ID: 1124139545

View in Genome Browser
Species Human (GRCh38)
Location 15:27065081-27065103
Sequence CCAGCTGCCAAGGAAGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124139545_1124139549 -5 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139549 15:27065099-27065121 GCTGGTGACTAGTCTCACGTTGG 0: 1
1: 0
2: 0
3: 2
4: 41
1124139545_1124139552 13 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139552 15:27065117-27065139 GTTGGCTGCCACTCTCAATGGGG 0: 1
1: 0
2: 2
3: 4
4: 92
1124139545_1124139554 22 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139554 15:27065126-27065148 CACTCTCAATGGGGACACTCAGG 0: 1
1: 0
2: 0
3: 9
4: 126
1124139545_1124139556 30 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139556 15:27065134-27065156 ATGGGGACACTCAGGAGGAAAGG 0: 1
1: 0
2: 2
3: 24
4: 306
1124139545_1124139555 25 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139555 15:27065129-27065151 TCTCAATGGGGACACTCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 154
1124139545_1124139551 12 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139551 15:27065116-27065138 CGTTGGCTGCCACTCTCAATGGG 0: 1
1: 0
2: 1
3: 2
4: 50
1124139545_1124139550 11 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124139545 Original CRISPR CCAGCTGCCAAGGAAGCAAT GGG (reversed) Intronic
900834345 1:4988706-4988728 CCAGCTGCCAAGGGAGCCTCAGG - Intergenic
901243717 1:7711432-7711454 CCAACTGTGAAGGAACCAATAGG + Intronic
903758048 1:25676731-25676753 AAAGCTGCCAAGGAAGGAAATGG - Intronic
905299975 1:36980464-36980486 CCAGTAGCCAAGGAGGCAAGTGG - Intronic
906035903 1:42750333-42750355 CCAGCTGCCAAGGAGACAGATGG + Exonic
906109461 1:43313187-43313209 CCAGCTGACATGGAAGCACCCGG + Exonic
907415826 1:54313195-54313217 ACAGCTGCCCAGGGACCAATCGG + Intronic
912563032 1:110563873-110563895 CTAGGTGCCAAGGAAGAAACAGG + Intergenic
913169958 1:116222761-116222783 CCAGCTGCCCAGGAAGCCTGAGG + Intergenic
915985786 1:160462791-160462813 CCTGTTGCCAAGGGAGGAATGGG - Intergenic
916674704 1:167055454-167055476 CCACCTGCCTAGGAACCACTCGG - Intronic
917807098 1:178623808-178623830 CCAGCTGCAAACCAAGCAACGGG + Intergenic
918956338 1:191213285-191213307 AAAGCTGACAAGAAAGCAATGGG - Intergenic
919182612 1:194104564-194104586 GCCACTGCCAAGGAAGGAATGGG - Intergenic
919429029 1:197470179-197470201 CCAGGTGCCAGGGAAACAATTGG + Intronic
919788588 1:201275766-201275788 CCACCTGCCAAGGAAGGAGGAGG + Intergenic
924453285 1:244198436-244198458 CCAGCTGGCAAGAAGGCACTTGG - Intergenic
1063053337 10:2476745-2476767 GCAGTTGCCAAGGAAACAGTAGG - Intergenic
1067733026 10:48826921-48826943 CCAGCAGACAAGGAAACAAGTGG - Intronic
1067802062 10:49365953-49365975 CCAGGTGCCAAGGGAGCTGTGGG + Exonic
1068092898 10:52454820-52454842 CAAGATGCCAAGTAAGCAGTTGG - Intergenic
1068406732 10:56599369-56599391 CCAGCTGCCATGGACTCCATGGG - Intergenic
1068735697 10:60411028-60411050 CCAGCTACCAAGGATCCACTGGG + Intronic
1071470536 10:85981040-85981062 CTAGCTCCCAATGAAGCCATAGG + Intronic
1072441457 10:95459724-95459746 CCAGCTGCCAGGAAAGCAAAGGG + Intronic
1072617628 10:97060054-97060076 CCAGCTCCCCAGGAAGCAGTGGG + Intronic
1072683587 10:97523865-97523887 CCAGCTGCCACAGAAGCAGCAGG - Intronic
1076630934 10:131851837-131851859 CCAGCTGCTATGAAATCAATGGG - Intergenic
1076794434 10:132791770-132791792 CCAGCTGCCAAGGCGGCATTGGG + Intergenic
1078479979 11:11667291-11667313 CTAGCAGCCAAGGAAGTAGTAGG - Intergenic
1078677334 11:13434674-13434696 CTAGCTGCAAAGCAAACAATGGG + Intronic
1078736137 11:14022925-14022947 CCAGCTGCCACGGAAGCCTCAGG + Intronic
1079306443 11:19327800-19327822 CCTGCTGCAAAGGATGCAAAAGG + Intergenic
1079545754 11:21630050-21630072 CCTCCTACCAAGGAAGCAAGAGG - Intergenic
1083948953 11:65943272-65943294 CCCTCTGCCAAGGAAGAAAGTGG + Intergenic
1084189523 11:67492748-67492770 CCAGCTGCCAGGCAAGCCAGAGG - Intronic
1085528157 11:77175933-77175955 CCAGCTGCCCAGGCAGCAATGGG - Intronic
1085689889 11:78656351-78656373 CCAGCTTAAAAGGAAGCATTTGG + Exonic
1090670382 11:128941544-128941566 CCAGCTGGCAAGGGAGAAATGGG - Intronic
1093220048 12:16409672-16409694 AGAGCTGCCATGGAAGCAACAGG - Intronic
1094078303 12:26503143-26503165 AGAGCTGGCAAGGAAACAATGGG + Intronic
1094531533 12:31279720-31279742 CCAGCTGGCAAGGAACTAAGCGG + Intergenic
1095361039 12:41339670-41339692 CCATCTGACAAGGAATTAATAGG + Intronic
1097015008 12:55979690-55979712 CCAGTTGCCAAGGAAGGCCTGGG + Intronic
1099497077 12:83362186-83362208 CCAGCTTTCAAAGAACCAATTGG - Intergenic
1102488260 12:113272860-113272882 CCAGCTCTCAAGGAAGAAAGTGG - Intronic
1103969445 12:124660904-124660926 CCAGCCGACAAGGACGCAGTGGG + Intergenic
1104427917 12:128693238-128693260 CCAGCCTCCAAGGATGCAAAGGG - Intronic
1106639748 13:31571617-31571639 CCAGCTGCCAAAGAGGACATTGG - Intergenic
1109195659 13:59375317-59375339 CCAACTGACAAGGAAGAAAAAGG + Intergenic
1111999184 13:95194064-95194086 CATGCTTCCAAGGAAGCAGTGGG - Intronic
1114631388 14:24161595-24161617 CCAGATGGCAAGGAAACAAATGG - Intronic
1114949447 14:27730406-27730428 CCAGCTGCCTAGGAAGCTCTAGG - Intergenic
1115936914 14:38562083-38562105 CCAGCTGTGATGGAAGCAGTAGG - Intergenic
1117243699 14:53862019-53862041 TCTGCTGGCAAGAAAGCAATTGG - Intergenic
1117722200 14:58638526-58638548 CTTGCTGCTAAGAAAGCAATTGG + Exonic
1118175898 14:63439845-63439867 CGAGCTGCCAAGGAATCCTTAGG - Intronic
1119466974 14:74865951-74865973 CAAGATGTCAAGAAAGCAATTGG + Intronic
1121690062 14:95871786-95871808 CCAGCTTCAAAGGAAGAAAATGG - Intergenic
1124139545 15:27065081-27065103 CCAGCTGCCAAGGAAGCAATGGG - Intronic
1124236166 15:27990953-27990975 CCAGTTGCCAAGGGAGCATATGG - Intronic
1124350595 15:28953033-28953055 CCAGGTCCCAGGGAAGCAACAGG - Intronic
1124412756 15:29450494-29450516 CCACCTGCAAAGCAAGCAGTGGG - Intronic
1124577324 15:30921348-30921370 ACAGCTGACAGGGAAGCAAAAGG - Intronic
1125458170 15:39881888-39881910 GCAGCTGCCAAGGAATATATTGG + Intronic
1126855977 15:52839929-52839951 CCAGCTGCCAAGGAAAGGAGAGG - Intergenic
1126913381 15:53438231-53438253 CCTGCTGCCCAGGAAGAAAAGGG + Intergenic
1126933534 15:53681221-53681243 CCAGCTGCCACAGAAACAATTGG - Intronic
1128178980 15:65583803-65583825 CCCTCTGACAAGGAAGCACTGGG + Intronic
1129542325 15:76360514-76360536 CCTTCTGCCCAGGAAGGAATGGG - Intronic
1132459443 16:43601-43623 TCAGCTGCCCTGGAAGCTATGGG + Intergenic
1135844355 16:25905268-25905290 CCTGCTGCCAAGGAAGTTTTAGG - Intronic
1138719251 16:59059690-59059712 CTAGTTGCCAAGGAGGAAATTGG + Intergenic
1139691840 16:68646232-68646254 CCAGCTGCCGAGGAAGAAGGGGG - Intronic
1140942750 16:79737128-79737150 CTTGATGCCCAGGAAGCAATGGG - Intergenic
1141441832 16:84034172-84034194 CCAGCTGCCATGGAAGAAGTTGG - Intronic
1146477173 17:33172396-33172418 CCATCTGCCAAGGCAGAACTGGG - Intronic
1150323052 17:64232860-64232882 CCATCTGCAAAGGAACCCATGGG - Intronic
1152472965 17:80500423-80500445 CAGGCTGGCAAGGAAGGAATTGG + Intergenic
1153471691 18:5453378-5453400 CCTGCTGCTCAGGAAGGAATGGG + Intronic
1158652652 18:59301366-59301388 CCAGGTCCAAAGGCAGCAATGGG + Intronic
1162469336 19:10863067-10863089 CCAGCCCACAGGGAAGCAATTGG - Intronic
1162659964 19:12161212-12161234 CAGGCTGCCCAGGAAGCAATCGG - Intergenic
1162943838 19:14030833-14030855 CCAGCTGGCAAGGAACCCCTGGG + Exonic
1168680119 19:58308795-58308817 TCAGCTGGTAAGAAAGCAATTGG + Intronic
925670214 2:6302953-6302975 CCAGCTGCCAAGTAGGGTATGGG + Intergenic
928441248 2:31294062-31294084 CCAGCTGCCAAGCTAGCTTTGGG - Intergenic
935546812 2:104408371-104408393 CCAGCTGCCAGGGGAGCAGAGGG + Intergenic
935985215 2:108666038-108666060 CCACACGCCAAGCAAGCAATCGG + Intronic
936103014 2:109600078-109600100 CCAGCTGCCTAGGGAGAAAGTGG - Intronic
938440001 2:131321514-131321536 CCAGCTGCCAATGGAGTAAAAGG + Intronic
939532429 2:143381390-143381412 CCAACTGCAAAAGCAGCAATAGG - Intronic
940246133 2:151618408-151618430 ACAACTTCCAAGGAATCAATCGG + Exonic
944451067 2:199843186-199843208 GTAGCTGCCAATGAAGCAAAGGG + Intronic
944513431 2:200486952-200486974 GCACTTGCTAAGGAAGCAATGGG + Intergenic
944602832 2:201320859-201320881 CCAGCTGCAATAGTAGCAATAGG - Intronic
944772052 2:202924667-202924689 GCAGCTGCCAAGGAGGCCCTTGG - Intronic
1168864999 20:1078728-1078750 CCAGAGGCCAAGGAAGCCCTAGG - Intergenic
1171232428 20:23498403-23498425 CCACCTACCAAGCAAGCCATGGG - Intergenic
1172449593 20:35012621-35012643 CCAGCTGCTCAGTAAGCAGTCGG + Intronic
1173680753 20:44879536-44879558 ACTGCAGCCAGGGAAGCAATAGG - Intergenic
1174148447 20:48468881-48468903 CAAGCAGCCAAGGAAGCCTTGGG - Intergenic
1174759208 20:53190291-53190313 CCAGCTCGCAAGGAAACAACTGG - Intronic
1174917524 20:54669131-54669153 CCAGCTGCCCAAGCAGCAAATGG + Intergenic
1174955208 20:55090310-55090332 CCAGCTGCCACTGAATTAATGGG - Intergenic
1180882631 22:19217207-19217229 CCAGCAGCTAAGGAACCAAAAGG + Intronic
1181334314 22:22117110-22117132 CCATCTGCCGAGGCAGCACTTGG - Intergenic
1181594150 22:23903464-23903486 CCAACTGCGAAGGCAGCAAGGGG + Intergenic
1182347684 22:29678095-29678117 CCAGCAGCCACAGAGGCAATGGG - Intronic
1184680325 22:46069619-46069641 CCAACTCCCAGGAAAGCAATTGG + Intronic
1185288333 22:50012162-50012184 ACACCTGCCAAGGAAACACTCGG - Intronic
952705493 3:36373318-36373340 ATGGCTGCCAAGGGAGCAATTGG + Intergenic
953462982 3:43096242-43096264 CCTGCTACCAAGGATCCAATCGG + Intronic
953698485 3:45178432-45178454 CCAACTGCCAAGGGAGCAGGCGG + Intergenic
958177547 3:90015842-90015864 ACAGCTGAAAAGGAAGCAAGAGG - Intergenic
962703991 3:138026104-138026126 CCAGCTGCCAAGAAAGACCTTGG + Intronic
962890003 3:139663194-139663216 CCAGCTTCCAAGCCAGCAATGGG + Intronic
964439338 3:156689815-156689837 CCAGCTACCAGGCAAACAATGGG - Intronic
965977333 3:174641154-174641176 CCTGCTGCCAAAGAAGCAAACGG + Intronic
971262466 4:25069640-25069662 GCAGCGGCCTAGGAATCAATAGG + Intergenic
971858956 4:32079595-32079617 CCAGATGCCTAGGAGGGAATAGG - Intergenic
973571554 4:52244900-52244922 CCAGTTGGCAAGGAATCAAAAGG + Intergenic
973895055 4:55403902-55403924 GCAGATACAAAGGAAGCAATGGG - Intronic
975347530 4:73310245-73310267 CCACCTGGCAAGGAAGCAAGGGG - Intergenic
975592519 4:76014863-76014885 TCAGAAGCCAAGGAAGCAAGAGG + Intronic
978338131 4:107691594-107691616 CCAGCTGTCAAGGAGCCAGTGGG + Intronic
979740520 4:124144454-124144476 CCAGCTGTCAAGGATGTAAATGG - Intergenic
982669271 4:158300899-158300921 CCAGTTGCGAAGGAAGGGATAGG - Intergenic
985614106 5:909261-909283 CCAACTCCCAAGGAAGTGATGGG + Intronic
986409565 5:7463876-7463898 CAAGCTACAAAGAAAGCAATGGG + Intronic
988103855 5:26717524-26717546 CCTGCTCCCTTGGAAGCAATTGG + Intergenic
990468344 5:56090238-56090260 CCAGTTGCCAAGCATCCAATTGG - Intergenic
990928749 5:61061749-61061771 CAGGCTGCCAAGGCAGCACTGGG - Intronic
997294347 5:132760439-132760461 ACAGCTGCCAAGGGGGCTATGGG + Intronic
999099691 5:149013026-149013048 TCAGGTGCCAAGGACGTAATAGG - Intronic
999210299 5:149882374-149882396 CTAGTTGCCTAGGAAGCATTGGG - Intronic
999555373 5:152736563-152736585 AAAGCTGCCAAGAAAACAATGGG - Intergenic
1000014173 5:157263312-157263334 CCAGGCTCCAAGGATGCAATGGG + Intergenic
1000870653 5:166573185-166573207 CCTGCTGCCAAGGAAGACCTTGG - Intergenic
1001546448 5:172573498-172573520 CCAGCAGCAAAGGAAGCATGTGG + Intergenic
1003619926 6:7690910-7690932 CCATCTGCCATGGAAGCCAGTGG - Intergenic
1004442231 6:15664334-15664356 CCAAGTGCCCAGGAGGCAATTGG - Intergenic
1006382362 6:33707001-33707023 CCACCTGCCCAGGAGGCAATGGG + Intronic
1006931671 6:37692527-37692549 CCAGCTGCCCAGGAGGCATGGGG - Intronic
1006944063 6:37772579-37772601 GCATCTGCCAAGGAAGCAGCTGG + Intergenic
1011659431 6:89581631-89581653 CCAGCTGCCTGGGAATCAAAGGG + Intronic
1013163991 6:107573331-107573353 TCAGCTGGCAAGAAGGCAATAGG - Intronic
1015288402 6:131510350-131510372 CCAGGTGGCAATGATGCAATGGG + Intergenic
1018519939 6:164636879-164636901 CTAGGAGCCAAGAAAGCAATGGG + Intergenic
1019626037 7:2016126-2016148 CCAGCTGCCCTGGAAACAACAGG + Intronic
1024507301 7:50172800-50172822 GCAGCTGCCATGGCAGCAAAGGG - Intergenic
1026498810 7:70925596-70925618 CCAGCTGCCCAGGGAGCTAAAGG - Intergenic
1029946743 7:104541220-104541242 CCAGGTGCCATGGGAGCCATGGG - Intronic
1031941372 7:127792956-127792978 CCAGGTGGCAAGGCAGAAATGGG + Intronic
1034829432 7:154296487-154296509 CCAGCTGCCTGGGAAGCCAATGG - Intronic
1034885924 7:154798910-154798932 CCTGCTGCCAGCGAAGCCATTGG + Intronic
1036049416 8:5179418-5179440 CCTGCTGCCAAGGCTGCAGTAGG - Intergenic
1037613149 8:20493501-20493523 CCAGCTGGAGAGGAAGCAACTGG + Intergenic
1038509585 8:28119003-28119025 ACAGCTGCAACGGAAGCAAAAGG + Intronic
1043263539 8:78232138-78232160 CCACTTGCCAAGGGAGCAACAGG + Intergenic
1043622128 8:82207092-82207114 CCAGATGCCAAGGAATGCATAGG - Intergenic
1043849960 8:85205069-85205091 CCAGCTACCAGGGAGGCCATAGG + Intronic
1044604752 8:94038943-94038965 ATAGGTGCCAAGGAAACAATGGG - Intergenic
1048982388 8:139709771-139709793 CCAGCTGCCAAGGAAGTGAGTGG + Intergenic
1049180335 8:141218962-141218984 CCAGCTGCCCAGGAAGGTCTGGG + Exonic
1049360551 8:142210709-142210731 CCAGCTGCGTAGGAGACAATTGG + Intergenic
1049369598 8:142257525-142257547 GCAGCTGCCAGGGAAGCAGAGGG - Intronic
1049592262 8:143468033-143468055 CCAGCTGCAAAGCCTGCAATGGG + Intronic
1051098522 9:13494400-13494422 CCAGGTGCCAATTAAGGAATTGG - Intergenic
1056952103 9:91048847-91048869 CCAGCTGCTAAGCAACTAATGGG + Intergenic
1062683580 9:137798437-137798459 CCAGCAGCAAAGGAAGCAAGAGG + Intronic
1062732046 9:138115533-138115555 CCATCTGCAAAGGAGGCAAAGGG - Exonic
1185714423 X:2329931-2329953 CAAGCTGCCAAGGATACAAAAGG + Intronic
1191902546 X:66054933-66054955 CCTGCTGCCAAGGAAGCCCATGG + Intergenic
1192237653 X:69306113-69306135 CCAGCAGCCTAGGATGCAGTTGG + Intergenic
1192439888 X:71166674-71166696 CCAGCTGGGCAGGAAGCAAGAGG + Intronic
1196275085 X:113757250-113757272 TCAGCTGCCAAGGAAGGGGTAGG - Intergenic
1201306121 Y:12552050-12552072 ACAGCTGACAAGGAGGCAAGAGG - Intergenic