ID: 1124139542

View in Genome Browser
Species Human (GRCh38)
Location 15:27065065-27065087
Sequence CAATGGGGTGCCTCAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124139542_1124139551 28 Left 1124139542 15:27065065-27065087 CCTCTCTTTGAGGCACCCCATTG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1124139551 15:27065116-27065138 CGTTGGCTGCCACTCTCAATGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1124139542_1124139546 -7 Left 1124139542 15:27065065-27065087 CCTCTCTTTGAGGCACCCCATTG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1124139546 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 173
1124139542_1124139552 29 Left 1124139542 15:27065065-27065087 CCTCTCTTTGAGGCACCCCATTG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1124139552 15:27065117-27065139 GTTGGCTGCCACTCTCAATGGGG 0: 1
1: 0
2: 2
3: 4
4: 92
1124139542_1124139550 27 Left 1124139542 15:27065065-27065087 CCTCTCTTTGAGGCACCCCATTG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139542_1124139549 11 Left 1124139542 15:27065065-27065087 CCTCTCTTTGAGGCACCCCATTG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1124139549 15:27065099-27065121 GCTGGTGACTAGTCTCACGTTGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124139542 Original CRISPR CAATGGGGTGCCTCAAAGAG AGG (reversed) Intronic
900104277 1:975666-975688 CACAGGGTGGCCTCAAAGAGGGG - Exonic
900692087 1:3987156-3987178 CAACGGAGTGCTTCAAAGGGAGG - Intergenic
901765915 1:11500017-11500039 CAGCGGGGTGGCCCAAAGAGAGG - Intronic
906276043 1:44516846-44516868 CAGTGTGGAGCTTCAAAGAGAGG - Intronic
908818688 1:68059741-68059763 CATTGGTGTCCCTGAAAGAGAGG + Intergenic
909014729 1:70369736-70369758 CAATGGGGTCCCACACAGATGGG - Intronic
910064739 1:83139974-83139996 CATTGGCGTCCCTGAAAGAGAGG - Intergenic
910166710 1:84336164-84336186 CACTGGTGTCCCTGAAAGAGAGG - Intronic
911235634 1:95409215-95409237 CAATTGGGGGACTCAAGGAGGGG - Intergenic
912314697 1:108657183-108657205 GAATGGGGAGCCTTAAGGAGGGG - Intronic
917250997 1:173060555-173060577 CAATGTGGTGTGTCAGAGAGGGG - Intergenic
919940692 1:202283968-202283990 CAATGGGCTACCTCAGAGATGGG + Intronic
920901506 1:210114182-210114204 CAGTGGGGTCCCTCACAGATGGG + Intronic
1063160558 10:3415367-3415389 CAATGGGATTCCACAATGAGAGG + Intergenic
1064913201 10:20426331-20426353 CAATGGCATTCCTCAAAGAGAGG - Intergenic
1065504069 10:26411581-26411603 TAATGGGGAGCCACAAAGAGTGG - Intergenic
1065546660 10:26828163-26828185 CAATAGGGAGGCCCAAAGAGAGG + Intronic
1069919038 10:71805334-71805356 CAATGGGGTACCTGAAAATGGGG - Intronic
1070486629 10:76938140-76938162 CAAAGGAGAGCCTCAGAGAGAGG - Intronic
1070842421 10:79496459-79496481 AAAAAGGCTGCCTCAAAGAGAGG + Intergenic
1072304035 10:94089305-94089327 AAATTGGGTACCTCAGAGAGCGG - Intronic
1072930287 10:99656505-99656527 CAATGGGGTGCCTGAAAGACAGG + Intergenic
1073127498 10:101160720-101160742 AAATAGGGTGCCTAAGAGAGGGG + Intergenic
1073150373 10:101307318-101307340 GAAAGGTGTGCCTTAAAGAGGGG + Intergenic
1073816449 10:107213119-107213141 CATTGGTGTCCCTGAAAGAGAGG - Intergenic
1074201494 10:111240098-111240120 GAATGGGGAGGCCCAAAGAGAGG + Intergenic
1077320993 11:1941942-1941964 CTCTCGGGTGCCACAAAGAGGGG - Intergenic
1078694623 11:13619016-13619038 CATTGGTGTCCCTGAAAGAGAGG - Intergenic
1079241938 11:18727678-18727700 CCATGGGGAGCCTCAAGGACAGG - Intergenic
1080600277 11:33815990-33816012 GAATGGGGTGTGTCAGAGAGCGG - Intergenic
1085731529 11:79003180-79003202 CACTGGCATCCCTCAAAGAGAGG + Intronic
1085844427 11:80049356-80049378 CAATGGAGAGCCACAAAAAGAGG - Intergenic
1087314700 11:96590264-96590286 CAGTGGGGTCCCACAAAGATGGG - Intergenic
1089890761 11:121878613-121878635 CAGTGGGGTGCCTCAGCCAGAGG + Intergenic
1098482958 12:70987000-70987022 CACTGGGTTCCCTCAAAAAGGGG + Intergenic
1098629082 12:72705690-72705712 CAGTGGGGTCCCACAAAGATGGG - Intergenic
1106759290 13:32851857-32851879 GAATGGAGTGCTTCAGAGAGAGG + Intergenic
1107617161 13:42181659-42181681 GAATGGGGTGGCTTAAACAGAGG - Intronic
1108282043 13:48870494-48870516 CAGTGGGGTGCCACACAGATGGG + Intergenic
1108814148 13:54269197-54269219 CAGTGGGGTGCCACACAGATGGG - Intergenic
1115890679 14:38024691-38024713 CATTGGTGTCCCTGAAAGAGAGG + Intronic
1121239090 14:92415099-92415121 CATGGAGGTGCATCAAAGAGTGG - Intronic
1124139542 15:27065065-27065087 CAATGGGGTGCCTCAAAGAGAGG - Intronic
1124719257 15:32097770-32097792 CAAGGGGGTTCCTGCAAGAGAGG - Intronic
1125239674 15:37559402-37559424 CATTGGAGTCCCTGAAAGAGAGG + Intergenic
1126413822 15:48397718-48397740 CAATGTGGTGGCTCAGAAAGTGG - Intergenic
1128218664 15:65952328-65952350 CAGTGGGGAGCCACAGAGAGGGG + Intronic
1131815036 15:96213268-96213290 CACTGGTGTGCCTCAAAGTATGG + Intergenic
1131872290 15:96775411-96775433 CAAGGGGGTGCGGCAGAGAGAGG - Intergenic
1135025390 16:18995500-18995522 CAATGGGGTCCCACACAGATGGG + Intronic
1135419081 16:22292669-22292691 TAAAGGGATGCCTCCAAGAGTGG + Intergenic
1141940689 16:87274111-87274133 CTATGTGGTGCCCCAAAGTGGGG + Intronic
1144060116 17:11575607-11575629 GAATGTGGGGCCTCCAAGAGAGG - Intergenic
1144120970 17:12151987-12152009 GATTGGGGTACCTAAAAGAGAGG + Intergenic
1147567385 17:41546113-41546135 CAATGGAGGGCCTCACGGAGGGG + Intergenic
1149120293 17:53155422-53155444 CAATGGGGTGTGTCAGAGGGTGG - Intergenic
1149220528 17:54411799-54411821 CAGTGGGGTCCCTCACAGATGGG - Intergenic
1153858207 18:9172339-9172361 GATTGGGGTGCCTGAAAGACAGG - Intronic
1157583775 18:48788315-48788337 AATTGGGGTGCCCCAAGGAGGGG + Intronic
1160600165 18:80006429-80006451 CAGTGGGGCGCCTCAGAGAGAGG + Intronic
1160730494 19:639780-639802 CAATGGGGTGCCTCGGGGCGGGG - Intergenic
1161453953 19:4361141-4361163 CCATGGGGTGGCTCAGAGATAGG - Exonic
1161861673 19:6802519-6802541 TCATGTGATGCCTCAAAGAGGGG - Intronic
1163736804 19:18986520-18986542 CAATGGGATGCCTCAAGGACTGG + Intergenic
1164479197 19:28598458-28598480 CAATGGTGTCCCTCATAGGGTGG - Intergenic
1165897631 19:39152765-39152787 CAATGGGATGCCTGAAACTGTGG - Intronic
926583582 2:14660314-14660336 GAATAGGGAGCCTCAAAGAGAGG + Intergenic
926979143 2:18548585-18548607 CAATGGGGAGGCCCAAGGAGAGG - Intergenic
926987182 2:18637868-18637890 GATTGGGGTACCTGAAAGAGAGG - Intergenic
928323910 2:30304888-30304910 CTATTGGGGGCCTCAAAGATTGG - Intronic
930839383 2:55828071-55828093 CATTGGTGTCCCTGAAAGAGAGG + Intergenic
933066536 2:77805686-77805708 CAGTGGGGTGCCTCAGCAAGAGG + Intergenic
933691377 2:85181791-85181813 GAGTGAGGTGCCTCAAAGAGGGG - Intronic
935581590 2:104760480-104760502 CAATGGGCTCCCTCAAGGAGAGG + Intergenic
937118348 2:119425465-119425487 CAAGGGGGTGAATCACAGAGTGG - Intergenic
937131712 2:119518820-119518842 CAAGGGGGTGCCAGGAAGAGAGG + Intronic
939089195 2:137758771-137758793 CATTGGTGTCCCTGAAAGAGAGG + Intergenic
939547842 2:143575494-143575516 CCATGGGGTGCAGGAAAGAGAGG + Intronic
940524367 2:154793233-154793255 TATTGGATTGCCTCAAAGAGAGG - Intronic
943016163 2:182512973-182512995 CAATGGCATCCCTGAAAGAGAGG + Intronic
944134944 2:196388942-196388964 CACTGGGGTGCCCCTCAGAGTGG - Intronic
944387469 2:199181708-199181730 CAGTGGGGTCCCACAAAGATGGG - Intergenic
945346990 2:208730509-208730531 CAATGGTGTCTCTGAAAGAGAGG - Intronic
945376124 2:209080414-209080436 CAATGGGGTCCCACACAGATGGG - Intergenic
945858142 2:215091931-215091953 CAGTGGGGTCCCTCACAGACGGG - Intronic
948390707 2:237609298-237609320 CACTGGGGTCCCGCAAAGATGGG - Intergenic
1168839285 20:898886-898908 CAGTGGGGTCCCGCAAAGATGGG - Intronic
1175377413 20:58538259-58538281 GAATGGGGTGGCCCAAAGACAGG - Intergenic
1176976376 21:15326671-15326693 CCATGGGGCACCTCCAAGAGTGG - Intergenic
1177338031 21:19759547-19759569 CAATGGGGAGTCTCAATGAAAGG - Intergenic
1177854523 21:26386175-26386197 CTATGGGGTGTCTAAGAGAGCGG + Intergenic
1177970902 21:27788308-27788330 GATTGGGGTACCTGAAAGAGAGG + Intergenic
1179613104 21:42565030-42565052 CAAGGGGGCACCCCAAAGAGAGG - Intronic
1179632774 21:42688913-42688935 CACTGGGGGGCCTCACTGAGGGG - Intronic
1182443780 22:30378909-30378931 CAATGTGGTGCCTCATCCAGGGG - Exonic
1184483604 22:44762881-44762903 TAATGAGGTGACTCAAGGAGGGG + Intronic
1185403538 22:50631563-50631585 CAATGAGGTGCCTCAGCAAGAGG + Intergenic
949472072 3:4406728-4406750 CAATTGTGTCCCTCACAGAGAGG + Intronic
949503646 3:4705875-4705897 CAATGGGTTTCCTCAATGAATGG - Intronic
949601353 3:5601483-5601505 CATTGGCGTCCCTGAAAGAGAGG + Intergenic
949671176 3:6400022-6400044 CAGTGGGGTGCCACACAGATGGG - Intergenic
949913425 3:8935647-8935669 CAATGGGGTGCCTCTGAGAAGGG + Intronic
951905797 3:27706049-27706071 AATTGGAGTGCATCAAAGAGAGG - Intergenic
953927181 3:46988424-46988446 CAGTGGGGTGCCTGGAAAAGTGG + Intronic
954013269 3:47662493-47662515 CAATGGGAAGTCTCAAAAAGTGG + Exonic
955870976 3:63437868-63437890 CATTAGGATGCCTCAAAGAAAGG + Intronic
956097217 3:65729663-65729685 CGATGGGGAGCTTCAAAGATGGG - Intronic
956209607 3:66789521-66789543 CGATGGGGTGACTTACAGAGTGG + Intergenic
957307255 3:78473645-78473667 CATTGGTGTCCCTGAAAGAGAGG + Intergenic
957675231 3:83356488-83356510 CAGTGGGGTCCCACACAGAGGGG + Intergenic
957773478 3:84724503-84724525 AAATAGTTTGCCTCAAAGAGTGG + Intergenic
959439282 3:106357271-106357293 CACTGGTGTCCCTGAAAGAGAGG - Intergenic
960681391 3:120250865-120250887 GACTGGGGTACCTGAAAGAGAGG + Intronic
962406806 3:135107461-135107483 CAATGGGATACTTAAAAGAGAGG - Intronic
963112812 3:141700933-141700955 CAGTGGGGTCCTTCACAGAGGGG + Intergenic
964630866 3:158808829-158808851 GACTGGGATGCCTCAAAGACTGG + Intronic
969176383 4:5402213-5402235 CAATGGGGTGATCCAGAGAGGGG + Intronic
970170908 4:13289656-13289678 CACTGGTGTCCCTGAAAGAGAGG - Intergenic
970249270 4:14097016-14097038 CTATGAGGTTCCTCAGAGAGTGG - Intergenic
971810110 4:31413969-31413991 CAATGCGGTGTCTCAGAGACGGG - Intergenic
972029245 4:34431958-34431980 CAATTGTTTGACTCAAAGAGAGG + Intergenic
972409369 4:38777501-38777523 CTATAGGTTGCCTCAAACAGAGG - Intronic
972862763 4:43191237-43191259 CAATGGTGTGCTTTACAGAGTGG + Intergenic
974435571 4:61853209-61853231 TAATGGGGTGACCCAAAGTGGGG - Intronic
977010338 4:91626429-91626451 CAGTGGGGTCCCACAAAGATGGG - Intergenic
977861162 4:101961829-101961851 CAATGGGGTCCCTTAAGGATGGG + Intronic
977992480 4:103461259-103461281 GAATAGGGAGGCTCAAAGAGAGG + Intergenic
978710079 4:111769612-111769634 CATTGGGATCCCTGAAAGAGAGG - Intergenic
979753635 4:124311325-124311347 CTATGGGTGGCCTCCAAGAGTGG + Intergenic
980586449 4:134822711-134822733 CAAAGAGATGACTCAAAGAGTGG - Intergenic
981466411 4:145077306-145077328 CATTGGGGTCCCTGACAGAGAGG + Intronic
982318828 4:154058619-154058641 CAGTGGGGTCCCACAAAGATGGG - Intergenic
986468571 5:8051201-8051223 CAATGGAATGCCTCAAGGAGAGG - Intergenic
987974282 5:24992246-24992268 CACTGGTGTCCCTGAAAGAGAGG + Intergenic
989427131 5:41308888-41308910 CAATGGGGTACCTCACAAGGTGG + Exonic
989615139 5:43331310-43331332 CAATGGGGTCCCACAAAGATGGG + Intergenic
990947030 5:61260389-61260411 AAATGAGGAGGCTCAAAGAGTGG - Intergenic
991244149 5:64491011-64491033 CACTGGGGTCCTTGAAAGAGAGG + Intergenic
991433077 5:66568458-66568480 CTGTGGGGTTGCTCAAAGAGTGG - Intergenic
991933646 5:71781070-71781092 CAGTGGGGTGCCAGAAAGGGAGG - Intergenic
993747540 5:91619788-91619810 GAATGGGGAGCATCAAAAAGTGG + Intergenic
997257414 5:132439699-132439721 CTATGTGGTGACTCAAGGAGGGG + Intronic
999541872 5:152583307-152583329 CATTGGTGTTCCTGAAAGAGAGG - Intergenic
999794137 5:154972294-154972316 CTATGGGGTGTCTCAATAAGAGG + Intergenic
1002986025 6:2191231-2191253 CCAGGGGGTGCCTCCAGGAGCGG - Intronic
1003477641 6:6498714-6498736 CAATAGGGTGCTTTAGAGAGAGG + Intergenic
1003727703 6:8784270-8784292 CATTCGGCAGCCTCAAAGAGCGG + Intergenic
1008082794 6:47211253-47211275 GATTGGGGTACCTGAAAGAGAGG + Intergenic
1012978204 6:105802549-105802571 GAATGGGGTTCCTGAAAGTGTGG - Intergenic
1015266758 6:131297794-131297816 CAGTGGGGTCCCACACAGAGGGG - Intergenic
1016075177 6:139787488-139787510 CACTGGTGTCCCTAAAAGAGAGG - Intergenic
1022053942 7:26709454-26709476 CATTGGAGGGCCTCAAAAAGAGG - Intronic
1022716718 7:32905590-32905612 CAAAGGCGAGGCTCAAAGAGGGG - Intergenic
1022985798 7:35652218-35652240 CAGTGGGGTGCCTCAGTGAGAGG - Intronic
1024512481 7:50214556-50214578 CAAAGGGGAGCCTCAGAGATGGG + Intergenic
1031400004 7:121317914-121317936 CAGTGGGGTCCCGCAAAGATGGG - Intergenic
1034877972 7:154742072-154742094 CAACGGGGTACCTGAAAAAGAGG + Intronic
1036657245 8:10684615-10684637 CCAAGGGGTGCCTGAAACAGGGG + Intronic
1038732431 8:30139291-30139313 GAATGGAGGGCATCAAAGAGAGG - Intronic
1038859732 8:31374428-31374450 CATTGGTGTCCCTGAAAGAGAGG - Intergenic
1043717878 8:83508513-83508535 CAATGGGGTCCCGCACAGATGGG + Intergenic
1044245856 8:89944477-89944499 CAGAGGGGTGCCTCAGCGAGAGG - Intronic
1045058530 8:98391493-98391515 CAAAGGGGAGCCCCAAGGAGTGG - Intergenic
1046294138 8:112198161-112198183 CAGTGGGGTTCCACAAAGATGGG - Intergenic
1047499821 8:125432059-125432081 CTCTGGGGTGCCTCAAGCAGGGG - Intronic
1050258085 9:3814523-3814545 CAGTGGGGTCCCACAAAGATGGG + Intergenic
1050990565 9:12146113-12146135 CAGTGGGGTGCCTTAGAGAGAGG - Intergenic
1051575003 9:18605215-18605237 CAATGGGGTATTTCAGAGAGTGG + Intronic
1052694231 9:31855291-31855313 CATTGGTGTCCCTGAAAGAGAGG + Intergenic
1055347696 9:75355152-75355174 CAATGGGGTCCCGCACAGATGGG + Intergenic
1055367981 9:75566209-75566231 CATTGGTGTCCCTGAAAGAGAGG - Intergenic
1056941604 9:90961008-90961030 CCATGGGGTGGCTCTAGGAGCGG + Intergenic
1057502097 9:95603997-95604019 CACTGGGGACCCCCAAAGAGGGG - Intergenic
1060836548 9:126759353-126759375 CAATGTGTTGCGTCACAGAGGGG - Intergenic
1185960671 X:4543855-4543877 CAATGGGGTCCCGCACAGATGGG + Intergenic
1186643515 X:11482416-11482438 CATTAGGGTGCCTCCAGGAGAGG - Intronic
1188887541 X:35568988-35569010 GAATGGGGTGCCAGAAAGGGAGG - Intergenic
1189447713 X:41096147-41096169 CAATGTGGTTCCTTAAACAGTGG + Intronic
1189897929 X:45674719-45674741 CATTGGTGTCCCTGAAAGAGAGG + Intergenic
1190464037 X:50708062-50708084 CAGTTGGGTTCCTAAAAGAGAGG - Intronic
1193392679 X:80947906-80947928 CATTGGTGTCCCTGAAAGAGGGG - Intergenic
1193807513 X:86012608-86012630 CAGCGGGGTGCCTCAATGAGAGG - Intronic
1194205257 X:91003520-91003542 CAATGGAGTGCCCCAAAGGAGGG - Intergenic
1194330563 X:92579364-92579386 GATTGGGGTGCCTGAAAGAGAGG - Intronic
1194931979 X:99900069-99900091 CAGTGGGGTGCCTCAGCAAGGGG - Intergenic
1195142524 X:101977157-101977179 CATTGGAGTCCCTGAAAGAGAGG - Intergenic
1195172767 X:102285201-102285223 CATTGGTGTCCCACAAAGAGAGG - Intergenic
1195186099 X:102401894-102401916 CATTGGTGTCCCACAAAGAGAGG + Intronic
1195784963 X:108509263-108509285 CAATGGGGTCTTTCAGAGAGTGG + Intronic
1198274917 X:135091027-135091049 CATTAGGGTGGCTCAGAGAGTGG - Intergenic
1200639267 Y:5698434-5698456 GATTGGGGTGCCTGAAAGAGAGG - Intronic