986543 AATGGGATGCCTCAAGGACTGGG + Intergenic
1164112884 19:22185904-22185926 ATTGGGGTACCTGAAAGTGATGG + Intronic
1165270056 19:34698129-34698151 ACTGGGGTCCCTGAAAGTGATGG + Intergenic
925553805 2:5106225-5106247 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
926338728 2:11886075-11886097 AATGGTGTACCTGAAAGTGATGG - Intergenic
926979142 2:18548584-18548606 AATGGGGAGGCCCAAGGAGAGGG - Intergenic
926987181 2:18637867-18637889 ATTGGGGTACCTGAAAGAGAGGG - Intergenic
928103487 2:28452874-28452896 AATGGGGTGGTTCCCAGAGATGG - Intergenic
928484843 2:31719249-31719271 ATTGGTGTACCTGAAAGAGATGG + Intergenic
929323206 2:40571867-40571889 AATGGAGAGGCCCAAAGAGAGGG - Intronic
930711117 2:54552012-54552034 AATGGGCTGAGTTAAAGAGAAGG + Intronic
930839384 2:55828072-55828094 ATTGGTGTCCCTGAAAGAGAGGG + Intergenic
931030532 2:58169927-58169949 ATTGGTGTGCCTGAAAGTGATGG + Intronic
931921331 2:67019351-67019373 AATGATGTACCTGAAAGAGAAGG + Intergenic
932379742 2:71271152-71271174 ATTGGGGTACCTGAAAGAGATGG + Intergenic
932492868 2:72132724-72132746 AGTGGGGTGTCTCTAAGAAAAGG - Intronic
933169855 2:79113276-79113298 AATGGCCTGCCTCAAAGACATGG - Intergenic
933390069 2:81656854-81656876 AAAGAGGTGCCACAAGGAGAGGG - Intergenic
933482732 2:82877224-82877246 ATTGGGGTAACTTAAAGAGATGG + Intergenic
934102619 2:88667284-88667306 AATGGGGTGCCCAGAAGAGCAGG + Intergenic
934478965 2:94617567-94617589 ATTGGGGTACCTGAAAGAAATGG - Intergenic
934698754 2:96421547-96421569 ATTGGGGTCCCTGAAAGTGACGG - Intergenic
934702884 2:96456230-96456252 ATTGGGGTCCCTGAAAGTGATGG + Intergenic
934710325 2:96509948-96509970 AATGGGGAGCCTGCCAGAGAGGG + Intergenic
934923523 2:98365523-98365545 ATTGGGGTACCTGAAAGAGATGG - Intronic
935449409 2:103191518-103191540 ATTGGTGTTCCTGAAAGAGATGG + Intergenic
935581591 2:104760481-104760503 AATGGGCTCCCTCAAGGAGAGGG + Intergenic
936674052 2:114693696-114693718 ATTGGGGTACCTCAAAGAGATGG - Intronic
936820220 2:116510951-116510973 AATGGGGTGCTTCAAAAACTTGG + Intergenic
936873159 2:117157409-117157431 ACTGGGGTACCTGAAAGCGATGG + Intergenic
937633030 2:124124436-124124458 ATTGGTGTACCTAAAAGAGACGG + Intronic
938700721 2:133876795-133876817 CATAAGGTGTCTCAAAGAGATGG + Intergenic
939089196 2:137758772-137758794 ATTGGTGTCCCTGAAAGAGAGGG + Intergenic
939398511 2:141661704-141661726 ACTGGGGTACCTGAACGAGATGG + Intronic
940134594 2:150422211-150422233 AATGGGAAGCCTAAAAGAGAAGG + Intergenic
940410897 2:153361747-153361769 ATTGGAGTACCTGAAAGAGAAGG + Intergenic
940524366 2:154793232-154793254 ATTGGATTGCCTCAAAGAGAGGG - Intronic
941136254 2:161721803-161721825 ATTGGGGTACCTGAAAGAGATGG - Intronic
941265157 2:163352151-163352173 AATGGGGTGCTTTATAGGGAAGG + Intergenic
941602468 2:167559828-167559850 ATTGGTGTACCTCAAAGTGACGG + Intergenic
941611498 2:167667569-167667591 ATTGGTGTACCTCAAAGTGACGG - Intergenic
942581949 2:177428932-177428954 ATTGGGGTACCCGAAAGAGATGG - Intronic
942856669 2:180556855-180556877 ATTGGGGTACCAGAAAGAGATGG + Intergenic
943016164 2:182512974-182512996 AATGGCATCCCTGAAAGAGAGGG + Intronic
943105900 2:183545112-183545134 AATGGTGTACCTGAAAGTGACGG + Intergenic
944275274 2:197830545-197830567 ATTGGTGTACCTGAAAGAGATGG + Intronic
944783177 2:203040821-203040843 AGTGGGCTTCCTCAAGGAGATGG + Intronic
945346989 2:208730508-208730530 AATGGTGTCTCTGAAAGAGAGGG - Intronic
945366423 2:208960196-208960218 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
945450192 2:209985416-209985438 AATAGCATGCATCAAAGAGAAGG - Intronic
945487591 2:210416026-210416048 ATTGGTGTCCCTGAAAGAGAAGG - Intergenic
945815687 2:214602633-214602655 ATCTGGGTGCCTCATAGAGATGG - Intergenic
946648861 2:221869635-221869657 ATTGGGGTACCCAAAAGAGATGG + Intergenic
946748922 2:222872981-222873003 AATGGATTGCTTCTAAGAGACGG - Intronic
947088956 2:226488578-226488600 AAGATGGTCCCTCAAAGAGAAGG + Intergenic
947098180 2:226590690-226590712 ATTGGGGTACCTGAAAGAGATGG - Intergenic
947281339 2:228459163-228459185 ATTGGTGTCCCTGAAAGAGAAGG - Intergenic
1168933364 20:1643187-1643209 ATTGGAGTACCTGAAAGAGATGG - Intronic
1169319888 20:4623934-4623956 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
1169516289 20:6320437-6320459 ATTGGGGTACCTGAAAGTGATGG - Intergenic
1171404657 20:24901979-24902001 ATTGGGGTACCTGAAAGCGATGG + Intergenic
1171513247 20:25705313-25705335 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
1173776874 20:45715858-45715880 ATTGGGATACCTGAAAGAGATGG + Intergenic
1173789506 20:45818655-45818677 AATGGGGTTGCTAAAAGAGAAGG + Intergenic
1174790590 20:53474030-53474052 ATTGGGGTACCTGAAAGCGATGG + Intronic
1174854646 20:54031859-54031881 ATTGGGGTGTCTGAAAGAGATGG + Intronic
1176987461 21:15454471-15454493 ATGGGGGTACCTGAAAGAGACGG - Intergenic
1177133341 21:17283280-17283302 ATAGGGGTACCTAAAAGAGATGG + Intergenic
1177280239 21:18972841-18972863 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1177387526 21:20427198-20427220 AAAGTGGTGCGTCAAAGATATGG - Intergenic
1177388267 21:20434485-20434507 GTTGGGGTACCTGAAAGAGATGG + Intergenic
1177563509 21:22787340-22787362 GATGAGGTGACTCCAAGAGAAGG + Intergenic
1177970903 21:27788309-27788331 ATTGGGGTACCTGAAAGAGAGGG + Intergenic
1179517694 21:41920038-41920060 AATGGGGTGCCTCAAGGAGCCGG + Intronic
1180210901 21:46295184-46295206 AATAGGGAGCCCCAAGGAGAGGG - Intronic
1180250217 21:46581061-46581083 ATTGGGGTACCTGGAAGAGATGG - Intergenic
1180458493 22:15535670-15535692 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1180844837 22:18975380-18975402 ATAGGGGTGCCTCTCAGAGAAGG - Intergenic
1181056629 22:20263332-20263354 ATAGGGGTGCCTCTCAGAGAAGG + Intronic
1182950445 22:34370351-34370373 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1183674148 22:39290524-39290546 AATGGGCTGCCCCAGAGCGAAGG - Intergenic
1203236154 22_KI270732v1_random:3238-3260 ATTGGGGTACCTGAAAGTGATGG + Intergenic
949250341 3:1976183-1976205 ATTGGAGTACCTGAAAGAGATGG + Intergenic
949472073 3:4406729-4406751 AATTGTGTCCCTCACAGAGAGGG + Intronic
949590179 3:5486207-5486229 AAAGAGGTACCTCAAAGTGACGG - Intergenic
949998600 3:9639033-9639055 CATAAGGTGTCTCAAAGAGATGG + Intergenic
950434862 3:12973382-12973404 TAGGGGAGGCCTCAAAGAGAAGG - Intronic
950619548 3:14193395-14193417 ATTGGTGTACCTCAAAGTGACGG - Intronic
950995640 3:17493542-17493564 ACTGGGGTACCTGAAAGAGATGG - Intronic
951258920 3:20483151-20483173 ATTGGTATGCCTGAAAGAGATGG + Intergenic
951469912 3:23045028-23045050 ATTGGGGTAGCTAAAAGAGAAGG + Intergenic
951996435 3:28735382-28735404 ACTGGGGTACCTGAAAGAGATGG - Intergenic
952673474 3:35999236-35999258 ACTGGGGTACATGAAAGAGATGG - Intergenic
952679278 3:36072904-36072926 ATTGGGGTACCTGAAAGAGACGG - Intergenic
953118700 3:40018100-40018122 AAGGAGGTGCCTCCAAAAGAGGG - Intronic
954444938 3:50541531-50541553 ACTGGGGAGCCCCAAAGAGGAGG + Intergenic
954857694 3:53660699-53660721 AATGGGGAGCATCAGAGGGATGG + Intronic
955119066 3:56037576-56037598 ATTGGGGTACCTGAAAGAGATGG + Intronic
955870977 3:63437869-63437891 ATTAGGATGCCTCAAAGAAAGGG + Intronic
955895560 3:63695764-63695786 AATGGTGTACCTGAAAGTGACGG + Intergenic
955904589 3:63793473-63793495 AATTTGCTGCCTCCAAGAGAAGG - Intergenic
956386346 3:68723997-68724019 ACTGGGCTACCTGAAAGAGATGG - Intergenic
956423364 3:69108114-69108136 AATGGAGTGCCTTAAAGAATAGG + Exonic
957098288 3:75798393-75798415 ATTGGGGTACCTGAAAGTGACGG - Intergenic
957307256 3:78473646-78473668 ATTGGTGTCCCTGAAAGAGAGGG + Intergenic
957352922 3:79049421-79049443 ATTGGTGTGCCTGAAAGTGATGG + Intronic
957667214 3:83248244-83248266 ACTGGTGTCCCTGAAAGAGATGG - Intergenic
957689971 3:83554864-83554886 ATTGGAGTACCTGAAAGAGACGG - Intergenic
957773479 3:84724504-84724526 AATAGTTTGCCTCAAAGAGTGGG + Intergenic
958188582 3:90155143-90155165 ACTGGGGTGACTCAATGTGAAGG + Intergenic
958253070 3:91292642-91292664 ATTGGTGTACCTCAAAGTGACGG + Intergenic
958411105 3:93816981-93817003 ACTGGGGTGGCTCAATGTGAAGG + Intergenic
958590762 3:96155553-96155575 ATTGGTGTACCTGAAAGAGATGG + Intergenic
958702973 3:97616805-97616827 ATTGGTGTACCTGAAAGAGATGG + Intronic
959258865 3:104049463-104049485 ATTGGAGTACCTGAAAGAGATGG + Intergenic
959455617 3:106557278-106557300 AATGGTGTGCCTTAAAGTGAAGG - Intergenic
959617788 3:108367730-108367752 ATTGGGGTCCCTGAAAGTGATGG + Intronic
960207345 3:114918603-114918625 AATGTGCTGCCTTGAAGAGAAGG - Intronic
960656067 3:120005300-120005322 AATGGTGTACCTGAAAGTGATGG + Intronic
960680001 3:120237932-120237954 ATTGGAGTACCTGAAAGAGATGG - Intronic
960681392 3:120250866-120250888 ACTGGGGTACCTGAAAGAGAGGG + Intronic
962335410 3:134526049-134526071 ATTGGTGTCCCTGAAAGAGATGG - Intronic
962831995 3:139151094-139151116 ATTGGTGTTCCTGAAAGAGATGG + Intronic
962880182 3:139569961-139569983 ATTGGTGTGCCTGAAAGTGACGG - Intronic
962984314 3:140520777-140520799 ATTGGGGTACCTGAAAGGGACGG - Intronic
963756151 3:149236741-149236763 ATTGGGGTACCTGAAAGAGATGG + Intergenic
963773253 3:149411153-149411175 AATAGGGTGGCCCAAGGAGAGGG + Intergenic
964053249 3:152421142-152421164 ATTGGTGTACCTCAAAGTGATGG + Intronic
964214490 3:154264097-154264119 ATTGGTGTACCTCAAAGTGACGG + Intergenic
964581743 3:158246995-158247017 ATTGGGGTACCTGAAAGTGAGGG - Intronic
964630867 3:158808830-158808852 ACTGGGATGCCTCAAAGACTGGG + Intronic
964910251 3:161772306-161772328 ACTGGGGTGCCTCAAAGGTGAGG - Intergenic
965288652 3:166848575-166848597 ATTGGGGTACCTAAAAGAGATGG - Intergenic
965324906 3:167291080-167291102 ATTGGTGTACCTCAAAGTGACGG + Intronic
965343006 3:167512976-167512998 ATTGGGGTACCTGCAAGAGACGG + Intronic
965382939 3:168012412-168012434 AATGGTGTACCTGAAAGTGATGG + Intronic
965988131 3:174781397-174781419 AATGGTGTACCTGAAAGTGATGG - Intronic
966290054 3:178344676-178344698 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
966320672 3:178698214-178698236 ATTGGTGTCCCTGAAAGAGATGG - Intronic
966652205 3:182314250-182314272 ATTGGAGTACCTGAAAGAGAAGG - Intergenic
968437008 4:598545-598567 AGTGGGGTACCTGAAAGAAATGG - Intergenic
968696526 4:2032526-2032548 ATTGGAGTACCTGAAAGAGACGG - Intronic
970170907 4:13289655-13289677 ACTGGTGTCCCTGAAAGAGAGGG - Intergenic
971590127 4:28456633-28456655 ATTGGGGTACCTGAAAGTGATGG - Intergenic
972061028 4:34873717-34873739 ATTGGGGTACCTGAAAGTGACGG + Intergenic
972219471 4:36937144-36937166 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
972861152 4:43170367-43170389 ATTGGAGTACCTGAAAGAGAGGG + Intergenic
972990039 4:44813538-44813560 ATTGGGGTACCTGAAAGAGATGG - Intergenic
973284666 4:48402395-48402417 ACTGGGGTACCTGAAAGAGATGG - Intronic
973584818 4:52379087-52379109 ACTGGAGTACCTGAAAGAGATGG + Intergenic
973629256 4:52803514-52803536 ATTGGGGTCCCTGAAAGTGATGG + Intergenic
973679761 4:53304445-53304467 ATTGGTGTACCTCAAAGTGATGG - Intronic
973901199 4:55473913-55473935 AATGGGGAGCTCCAAGGAGAGGG - Intronic
974181070 4:58385565-58385587 ACTGGAGTGCCTGAAAGAGGTGG - Intergenic
974249099 4:59361745-59361767 ATTGGTGTACCTGAAAGAGATGG - Intergenic
974307414 4:60158807-60158829 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
974339915 4:60602477-60602499 ATTGGGGTACCTGAGAGAGATGG - Intergenic
974499861 4:62685354-62685376 ATTGGGGTACCTGAAGGAGATGG + Intergenic
974663123 4:64920875-64920897 ATTGGTGTACCTAAAAGAGATGG + Intergenic
974814532 4:66988056-66988078 ATTGGAGTACCTGAAAGAGATGG - Intergenic
974842464 4:67313762-67313784 AATGCGGTGCCTTAAAGCCATGG + Intergenic
974937140 4:68421706-68421728 AATGGTGTACCTGAAAGTGACGG + Intergenic
975009998 4:69339205-69339227 AATTGGAAGGCTCAAAGAGAGGG - Intronic
975022370 4:69504625-69504647 ACTGGAGTGCCTGAAAGATATGG + Intronic
975178065 4:71310207-71310229 ATTGGGGTCCCTGAAAGTGATGG + Intronic
975240714 4:72055477-72055499 AATAGGAAGCCTCAAGGAGAGGG - Intronic
975348564 4:73321215-73321237 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
975403523 4:73964354-73964376 ATTGGTGTCCCTTAAAGAGATGG - Intergenic
975407646 4:74009750-74009772 AATAGGGAGGCCCAAAGAGAAGG - Intergenic
975620178 4:76289246-76289268 ACTGGGGTCCCTGAAAGTGATGG - Intronic
975702762 4:77082452-77082474 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
975764841 4:77656231-77656253 ATTGGTGTACCTCAAAGTGATGG + Intergenic
975899041 4:79128401-79128423 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
975977669 4:80117112-80117134 ATTGGGGTACCTGAAAGAAATGG + Intronic
975999720 4:80359435-80359457 ATTGGTGTCCCTGAAAGAGATGG - Intronic
976395585 4:84551560-84551582 AGTGGGGTACCTGAAAGAGATGG + Intergenic
977668876 4:99672333-99672355 ACTGGGATACCTGAAAGAGAGGG + Intergenic
977698196 4:99990793-99990815 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
977774572 4:100901954-100901976 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
977793088 4:101130274-101130296 ATTGGGGTACCTGAAAGTGATGG + Intronic
977815540 4:101410286-101410308 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
977992481 4:103461260-103461282 AATAGGGAGGCTCAAAGAGAGGG + Intergenic
978078760 4:104566937-104566959 ATTGGGGTACCTGAAAGTGATGG - Intergenic
978598021 4:110399829-110399851 AGTGGGCTTCCTCAAGGAGATGG - Intronic
978880400 4:113695551-113695573 AATGAATTGCCTCAAAGATAAGG - Intronic
979009863 4:115354240-115354262 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
979076408 4:116276182-116276204 ATTGGTGTCCCTAAAAGAGATGG + Intergenic
979576264 4:122295136-122295158 ATTGGGGTACCTGAAAGAGATGG + Intronic
979729449 4:124006382-124006404 AATAGGGAGGCCCAAAGAGAGGG + Intergenic
979742551 4:124169025-124169047 ATTGGGGTACCTGAAAGAGATGG + Intergenic
980015823 4:127649168-127649190 AATGGGTTGCCTTAAAGGAAAGG + Intronic
980169890 4:129276403-129276425 AAATGGTTGCCTCAGAGAGAGGG - Intergenic
980333479 4:131439671-131439693 TTTGGGGTACCTGAAAGAGATGG - Intergenic
981290526 4:143070224-143070246 ATTGGGGTACTTGAAAGAGATGG - Intergenic
981466412 4:145077307-145077329 ATTGGGGTCCCTGACAGAGAGGG + Intronic
981656053 4:147113475-147113497 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
982405923 4:155020393-155020415 ACTGGTGTACCTCAAAGTGACGG - Intergenic
982848303 4:160278078-160278100 ATTGGAGTACCTGAAAGAGATGG + Intergenic
982855360 4:160375446-160375468 AATGAGGTGCCCTAAAGAGCTGG - Intergenic
982879046 4:160687296-160687318 AATGATGTCCCTGAAAGAGAAGG + Intergenic
983169444 4:164519653-164519675 ACTGGAGTACCTGAAAGAGATGG - Intergenic
983331227 4:166332335-166332357 ATTGGGGTCCCTGAAAGTGACGG - Intergenic
983985153 4:174050710-174050732 ATTGGAGTACCTGAAAGAGATGG - Intergenic
984144307 4:176042953-176042975 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
984628424 4:182035000-182035022 ATTGGGGTACCTGAAAGGGATGG - Intergenic
985806258 5:2045668-2045690 TATGATGTGCCTCAAAGTGAAGG - Intergenic
986618064 5:9640184-9640206 AATAGGGAGGCTCAAGGAGAAGG + Intronic
986752809 5:10804728-10804750 AATAGGGAGGCTCAAGGAGAGGG - Intergenic
986753699 5:10813526-10813548 ATTGGGGTACCTGAAAGAGATGG + Intergenic
986903864 5:12469352-12469374 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
987260566 5:16197924-16197946 ATTGGGGTACCTGAAAGAAACGG + Intergenic
987279607 5:16399573-16399595 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
987887827 5:23833337-23833359 ATTGGTGTACCTGAAAGAGATGG + Intergenic
987974283 5:24992247-24992269 ACTGGTGTCCCTGAAAGAGAGGG + Intergenic
988110628 5:26814242-26814264 ATAGGGGTACCTGAAAGAGATGG + Intergenic
988416175 5:30949258-30949280 ATTGGTGTTCCTCAAAGTGACGG + Intergenic
988945072 5:36188848-36188870 ATTGGGGTACCTGAAAGTGACGG - Intergenic
989029516 5:37103982-37104004 ATTGGGGTACCTGAAAGAGATGG - Intergenic
989086648 5:37683958-37683980 ATTGGCGTCCCTGAAAGAGATGG - Intronic
989305592 5:39951736-39951758 ATTGGGGTACCTGAAAGGGATGG + Intergenic
990084112 5:51953252-51953274 ATTGGTGTACCTCAAAGTGACGG + Intergenic
990619954 5:57549032-57549054 ATTGGAGTACCTGAAAGAGACGG - Intergenic
990704889 5:58516682-58516704 ATTGGGGTACCTGAAAGAGATGG + Intergenic
990837962 5:60043320-60043342 ATTGGTGTACCTCAAAGTGATGG + Intronic
990843067 5:60105385-60105407 ATTGGTGTACCTCAAAGTGATGG + Intronic
991244150 5:64491012-64491034 ACTGGGGTCCTTGAAAGAGAGGG + Intergenic
991545941 5:67781532-67781554 ATTGGTGTACCTCAAAGTGAAGG + Intergenic
992031507 5:72726076-72726098 AGTGGGCTTCCTCAAGGAGATGG + Intergenic
992287438 5:75249647-75249669 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
992571857 5:78066691-78066713 ATTGGGGTACCTAAAAGAGATGG + Intronic
993311618 5:86339257-86339279 ATTGGTGTCCCTTAAAGAGATGG + Intergenic
993375794 5:87148400-87148422 ATTGGGGTAACTTAAAGAGATGG - Intergenic
993420836 5:87699496-87699518 ATTGGGGTACCTGAAAGAGATGG - Intergenic
993494137 5:88588061-88588083 ATTGGGGTACCTGAAAGAGATGG + Intergenic
993747541 5:91619789-91619811 AATGGGGAGCATCAAAAAGTGGG + Intergenic
993837505 5:92833937-92833959 ACTGGGGTACCTGAAAGAGACGG - Intergenic
994227718 5:97273031-97273053 ACTGGTGTCCCTGAAAGAGATGG - Intergenic
994492303 5:100462717-100462739 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
994826412 5:104718600-104718622 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
994973693 5:106775598-106775620 ATTGGTGTACCTCAAAGTGAAGG - Intergenic
995052378 5:107720756-107720778 ATTGGGGTATCTGAAAGAGATGG + Intergenic
995188123 5:109292107-109292129 ATTGGTGTACCTGAAAGAGATGG + Intergenic
995255751 5:110044596-110044618 ATTAGGGTACCTAAAAGAGATGG - Intergenic
995660587 5:114478422-114478444 ATTGGGGTACCTGAAAGAGATGG + Intronic
995692272 5:114840623-114840645 AGTGGGGTACCTCAAGGAAATGG + Intergenic
995749978 5:115443408-115443430 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
995785756 5:115825778-115825800 ACTGGGGTCCCTGAAAGTGATGG - Intergenic
995810996 5:116107295-116107317 ATTGGTGTACCTCAAAGTGATGG - Intronic
995956152 5:117778879-117778901 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
996005990 5:118421071-118421093 ATTGGGGTACCTGAAAGAGATGG + Intergenic
996046076 5:118874736-118874758 ATTGGGGTACCTGAAAGAAACGG + Intronic
996182001 5:120431014-120431036 GATGGGGTACCTGAAAGAGATGG - Intergenic
996195759 5:120605164-120605186 ATTGGGATTCCTGAAAGAGATGG - Intronic
996295479 5:121909876-121909898 AATACTCTGCCTCAAAGAGATGG + Intergenic
996420292 5:123255540-123255562 ATTGGTGTACCTGAAAGAGACGG - Intergenic
996451480 5:123630262-123630284 ACTGGTGTGCCTGAAAGAAATGG + Intergenic
996675853 5:126173452-126173474 ACTGGAGTACCTGAAAGAGAAGG + Intergenic
996829858 5:127728067-127728089 ATTGGGGTACCTGAAAGAGACGG + Intergenic
996901969 5:128552926-128552948 ACTGGTGTACCTAAAAGAGATGG + Intronic
997084796 5:130784982-130785004 AATGGTGTACCTGAAAGTGACGG + Intergenic
997136916 5:131336589-131336611 AATGGTGTACCTGAAAGTGACGG - Intronic
998275800 5:140752317-140752339 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
998577553 5:143333161-143333183 AGTGGGCTTCCTCAAGGAGATGG + Intronic
998755819 5:145378402-145378424 ACTGGTGTGTCTGAAAGAGATGG - Intergenic
999541871 5:152583306-152583328 ATTGGTGTTCCTGAAAGAGAGGG - Intergenic
1000462637 5:161542041-161542063 AATAGGGAACCTCACAGAGAGGG + Intronic
1000548220 5:162627262-162627284 ATTGGGGTCCCTGAAAGTGATGG + Intergenic
1000587765 5:163121452-163121474 AATGGTGTACCTGAAAGTGACGG - Intergenic
1000660676 5:163934349-163934371 ACTGGAGTACCTGAAAGAGACGG + Intergenic
1003866238 6:10365573-10365595 AATGGGCTTCCTCAGGGAGATGG - Intergenic
1004555197 6:16690246-16690268 ATTGGGTAGCCTCAAAGAGGAGG + Intronic
1004832912 6:19496533-19496555 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
1004989569 6:21122319-21122341 AATGTGGTACTTCAAAAAGAAGG - Intronic
1006048712 6:31322554-31322576 ATTGGTGTACCTGAAAGAGATGG + Intronic
1006198195 6:32261697-32261719 ATTGGTGTACCTCAAAGTGACGG - Intergenic
1006240963 6:32678676-32678698 ATTGGGGTGCCTGAAAGAGACGG - Intergenic
1006250838 6:32782419-32782441 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1007570449 6:42886386-42886408 AGTGGGCTTCCTCAAGGAGATGG + Exonic
1007988242 6:46229388-46229410 ATTGGTGTGCCTGAAAGTGACGG - Intronic
1008082795 6:47211254-47211276 ATTGGGGTACCTGAAAGAGAGGG + Intergenic
1008244097 6:49149600-49149622 ATTGGAGTACCTGAAAGAGATGG - Intergenic
1008298627 6:49807028-49807050 ATTGGAGTACCTGAAAGAGACGG + Intergenic
1008576200 6:52862330-52862352 ATTGGTGTGCCTGAAAGTGACGG + Intronic
1008688220 6:53947327-53947349 ATTGGTGTCCCTGAAAGAGATGG + Intronic
1009279091 6:61723846-61723868 ATTGGGGTACCTGAAGGAGAGGG + Intronic
1010411893 6:75570123-75570145 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1010526331 6:76904824-76904846 AATGGTGTACCTGAAAGTGACGG - Intergenic
1010821180 6:80417949-80417971 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1011159180 6:84369156-84369178 ACTGGGGTACCTGAAAGTGACGG - Intergenic
1011167822 6:84469479-84469501 TATGGGCTTCCTCAAAGGGAGGG + Intergenic
1011377496 6:86705734-86705756 ATTGAGGTACCTGAAAGAGATGG - Intergenic
1011407777 6:87033851-87033873 ACTGGGGTGCCTTTAAGAAATGG + Intergenic
1012315206 6:97776325-97776347 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1012572023 6:100741499-100741521 ATTGGGGTACCTAAACGAGATGG - Intronic
1012653999 6:101792826-101792848 ATTGGTGTACCTGAAAGAGACGG - Intronic
1012669004 6:102016649-102016671 AATGGTGTCCCTCAAAGAGACGG + Intronic
1013080807 6:106810619-106810641 ACTGGTGTCCCTGAAAGAGATGG + Intergenic
1013353502 6:109327231-109327253 AGTGGGCTTCCTCAAGGAGATGG - Intergenic
1013947719 6:115742512-115742534 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
1014034882 6:116755001-116755023 AATAGGGAGGCCCAAAGAGAGGG - Intronic
1014064812 6:117112068-117112090 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1014071185 6:117183203-117183225 ATTGGGGTACCTGAAAGTGATGG + Intergenic
1014076942 6:117246138-117246160 ATTGGGGTACCTGAAAGTGATGG + Intergenic
1014288486 6:119530671-119530693 AATGGTGTTTCCCAAAGAGAGGG - Intergenic
1014564234 6:122929182-122929204 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1015679011 6:135782724-135782746 ACTGGTGTCCCTGAAAGAGATGG + Intergenic
1016569485 6:145496444-145496466 ATTGGTGTACCTGAAAGAGATGG - Intergenic
1017305506 6:152913929-152913951 ACTGGTGTCCCTGAAAGAGAAGG - Intergenic
1018106350 6:160490840-160490862 TATGAGGTGCCAGAAAGAGAAGG - Intergenic
1018578405 6:165284347-165284369 AGTGGGGTACTTGAAAGAGATGG + Intronic
1018797504 6:167198505-167198527 ATTGGGGTCCCTGAAAGTGATGG - Intergenic
1019204816 6:170351320-170351342 ATTGGGGTACCTGAAAGAGATGG + Intronic
1019263548 7:97594-97616 AATAGGGAGGCTCAAGGAGAGGG + Intergenic
1020599081 7:10249359-10249381 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1020633639 7:10671043-10671065 ATTGGAGTACCTGAAAGAGATGG - Intergenic
1021047537 7:15941615-15941637 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1021071490 7:16247392-16247414 AATAGGGAATCTCAAAGAGAAGG + Intronic
1021390768 7:20089996-20090018 ATTGGTGTACCTGAAAGAGATGG + Intergenic
1021624146 7:22576169-22576191 AGTGGAGTGTCACAAAGAGAAGG + Intronic
1021915324 7:25425877-25425899 AAAGAGGTGCCTTAAAGAGAAGG + Intergenic
1021916878 7:25442959-25442981 ACTGGGGTACCTGAAAGAGATGG - Intergenic
1021967341 7:25933613-25933635 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1024385497 7:48747386-48747408 ACTGGTGTCCCTGAAAGAGATGG - Intergenic
1024632247 7:51259486-51259508 AGTGGGTTTCCTCAAGGAGATGG - Intronic
1024677362 7:51648822-51648844 AATGGGGTGTCTTGAAGAAAGGG - Intergenic
1024795178 7:53011618-53011640 ACTGGAGTACCTAAAAGAGATGG - Intergenic
1027627343 7:80562797-80562819 ATTGGTGTACCTGAAAGAGATGG - Intronic
1027929785 7:84517887-84517909 ATTGGTGTACCTCAAAGTGATGG + Intergenic
1028077257 7:86532224-86532246 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1028083175 7:86601963-86601985 ATTGGTGTACCTGAAAGAGATGG + Intergenic
1028139915 7:87262442-87262464 ACTGGTGTACCTCAAAGTGATGG - Intergenic
1028313809 7:89374445-89374467 ATTGGGCTGTCTCAAAGAAAGGG + Intergenic
1028372357 7:90107612-90107634 AATAGGATGGCCCAAAGAGAGGG + Intergenic
1028423167 7:90656150-90656172 AATGGAGTCCCTAAAAGAAAAGG - Intronic
1028518193 7:91700410-91700432 AGTGGAGTACCTGAAAGAGATGG + Intronic
1028686089 7:93590362-93590384 ATTGGGGTACCTGAAAGCGATGG - Intergenic
1028730767 7:94146160-94146182 TGTGGGGTGTCTCAGAGAGAAGG + Intergenic
1028780409 7:94729029-94729051 GATGGGGTGAAACAAAGAGATGG + Intergenic
1029850037 7:103452470-103452492 ATTGGTGTACCTGAAAGAGAAGG - Intergenic
1029850421 7:103456136-103456158 AATGGTGTACCTAAAAGTGATGG - Intergenic
1030256677 7:107517369-107517391 ATTGGAGTACCTGAAAGAGATGG + Intronic
1030696379 7:112589415-112589437 ATTGGGGTACCTGAAAGAGACGG + Intergenic
1031096996 7:117432175-117432197 ATTGGGGTACCTCAAAGACATGG - Intergenic
1031669388 7:124524284-124524306 ATTGGTGTTCCTAAAAGAGAGGG - Intergenic
1032374904 7:131403686-131403708 AATAGGGAGGCCCAAAGAGAGGG + Intronic
1033136773 7:138791809-138791831 AATGGTATTCTTCAAAGAGAAGG + Intronic
1033893352 7:146042337-146042359 AATGGTGTACCTGAAAGTGATGG - Intergenic
1034379669 7:150679866-150679888 AATGGTGTACCTGAAAGTGACGG + Intergenic
1034549105 7:151809078-151809100 TATGGGGTGACTCAGAGGGAAGG + Intronic
1034583216 7:152065071-152065093 ATTGGTGTGCCTGAAAGTGACGG - Intronic
1034893489 7:154860197-154860219 GAGGGGGTGCCTCAGGGAGAAGG - Intronic
1036706314 8:11049554-11049576 ACTGGGGAGCCCCAGAGAGAGGG + Intronic
1038409612 8:27347971-27347993 AATGGGCTGCTTCAGAGAGAAGG - Intronic
1038732338 8:30138747-30138769 AAAGAGGTACCTGAAAGAGAAGG + Exonic
1039025234 8:33251660-33251682 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1039097424 8:33901664-33901686 AATGGTGTACCTGAAAGCGACGG - Intergenic
1039154223 8:34536930-34536952 ACTGGTGTGCCTGAGAGAGATGG + Intergenic
1039559940 8:38504768-38504790 AATGGGGGGGGCCAAAGAGAAGG + Intergenic
1039676632 8:39675240-39675262 ATTGGTGTGCCTGAAAGTGATGG - Intronic
1040019263 8:42725600-42725622 AGTGGGCTTCCTCAAGGAGATGG - Intronic
1040539348 8:48338548-48338570 ATTGGTGTACCTCAAAGTGACGG - Intergenic
1040842021 8:51794188-51794210 ATTGGGGTACTTGAAAGAGATGG + Intronic
1041130733 8:54697060-54697082 AGTGGGCTTCCTCAAGGAGATGG + Intergenic
1041146751 8:54884144-54884166 AAAGGAGTGCCTCAAATAAATGG - Intergenic
1041404647 8:57484566-57484588 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1041482138 8:58333247-58333269 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1041623805 8:60002027-60002049 ATTAGGGTACCTAAAAGAGATGG + Intergenic
1041711897 8:60901986-60902008 AATAGGGTGCCTCTCAGTGAGGG - Intergenic
1041972458 8:63759687-63759709 ATTGAGGTACCTAAAAGAGATGG - Intergenic
1042335375 8:67624732-67624754 AATGAGATGCCCCATAGAGATGG - Intronic
1042489679 8:69382685-69382707 ATTGGGGTACCTGAAAAAGAAGG + Intergenic
1042981962 8:74539935-74539957 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1043025101 8:75057216-75057238 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1043304831 8:78781836-78781858 ATTGGGGTACGTGAAAGAGATGG - Intronic
1043324730 8:79035438-79035460 ATTGCGGTACCTGAAAGAGATGG + Intergenic
1044117060 8:88348850-88348872 ACTGGGGTACCTGAAATAGATGG - Intergenic
1044313968 8:90727944-90727966 ATTGGTGTCCCTGAAAGAGATGG + Intronic
1044315686 8:90748117-90748139 ATTGGAGTACCTGAAAGAGATGG - Intronic
1044447451 8:92295735-92295757 ACTGGGGTACCTGAAAGAGATGG - Intergenic
1044450835 8:92334493-92334515 ATTGGAGTACCTGAAAGAGAGGG - Intergenic
1044793669 8:95873669-95873691 ATTGGTGTCCCTTAAAGAGATGG + Intergenic
1045071022 8:98505008-98505030 ATTGGTGTGCCTGAAAGTGATGG - Intronic
1045595400 8:103649558-103649580 ATTAGGGTACCTGAAAGAGATGG - Intronic
1045841920 8:106590890-106590912 AGTGGGCTTCCTCAAGGAGATGG - Intronic
1046256318 8:111700773-111700795 AGGTCGGTGCCTCAAAGAGAAGG + Intergenic
1046874169 8:119235323-119235345 ATTGGGGTACCTGAAAGTGATGG + Intronic
1048429160 8:134352861-134352883 ATTGGGGTACCCGAAAGAGATGG - Intergenic
1048429295 8:134354012-134354034 ATTGGGGCACCTGAAAGAGATGG + Intergenic
1049506875 8:143007201-143007223 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1049744771 8:144258604-144258626 AATGGGGGGCCTCTAGCAGATGG + Intronic
1050441081 9:5664729-5664751 ACTGGGGTACCTGAAAGAGATGG - Intronic
1050597412 9:7217482-7217504 ACTGGTGTGCCTGAAAGTGACGG + Intergenic
1052176614 9:25471005-25471027 ATTGAGGTACCTGAAAGAGACGG - Intergenic
1052199892 9:25765120-25765142 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1052217462 9:25984077-25984099 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1052515177 9:29471362-29471384 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1052534312 9:29727905-29727927 ATTGGTGTACCTAAAAGAGATGG + Intergenic
1052694232 9:31855292-31855314 ATTGGTGTCCCTGAAAGAGAGGG + Intergenic
1052717099 9:32130011-32130033 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1053041778 9:34879723-34879745 ACTGGTGTACCTGAAAGAGACGG + Intergenic
1055168403 9:73224630-73224652 ACTGGTGTCCCTGAAAGAGATGG + Intergenic
1055367980 9:75566208-75566230 ATTGGTGTCCCTGAAAGAGAGGG - Intergenic
1055533812 9:77215687-77215709 GACGGGGTGCCCAAAAGAGAGGG + Intronic
1055547554 9:77395285-77395307 AATAGGGAGGCTCAAGGAGAGGG + Intronic
1057752799 9:97805551-97805573 AGTGGGATGCCTACAAGAGAGGG - Intergenic
1058265943 9:102898954-102898976 ACTGGGGTCCCTGAAAGTGATGG + Intergenic
1058530209 9:105899033-105899055 ACTGGGGTACCTGAAAGAGATGG - Intergenic
1058849910 9:109001496-109001518 AATGGAGTGCTTCTAAGAGTAGG + Intronic
1059509850 9:114835044-114835066 ATTGGCGTACCTGAAAGAGATGG - Intergenic
1060320954 9:122560944-122560966 ATTGGAGTACCTGAAAGAGATGG - Intergenic
1060799260 9:126533275-126533297 AATGAGGTGCCTCTGAGAGCCGG - Intergenic
1061480842 9:130897138-130897160 AGTGGGGTGCCTGTAGGAGAGGG - Intergenic
1186563691 X:10639537-10639559 ATTGGTGTGCCTGAAAGTGACGG + Intronic
1186913244 X:14192423-14192445 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1187689385 X:21849566-21849588 AATGTTATGCCTCACAGAGAGGG - Intronic
1187818299 X:23257088-23257110 ATTGGGGTACCTGAAGGAGACGG + Intergenic
1188042021 X:25379275-25379297 GATGGTTAGCCTCAAAGAGATGG + Intergenic
1188851431 X:35137282-35137304 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1189557952 X:42164844-42164866 ATTGGTGTTCCTGAAAGAGATGG - Intergenic
1189855106 X:45215903-45215925 ATTGGTGTACCTGAAAGAGATGG + Intergenic
1189897930 X:45674720-45674742 ATTGGTGTCCCTGAAAGAGAGGG + Intergenic
1190139029 X:47825015-47825037 AAAGGGGTTCCTCAGGGAGAAGG + Intergenic
1191034523 X:56009984-56010006 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1191093791 X:56653661-56653683 ATTGGGGTACTTGAAAGAGATGG - Intergenic
1191187714 X:57630776-57630798 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1191610738 X:63109685-63109707 ACTGGTGTCCCTAAAAGAGATGG + Intergenic
1191642593 X:63443506-63443528 AATGGTGTACCTGAAAGAGATGG + Intergenic
1191651115 X:63538552-63538574 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1191733610 X:64365133-64365155 ATTGGTGTGCCTGAAAGTGACGG + Intronic
1192296995 X:69860844-69860866 ATTGGTGTCCCTGAAAGAGATGG - Intronic
1192879246 X:75265298-75265320 ATTGGTGTACCTCAAAGTGATGG - Intergenic
1192897738 X:75461308-75461330 ATTGGGGTACCTGAAAGAGATGG + Intronic
1192906717 X:75559777-75559799 ATTGGTGTACCTCAAAGTGATGG - Intergenic
1192984415 X:76381244-76381266 ACTGGTGTGCCTGAAAGTGATGG + Intergenic
1193113604 X:77754951-77754973 ATTGGGGTCCCTGAAAGTGATGG - Intronic
1193217110 X:78876388-78876410 ATTGGGGTACCTGAAAGAGGTGG + Intergenic
1193270817 X:79529029-79529051 ATTGAGGTACCTCAAAGAGATGG - Intergenic
1193478544 X:81997242-81997264 ATTGGGGTACCTGAAAGAGACGG + Intergenic
1193595279 X:83438157-83438179 ATTGGGGTACCTGAAAGAGATGG - Intergenic
1193647510 X:84087774-84087796 ATTGGGGTACCGGAAAGAGATGG - Intronic
1193687314 X:84592975-84592997 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1193758654 X:85439418-85439440 ATTGTGGTACCTGAAAGAGATGG - Intergenic
1193762722 X:85487888-85487910 GTTGGGGTACCTGAAAGAGATGG - Intergenic
1193844683 X:86454393-86454415 ATTGGGGTACCTGAAAGAGATGG - Intronic
1193897414 X:87130113-87130135 ATTGGTGTGCCTGAAAGTGATGG + Intergenic
1194016380 X:88626169-88626191 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1194068786 X:89294012-89294034 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
1194193679 X:90866498-90866520 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1194263846 X:91732405-91732427 ATTTGGGTACCTGAAAGAGAGGG - Intergenic
1194286943 X:92021544-92021566 ATTGGAGTACCTGAAAGAGACGG + Intronic
1194444816 X:93974772-93974794 ATAGGGGTACCTGAAAGAGATGG - Intergenic
1194465799 X:94234218-94234240 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1194506273 X:94737802-94737824 TTTGGGGTACCTGAAAGAGATGG - Intergenic
1194550711 X:95295298-95295320 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1194658251 X:96599150-96599172 ATTGGTGTACCTCAAAGTGATGG + Intergenic
1194664024 X:96657221-96657243 GATGGTGTTCCTGAAAGAGATGG + Intergenic
1194830486 X:98617857-98617879 ATTGGTGTACCTGAAAGAGATGG - Intergenic
1195127282 X:101821212-101821234 ATTGGGGTCCCTGAAAGTGATGG - Intergenic
1195140261 X:101951725-101951747 ATTGGGGTCCCTGAAAGTGACGG + Intergenic
1195142523 X:101977156-101977178 ATTGGAGTCCCTGAAAGAGAGGG - Intergenic
1195172766 X:102285200-102285222 ATTGGTGTCCCACAAAGAGAGGG - Intergenic
1195186100 X:102401895-102401917 ATTGGTGTCCCACAAAGAGAGGG + Intronic
1195224800 X:102781734-102781756 ATTGGTGTGCCTGAAAGTGACGG - Intergenic
1195391720 X:104368989-104369011 AAAGGGGTGCCTCATAGAGTTGG + Intergenic
1195533167 X:105981131-105981153 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1196381928 X:115099747-115099769 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1196546432 X:116969433-116969455 ACTGGGGTACCTGAAAGCGATGG - Intergenic
1196584235 X:117410654-117410676 ATTGGTGTTCCTGAAAGAGATGG + Intergenic
1196853701 X:119962985-119963007 ATTGGGGTACCTGAAAGTGATGG + Intergenic
1197023061 X:121715050-121715072 ATTGGGGTACCCAAAAGAGATGG - Intergenic
1197036385 X:121878876-121878898 AATGGTGTACCTGAAAGTGATGG + Intergenic
1197428219 X:126324447-126324469 ATTGATGTACCTCAAAGAGATGG + Intergenic
1197482630 X:127005879-127005901 ACTGGAGTCCCTGAAAGAGATGG + Intergenic
1197489681 X:127101892-127101914 ATTGGGGTACCTGAAAGAGATGG + Intergenic
1197570888 X:128149141-128149163 ATTGGAGTACCTGAAAGAGACGG + Intergenic
1197676780 X:129338428-129338450 ATTGGGGTACCTGAAAGCGATGG + Intergenic
1197988116 X:132289093-132289115 AATGGTGTACCTGAAAGTGACGG - Intergenic
1198062759 X:133063252-133063274 ATTGGGGTACCTGAAAGTGATGG + Intronic
1198603905 X:138315171-138315193 AATGGAATACGTCAAAGAGATGG + Intergenic
1199120635 X:144049222-144049244 ACTGTTGTGCCTGAAAGAGATGG + Intergenic
1199137157 X:144266638-144266660 ATTGGTATGCCTGAAAGAGATGG + Intergenic
1199478862 X:148275246-148275268 ATTGGTGTGCCTGAAAGAGATGG + Intergenic
1199497174 X:148465350-148465372 AGTGGGCTTCCTCAAGGAGATGG + Intergenic
1199564295 X:149198286-149198308 GATTGGGTACCTGAAAGAGATGG - Intergenic
1199578268 X:149335385-149335407 ATTGGTGTGCCTAAAAGTGACGG + Intergenic
1200321459 X:155194612-155194634 ATTGGGGTACCTGAAACAGAGGG - Intergenic
1200336401 X:155355225-155355247 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1200350069 X:155486002-155486024 ATTGGTGTCCCTGAAAGAGATGG - Intergenic
1200365259 X:155656215-155656237 ATTGGGGTCCCTGAAAGTGATGG - Intronic
1200540287 Y:4448881-4448903 ATTGGAGTACCTGAAAGAGATGG + Intergenic
1200604486 Y:5246104-5246126 ATTGGAGTACCTGAAAGAGACGG + Intronic
1200722931 Y:6628167-6628189 ATTGGTGTGCCTGAAAGTGACGG + Intergenic
1201229212 Y:11846853-11846875 ATTGGTGTCCCTGAAAGAGATGG + Intergenic
1201563364 Y:15341821-15341843 ATTGGGGTACCTGAAAGTGAGGG - Intergenic
1201582993 Y:15530884-15530906 AATGGTGTACCTCAAAGTGATGG - Intergenic
1201919430 Y:19218572-19218594 ATTGGTGTGCCTGAAAGTGATGG - Intergenic
1202253837 Y:22900615-22900637 ATTGGTGTACCTGAAAGAGATGG - Intergenic
1202406827 Y:24534364-24534386 ATTGGTGTACCTGAAAGAGATGG - Intergenic
1202463954 Y:25135717-25135739 ATTGGTGTACCTGAAAGAGATGG + Intergenic