ID: 1124139544

View in Genome Browser
Species Human (GRCh38)
Location 15:27065080-27065102
Sequence CAGCTGCCAAGGAAGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124139544_1124139554 23 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139554 15:27065126-27065148 CACTCTCAATGGGGACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 126
1124139544_1124139555 26 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139555 15:27065129-27065151 TCTCAATGGGGACACTCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 154
1124139544_1124139550 12 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139544_1124139552 14 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139552 15:27065117-27065139 GTTGGCTGCCACTCTCAATGGGG 0: 1
1: 0
2: 2
3: 4
4: 92
1124139544_1124139549 -4 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139549 15:27065099-27065121 GCTGGTGACTAGTCTCACGTTGG 0: 1
1: 0
2: 0
3: 2
4: 41
1124139544_1124139551 13 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139551 15:27065116-27065138 CGTTGGCTGCCACTCTCAATGGG 0: 1
1: 0
2: 1
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124139544 Original CRISPR CAGCTGCCAAGGAAGCAATG GGG (reversed) Intronic
900422277 1:2560763-2560785 CATCTCCCAGGGAAGCAACGTGG - Intronic
900588236 1:3444226-3444248 CAGAAGGCAAGGAAGCAGTGGGG - Intergenic
901321018 1:8339881-8339903 CTTCTGCTAATGAAGCAATGAGG - Intronic
901932792 1:12607352-12607374 CATCTGCCAAGGGAGAGATGAGG + Intronic
905181908 1:36172461-36172483 CAGCGGCCAAGAAGGCAGTGTGG + Exonic
905988150 1:42307002-42307024 CAGCTGGCAAAGCAGGAATGTGG - Intronic
907415827 1:54313196-54313218 CAGCTGCCCAGGGACCAATCGGG + Intronic
907550189 1:55298585-55298607 CAGAGGCTAAGGAAGAAATGAGG + Intergenic
907592865 1:55692386-55692408 CAGCTGACAAGGAGGCATTAAGG - Intergenic
911621687 1:100072769-100072791 CCGGTGCCCAGGAAGTAATGGGG - Intronic
911932801 1:103926727-103926749 CAGAGGCCAAAGAACCAATGTGG - Intergenic
912554782 1:110508187-110508209 CAGCTGCTGAGGAAGGAATGCGG - Intergenic
912712778 1:111961513-111961535 CAGCTGCCAAGTAGGATATGGGG - Intronic
914946141 1:152068165-152068187 CGGCTGCAAAGGAATCAGTGGGG - Intergenic
915985785 1:160462790-160462812 CTGTTGCCAAGGGAGGAATGGGG - Intergenic
916019477 1:160779398-160779420 AAACTACAAAGGAAGCAATGGGG - Intergenic
917016644 1:170539321-170539343 CAGCTGCTCTGGAAGTAATGAGG - Exonic
917681569 1:177373484-177373506 CAGGTGCCAAGGAAGCCACATGG - Intergenic
917799291 1:178555605-178555627 CAGATGCCAAGGAAGAGATTCGG - Intergenic
918956337 1:191213284-191213306 AAGCTGACAAGAAAGCAATGGGG - Intergenic
919182610 1:194104563-194104585 CCACTGCCAAGGAAGGAATGGGG - Intergenic
919429030 1:197470180-197470202 CAGGTGCCAGGGAAACAATTGGG + Intronic
1063135906 10:3215864-3215886 TGGCTGCCAGGGAAGCAAGGTGG + Intergenic
1064827237 10:19418924-19418946 TAGCTTTCAAGGAGGCAATGTGG - Intronic
1065961123 10:30735119-30735141 CCTCTGCCAAGGAAGCTTTGAGG - Intergenic
1068406731 10:56599368-56599390 CAGCTGCCATGGACTCCATGGGG - Intergenic
1068735698 10:60411029-60411051 CAGCTACCAAGGATCCACTGGGG + Intronic
1068950174 10:62769021-62769043 CTGCTGCCTAGTTAGCAATGGGG + Intergenic
1070512633 10:77175533-77175555 CAGCTTCCATGATAGCAATGTGG - Intronic
1071336492 10:84604670-84604692 CAGCTGCCAAGAGAGCAGAGGGG - Intergenic
1073180215 10:101578967-101578989 CAGCTGCCCAGGAAGCAGGACGG + Exonic
1074313282 10:112340852-112340874 CAGCTCCCAAGACAGGAATGAGG + Intergenic
1074421608 10:113314156-113314178 CAGCAGCCAGGGAAGAACTGAGG + Intergenic
1075747736 10:124739639-124739661 CAGATGCCCAAGAGGCAATGTGG + Intronic
1076048103 10:127311185-127311207 CAGCTGCCTTGGAAGCATGGAGG - Intronic
1076630933 10:131851836-131851858 CAGCTGCTATGAAATCAATGGGG - Intergenic
1076794435 10:132791771-132791793 CAGCTGCCAAGGCGGCATTGGGG + Intergenic
1077181326 11:1218501-1218523 CAGCTTCCAAGGAACAAAAGAGG - Intergenic
1079166632 11:18050118-18050140 CATCTTCAAAGCAAGCAATGTGG + Intergenic
1080264567 11:30387897-30387919 CATCTGCCAAGGACACGATGTGG - Intronic
1080611780 11:33910646-33910668 CAGCTCTCAAGGATGCTATGTGG - Intergenic
1080898913 11:36469212-36469234 CAGCTGACAAAGCAGCAATGTGG - Intergenic
1082847596 11:57739187-57739209 AAGGTGGCAAGGAGGCAATGCGG + Exonic
1082899895 11:58236371-58236393 AAGCTGTCAGGGAAGCAATAAGG - Intergenic
1083045207 11:59728386-59728408 AAACTCCAAAGGAAGCAATGAGG + Intronic
1083181423 11:60988385-60988407 CAGCTGTTAAGGACGCAAGGTGG + Intronic
1084069909 11:66727697-66727719 CAGCTGCCAAAGAGGCGAGGAGG + Intronic
1086025723 11:82288647-82288669 CAGCTGCTATGGAAACAATATGG - Intergenic
1086975058 11:93121767-93121789 CAGCTGGCAAGAAAGGAAAGTGG - Intergenic
1088607778 11:111547961-111547983 CATAGGCCAAGGAACCAATGTGG + Intronic
1089590492 11:119537235-119537257 CAGCAGCCCAGGCAGCAAAGAGG + Intergenic
1090190792 11:124765980-124766002 CAGCTGCTCAGGAAGCTTTGAGG + Intergenic
1092444728 12:8544046-8544068 CAGCTGTCAAGGCAGCAGTGTGG - Intergenic
1094042642 12:26133725-26133747 CAGCTGCCAGGGGAGAAATATGG + Intronic
1094078304 12:26503144-26503166 GAGCTGGCAAGGAAACAATGGGG + Intronic
1096155571 12:49339662-49339684 CAGCTGCAGGGGAAGCAATAAGG - Intergenic
1097298873 12:57997388-57997410 CAGCTTCCAAGGCTGGAATGGGG + Intergenic
1097923712 12:65105233-65105255 CAGCTGCCTAGGAAATAAGGGGG + Intronic
1098247287 12:68533622-68533644 AAGCGACCAAGGAAGCAATGTGG - Intergenic
1100972850 12:100089975-100089997 CAGCAGTCAAAGAAACAATGAGG - Intronic
1101295002 12:103413217-103413239 AGGCTGACAAAGAAGCAATGGGG - Intronic
1102740917 12:115206904-115206926 AAGCTACCGAGGAAGCAAAGTGG - Intergenic
1102904404 12:116662985-116663007 CAGCTGCCTAGGTACCAAAGAGG - Intergenic
1103969446 12:124660905-124660927 CAGCCGACAAGGACGCAGTGGGG + Intergenic
1104552280 12:129768291-129768313 CAGCTGCTATGGAAACAATATGG - Intronic
1112660625 13:101503457-101503479 CAGCCCCCAAGAAAGGAATGTGG - Intronic
1115975457 14:38992047-38992069 CAGCTGGCAAGGAGGCTAAGAGG - Intergenic
1117243698 14:53862018-53862040 CTGCTGGCAAGAAAGCAATTGGG - Intergenic
1117823037 14:59671345-59671367 CAGTTGCAAAAGAAGTAATGAGG - Intronic
1119334451 14:73820819-73820841 CAGCTGCCAAGGTAGGAGTGAGG - Intergenic
1121271596 14:92641520-92641542 CAGCTGCCCAGGACGCCCTGAGG + Intronic
1122355489 14:101120762-101120784 CAGCTGGCAAAGAAGGAAAGTGG + Intergenic
1123757257 15:23406644-23406666 CAGCAGGCAAGGAAGGAAGGAGG - Intergenic
1124139544 15:27065080-27065102 CAGCTGCCAAGGAAGCAATGGGG - Intronic
1124358721 15:29018636-29018658 GAGCTGCCAGGGAAGCTTTGAGG + Intronic
1124412755 15:29450493-29450515 CACCTGCAAAGCAAGCAGTGGGG - Intronic
1126913382 15:53438232-53438254 CTGCTGCCCAGGAAGAAAAGGGG + Intergenic
1126994597 15:54426375-54426397 CAAATGCCAAGGAAGAAGTGAGG - Intronic
1127832477 15:62763284-62763306 CAACTGCAAAGGAAGCAATTTGG - Intronic
1128178982 15:65583804-65583826 CCTCTGACAAGGAAGCACTGGGG + Intronic
1128480296 15:68031600-68031622 CAGCTGACAAAGCAGAAATGAGG + Intergenic
1129455746 15:75675469-75675491 CACCAGGCATGGAAGCAATGGGG + Exonic
1129858012 15:78838793-78838815 CAGCTCCCAAAGATGCTATGAGG - Intronic
1131260451 15:90884837-90884859 CTGACGCTAAGGAAGCAATGAGG + Intronic
1132300305 15:100771228-100771250 CACCTGCCAAGAGGGCAATGGGG - Intergenic
1132459444 16:43602-43624 CAGCTGCCCTGGAAGCTATGGGG + Intergenic
1137483460 16:48871849-48871871 AAGCTGCCTGGGAAGCAAGGCGG + Intergenic
1138119635 16:54389065-54389087 CTGCTCCCAAGGAAGACATGTGG - Intergenic
1139691839 16:68646231-68646253 CAGCTGCCGAGGAAGAAGGGGGG - Intronic
1140503824 16:75457227-75457249 CAGCTGCCACAGAACCACTGAGG + Intronic
1142512384 17:404843-404865 CTCCTGCCAAGTAAGCATTGAGG + Intergenic
1142613862 17:1124042-1124064 CTGTTGCCATGGCAGCAATGTGG + Intronic
1142773044 17:2113580-2113602 CAGCTGCCAAGTGAGCTATATGG + Intronic
1143809547 17:9459972-9459994 CAGCTGGCAAGACAGAAATGTGG + Intronic
1145941006 17:28743538-28743560 CTGCGGCCAAGGGAGGAATGTGG + Intergenic
1146392081 17:32431848-32431870 CAGCTGCACAGGAAGCCATGTGG + Intergenic
1146779098 17:35650688-35650710 CAGAGGCCAAAGAACCAATGTGG - Exonic
1146788308 17:35736527-35736549 CATCTGCCCTGGAAGCAGTGAGG + Intronic
1148141070 17:45329152-45329174 CAGCTGCCTAGGAAGAATTATGG - Intergenic
1148198810 17:45734283-45734305 AAGATCCCAAGGAAGCAATAAGG - Intergenic
1148758016 17:49984676-49984698 CAGAGGCCCAGGAAGCATTGAGG - Intergenic
1149424395 17:56541095-56541117 CAACCCCCAAGGAAGCAATTTGG + Intergenic
1149428591 17:56578661-56578683 AAGCTTCCAAGGATGAAATGAGG - Intergenic
1149443687 17:56697360-56697382 CATCTGGCAAGGGAGCATTGAGG - Intergenic
1152085436 17:78214890-78214912 CAGCTGTTTAAGAAGCAATGAGG - Intronic
1152244603 17:79178625-79178647 CAGCTGCCAAGGAATGAAACTGG + Intronic
1152658828 17:81533060-81533082 CAGCTGCCTTGGAAGCCGTGAGG - Intronic
1153471692 18:5453379-5453401 CTGCTGCTCAGGAAGGAATGGGG + Intronic
1155715178 18:28933249-28933271 CAGCTTCCAGGGAAGCATGGGGG + Intergenic
1157189653 18:45570103-45570125 CAGCTGGAGAGGGAGCAATGTGG + Intronic
1157218516 18:45806684-45806706 CAGGGGCAGAGGAAGCAATGAGG + Intergenic
1159148385 18:64484962-64484984 CAGCCAGGAAGGAAGCAATGGGG - Intergenic
1160997085 19:1887611-1887633 CAGCTGCCAGGGAAGGAATCAGG + Intergenic
1161424619 19:4196141-4196163 CAGGCACCAAGGAAGCACTGTGG - Intronic
1162659963 19:12161211-12161233 AGGCTGCCCAGGAAGCAATCGGG - Intergenic
1162943839 19:14030834-14030856 CAGCTGGCAAGGAACCCCTGGGG + Exonic
1163429433 19:17258271-17258293 CAGCTGAAAAGGAAGCATGGAGG - Exonic
1164618842 19:29681928-29681950 CAGCAGGCAGGGAAGGAATGGGG + Intergenic
1165095139 19:33406090-33406112 CAGCTGCCAGGAAAGCACAGTGG + Intronic
925057279 2:864934-864956 CAGCTGCAATCGGAGCAATGGGG + Intergenic
927943860 2:27122998-27123020 CAGCTGCCATGGGAGCACTGCGG - Intergenic
928394119 2:30931096-30931118 CAGCAGGCCAGGAAGCAGTGGGG - Intronic
928767174 2:34661212-34661234 CTGCTGCCATGGAAGCAATGAGG - Intergenic
932791974 2:74661806-74661828 CAGCTACCATGGAAGTAATTAGG + Intronic
934133553 2:88972130-88972152 CAGCCCCCAAGGCAGGAATGGGG - Intergenic
936743056 2:115538106-115538128 CAGGTGGGAAGGAAGCAATGAGG + Intronic
939511702 2:143114508-143114530 CAGGTCCCAGGGAAGCAATGTGG + Intronic
940850971 2:158688015-158688037 CAGCTAGCCAGGAAGCCATGAGG - Intergenic
941477981 2:165971711-165971733 CAGTAGCCAAGGAAGCCCTGAGG + Intergenic
942602182 2:177652651-177652673 CAGCTGGCAAGGAGGCAGTCAGG + Intronic
944198642 2:197082063-197082085 GAGCTGGCAAGGAGGCAGTGGGG - Intronic
944362752 2:198877590-198877612 CAGCTGCCCAGGCAGAAATGTGG + Intergenic
944771763 2:202921942-202921964 CAGCTTCCCAAGAAGCTATGGGG + Intronic
945684615 2:212953859-212953881 CAGCTGCCAGGAATGCAATTAGG - Intergenic
947941997 2:234065132-234065154 CAGCTGCTATGGAAATAATGTGG - Intronic
948233194 2:236366670-236366692 CAGCTGCAAAGGATACAAGGTGG - Intronic
1168831185 20:846059-846081 CAGAGGCCAAGGAAGGAAGGAGG - Exonic
1171361211 20:24587557-24587579 CAGCTGCCAAGGAGAGAGTGTGG + Intronic
1171405147 20:24907473-24907495 CAGTTGCCTAGGAAGCAGGGTGG + Intergenic
1172106205 20:32518663-32518685 CAGTTGCTATGGAAACAATGAGG + Intronic
1173857930 20:46262828-46262850 CATCTGCCCAGGAAGAAAAGAGG - Intronic
1174148446 20:48468880-48468902 AAGCAGCCAAGGAAGCCTTGGGG - Intergenic
1174748335 20:53086528-53086550 CACCTTCCAAAGAACCAATGTGG - Intronic
1175393368 20:58641663-58641685 TAGCTGCCTAGGAGGCAAAGTGG - Intergenic
1175415481 20:58797842-58797864 CAGCTGGGAAGGCAGCAAGGAGG + Intergenic
1177293586 21:19147192-19147214 CAGGGGCCAAGGAAGCAGTGTGG + Intergenic
1179938215 21:44618650-44618672 CTGCTGCCAGGGAAGCAGAGTGG + Intronic
1180785474 22:18544779-18544801 CAGCTGCCAAGGAAACAAAGAGG + Intergenic
1180932804 22:19605005-19605027 CAGCTGCAGAGGAAGCAAAGCGG - Intergenic
1181106530 22:20579058-20579080 CATCTGCCAAGGGAGGATTGTGG - Intronic
1181129060 22:20718820-20718842 CAGCTGCCAAGGAAGCAAAGAGG + Exonic
1181242378 22:21484132-21484154 CAGCTGCCAAGGAAACAAAGAGG + Intergenic
1181688424 22:24544602-24544624 GAGCTCCCCTGGAAGCAATGTGG - Intronic
1185037143 22:48485328-48485350 CAGCTGTCAAGGCAGGGATGTGG - Intergenic
1185199440 22:49492457-49492479 CAGCTGCCCGGGAAGGAAGGTGG + Intronic
952127579 3:30319934-30319956 CTGGTGCCAAAGCAGCAATGTGG - Intergenic
952330628 3:32361446-32361468 GAGCTGACATGGTAGCAATGTGG - Intronic
953119182 3:40023199-40023221 CAGATGTCAAGGAGGCCATGTGG + Intronic
955473889 3:59315273-59315295 CAGATGCTGAGGAATCAATGAGG - Intergenic
956017267 3:64896688-64896710 CAGCTGTACAGAAAGCAATGAGG - Intergenic
957950604 3:87121149-87121171 CAGCTGCCAAACCAGAAATGTGG + Intergenic
958653302 3:96966337-96966359 CAGCTGGCAAAGCAGAAATGTGG + Intronic
958929954 3:100198058-100198080 CAGCTGCCCAGGATGCAGTCTGG - Intergenic
959369279 3:105503728-105503750 CACCTGGGAAAGAAGCAATGGGG - Intronic
961087308 3:124079173-124079195 CAGCTGCAGAGGAAGCAGAGGGG + Intergenic
962449141 3:135497361-135497383 CAGTTGCCAAGGAAGCTAATAGG + Intergenic
962598899 3:136975876-136975898 CAGCATCCAAGCAAGCCATGTGG - Intronic
962911851 3:139859450-139859472 GAGTTGCCAAGGAAGCTATAAGG - Intergenic
968539493 4:1156631-1156653 CAGCCGCCATGTAACCAATGGGG + Intergenic
971262467 4:25069641-25069663 CAGCGGCCTAGGAATCAATAGGG + Intergenic
972077110 4:35102825-35102847 AAGCTGCCAAGAAAGCCATAAGG + Intergenic
975347529 4:73310244-73310266 CACCTGGCAAGGAAGCAAGGGGG - Intergenic
975592520 4:76014864-76014886 CAGAAGCCAAGGAAGCAAGAGGG + Intronic
976225115 4:82789786-82789808 CAGCTGCTAAAGAAAGAATGAGG + Intronic
977296418 4:95214531-95214553 CGGCTGCCAAGGAAAGTATGGGG + Intronic
978338132 4:107691595-107691617 CAGCTGTCAAGGAGCCAGTGGGG + Intronic
979289471 4:118964106-118964128 CAGGTGCCAAGGAAGTTTTGGGG + Intronic
979805944 4:124971268-124971290 CACGTCCCAAGGAAGCCATGGGG - Intergenic
979975434 4:127190419-127190441 CAGCTGGCAAAGGAGAAATGCGG - Intergenic
982184804 4:152785095-152785117 CAGCTTCCAAGGAACCAAGGAGG - Intronic
983520967 4:168708611-168708633 CAGCTGCAAACCAAGCAGTGGGG - Intronic
984955065 4:185036989-185037011 CAGGTGCAGAGGCAGCAATGTGG - Intergenic
985884578 5:2667284-2667306 CTGCTGCCTAGGCTGCAATGCGG - Intergenic
986185294 5:5430134-5430156 CAGCTGCTATGGAAGAAGTGAGG - Intronic
986409566 5:7463877-7463899 AAGCTACAAAGAAAGCAATGGGG + Intronic
987005600 5:13706429-13706451 CAGATGGAAAGGAAGCCATGGGG + Intronic
987337248 5:16907787-16907809 CAGCTGCTGAGAAGGCAATGAGG + Intronic
987572446 5:19682158-19682180 CAGCTGTCAAAGAAGAAATATGG - Intronic
989200430 5:38757546-38757568 CAGCTGGCACTGAAGCCATGTGG - Intergenic
991937692 5:71818066-71818088 CAGCTGGCAAAGCAGAAATGTGG + Intergenic
991974682 5:72174595-72174617 CAGCAGCCAAGAAGGAAATGTGG - Intronic
992669126 5:79041254-79041276 CAGCTGACAACAAAGCAGTGAGG - Intronic
994366740 5:98926635-98926657 CAGCTGTTAAGGAAGAAGTGGGG + Intronic
995449169 5:112281411-112281433 CAGAAGCCAAGGAAGCACAGAGG + Intronic
996802860 5:127422635-127422657 CAGCATCAAAGGCAGCAATGAGG - Intronic
997986311 5:138504177-138504199 CAGCTTCCCAGGAAGCTATCAGG - Intergenic
998054521 5:139063008-139063030 CAGCTTTCAAGCAAGCAATGAGG + Intronic
999555372 5:152736562-152736584 AAGCTGCCAAGAAAACAATGGGG - Intergenic
1000873086 5:166601626-166601648 CACCTGCAAAAGAAGAAATGAGG - Intergenic
1001450277 5:171819223-171819245 CATCTGCCAAGGAACGAATGTGG - Intergenic
1001902395 5:175443212-175443234 CCTCTGCCAGGGAAGCAATCTGG - Exonic
1002286270 5:178164641-178164663 CAGGTGCCAAGGAATGAATGAGG - Intergenic
1002928223 6:1617334-1617356 CAGCTGCAAAGGAAGACATTCGG - Intergenic
1006931670 6:37692526-37692548 CAGCTGCCCAGGAGGCATGGGGG - Intronic
1006944064 6:37772580-37772602 CATCTGCCAAGGAAGCAGCTGGG + Intergenic
1008031797 6:46704836-46704858 CAGCTGCTAAAGCAGCCATGAGG - Intronic
1011809273 6:91111785-91111807 CAGCTGCCAAGAAGGGCATGTGG + Intergenic
1013163990 6:107573330-107573352 CAGCTGGCAAGAAGGCAATAGGG - Intronic
1013706862 6:112845823-112845845 TAGCTGCCTAGCAAGAAATGGGG + Intergenic
1014386200 6:120805435-120805457 CAGCTGGCAAGGAAGGGATGTGG - Intergenic
1014498450 6:122156842-122156864 CAAAGGCCAAGGAATCAATGTGG + Intergenic
1014660228 6:124161145-124161167 CTGCTGTACAGGAAGCAATGTGG + Intronic
1016182549 6:141164931-141164953 CACCTGCCAGGAAAGCAAGGGGG - Intergenic
1016515919 6:144892982-144893004 ATGCTGTCAAGGAAGCAATGAGG + Intergenic
1018519940 6:164636880-164636902 TAGGAGCCAAGAAAGCAATGGGG + Intergenic
1018640504 6:165900004-165900026 CAGGAGCCAAGGAGGCCATGAGG + Intronic
1018708281 6:166478704-166478726 CAGATGAGCAGGAAGCAATGAGG + Intronic
1019351741 7:557183-557205 CAGCAGCCAAGGAGGGAAAGAGG + Intronic
1020037926 7:4976281-4976303 GAGCTGAAAAGGAAGCAAAGAGG - Intergenic
1021786252 7:24155696-24155718 CAGATGCCAAAGAAGCCGTGAGG + Intergenic
1024507300 7:50172799-50172821 CAGCTGCCATGGCAGCAAAGGGG - Intergenic
1024722361 7:52151725-52151747 CAGCTGCCAAGGGAACTAGGAGG - Intergenic
1027571968 7:79880479-79880501 GAGCTGCCACAGAAGCAATAAGG - Intergenic
1030134765 7:106236178-106236200 CAGCTGCCTGAGAAGCAGTGTGG + Intergenic
1031941373 7:127792957-127792979 CAGGTGGCAAGGCAGAAATGGGG + Intronic
1032647152 7:133837411-133837433 AATCTGACAAAGAAGCAATGTGG - Intronic
1036474559 8:9081381-9081403 AAGCTGCCAAGGGTGCATTGAGG + Intronic
1037194278 8:16168512-16168534 GAGCTGCAAATCAAGCAATGTGG + Exonic
1041508862 8:58632499-58632521 CAGGTGTCCAGGAAGCCATGTGG - Intronic
1041666046 8:60445750-60445772 CACCTGTTAAGGAAGCTATGGGG - Intergenic
1043727739 8:83631389-83631411 CAGCTACAAAGCAAGCAAAGTGG - Intergenic
1044506052 8:93020765-93020787 GGGGAGCCAAGGAAGCAATGAGG + Intergenic
1044544634 8:93445940-93445962 CAGCTGCAAAGGAAGGGAGGAGG - Intergenic
1044604751 8:94038942-94038964 TAGGTGCCAAGGAAACAATGGGG - Intergenic
1045526949 8:102949090-102949112 CAGCTGGAAAGGAGGGAATGTGG - Intronic
1047309618 8:123681113-123681135 AAGCTGCCAAGAAAGTAATCCGG + Exonic
1048982389 8:139709772-139709794 CAGCTGCCAAGGAAGTGAGTGGG + Intergenic
1049369597 8:142257524-142257546 CAGCTGCCAGGGAAGCAGAGGGG - Intronic
1049405926 8:142451844-142451866 CGGCTGCCGAGGAGGCAACGAGG + Intronic
1049568944 8:143359514-143359536 CAGGAGCCAAGGGAGCGATGAGG + Intronic
1049592263 8:143468034-143468056 CAGCTGCAAAGCCTGCAATGGGG + Intronic
1050006991 9:1142007-1142029 CAGCTTCCTAGGAAGCATTTTGG + Intergenic
1050346066 9:4688917-4688939 CAGATTCCAAGGAAGCAAAGAGG - Intronic
1051278184 9:15416988-15417010 CTGCTGCCCAGGAACCTATGTGG + Intergenic
1054814057 9:69457559-69457581 CAGCTGCAAATGAAGCCATTTGG + Intronic
1055496588 9:76861075-76861097 CAGCCTCCAAGGAAGCCAGGTGG + Intronic
1057971814 9:99565942-99565964 CATCTGGCAAGGAAGGAGTGAGG - Intergenic
1058047675 9:100373958-100373980 CAGCTGGCAAAGCAGAAATGTGG + Intergenic
1058662035 9:107275385-107275407 AAGGAGCCAAGGAAGCAAGGAGG - Intergenic
1060104045 9:120862515-120862537 CTGCTTCCAAGCAAGCAAGGAGG - Intronic
1060831355 9:126719711-126719733 CTTCTGCTAAGGAAGGAATGAGG + Intergenic
1062524403 9:136972447-136972469 CAGCTCCCAAGGCAGCCCTGGGG + Intergenic
1187665419 X:21603670-21603692 CAGCTGCCAAGATAGCAATTTGG + Intronic
1190477372 X:50841397-50841419 TAGCTGCCAAAAAAGCAGTGAGG - Intergenic
1192168807 X:68841917-68841939 CAGCTGGCCAGGAGGCAGTGTGG - Exonic
1192980554 X:76335272-76335294 CAGCTGCCATGGAAGGATTTTGG - Intergenic
1194383443 X:93223301-93223323 CAGAGGCCAAAGAACCAATGTGG + Intergenic
1197052895 X:122081558-122081580 CAGCTGGCAGTGAAGTAATGAGG - Intergenic
1199977587 X:152903575-152903597 CTGCAGCCAGGGAACCAATGTGG - Intergenic
1200133621 X:153864276-153864298 CACCTGCCAGGGAAGCATGGGGG - Intronic
1202200051 Y:22336535-22336557 CTGCTGCCAAGAGAGCAATGAGG - Intronic