ID: 1124139550

View in Genome Browser
Species Human (GRCh38)
Location 15:27065115-27065137
Sequence ACGTTGGCTGCCACTCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124139541_1124139550 28 Left 1124139541 15:27065064-27065086 CCCTCTCTTTGAGGCACCCCATT 0: 1
1: 0
2: 10
3: 89
4: 642
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139545_1124139550 11 Left 1124139545 15:27065081-27065103 CCCATTGCTTCCTTGGCAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 161
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139542_1124139550 27 Left 1124139542 15:27065065-27065087 CCTCTCTTTGAGGCACCCCATTG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139548_1124139550 1 Left 1124139548 15:27065091-27065113 CCTTGGCAGCTGGTGACTAGTCT 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139547_1124139550 10 Left 1124139547 15:27065082-27065104 CCATTGCTTCCTTGGCAGCTGGT 0: 1
1: 0
2: 0
3: 32
4: 335
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55
1124139544_1124139550 12 Left 1124139544 15:27065080-27065102 CCCCATTGCTTCCTTGGCAGCTG 0: 1
1: 1
2: 3
3: 33
4: 223
Right 1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124139550 Original CRISPR ACGTTGGCTGCCACTCTCAA TGG Intronic
905583201 1:39097836-39097858 GCATTGGCCACCACTCTCAAGGG + Intronic
909828777 1:80159175-80159197 AGTTTGGCTGCCACCTTCAATGG - Intergenic
915825148 1:159067861-159067883 ACGTTGTCTGCCACTCCCTCAGG + Intronic
918296187 1:183159680-183159702 ACGGTGGCTGCCACTCAGTAGGG - Intergenic
919431889 1:197504133-197504155 ACTTTGCCTGCCACCATCAAAGG - Intergenic
922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923881710 1:238110929-238110951 ACTTGGGCTGACACTCTGAATGG + Intergenic
1065188979 10:23193492-23193514 ACGTTGACCGCGGCTCTCAAGGG + Intronic
1068171825 10:53404191-53404213 ACCGTGGCTGCCACACTCCAGGG - Intergenic
1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG + Intergenic
1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG + Intergenic
1092766537 12:11858073-11858095 ACTCTTGCTGCCACTCTCAGAGG - Intronic
1093806914 12:23445715-23445737 ACATTGGCAGGCACTATCAAGGG + Intergenic
1105974441 13:25460878-25460900 AAGATGGCTGCCAGTCTCAATGG - Intronic
1107171530 13:37347975-37347997 ACTTTTGCTGTCACTCTCATTGG + Intergenic
1113513952 13:110876660-110876682 AAGTTGGCTCCCACTCTGGAGGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG + Intronic
1129710051 15:77816313-77816335 ACCTTGGCTGTTACTCTCCATGG - Intronic
1132497515 16:270861-270883 GCCCTGGCTGCCACTCTCGATGG - Intronic
1132898137 16:2238483-2238505 AGGGTGGCTGCCACCCTGAAGGG - Exonic
1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG + Intronic
1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG + Intergenic
1144269805 17:13604707-13604729 AAGCTTGCTGCCACTCTCAAGGG - Intergenic
1144710217 17:17396594-17396616 ACGTCGGCTGGCATTCTCCAGGG - Intergenic
1150281878 17:63933609-63933631 AAGGTGGGGGCCACTCTCAAGGG + Intergenic
1152956843 18:47769-47791 ACGGTGGCTGCCATTTTCAGGGG - Exonic
1159218477 18:65428427-65428449 ACTCTGGCTGCCACTCTGGAGGG + Intergenic
1163515464 19:17760490-17760512 ACTTTTTCTGCCACTCTCAATGG - Intronic
927218028 2:20680772-20680794 ACGTTGGGCACCACCCTCAATGG - Intergenic
928184540 2:29097709-29097731 ACGCTGGCTGGTGCTCTCAAAGG + Intronic
938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG + Intergenic
938742265 2:134244112-134244134 AGATTTGCTTCCACTCTCAAAGG - Intronic
939397568 2:141650526-141650548 ACCATGGCTGCCACTCAAAATGG + Intronic
940932439 2:159449573-159449595 ATGGTAGCTGCCAGTCTCAAAGG + Intronic
946910908 2:224459686-224459708 ACGTGGGCTGTCAGTCTCCACGG + Intergenic
1173263498 20:41457582-41457604 AGGTTGGCTGCCACCCTCCGTGG + Intronic
1178700307 21:34827733-34827755 ACCTAGGCTGCCATTCTGAAGGG + Intronic
1179394542 21:41026331-41026353 ACGGTGGCTGCCACATTCTATGG + Intergenic
1183655236 22:39180623-39180645 CTGATGGCTGCCCCTCTCAAGGG + Intergenic
1184424946 22:44403875-44403897 ACGGGGGCTGCAACTCTCAGAGG + Intergenic
969888409 4:10237209-10237231 ACTTAGGCTGTCACTATCAAGGG - Intergenic
987123957 5:14793624-14793646 ATGGTGGCTGCAAATCTCAATGG + Intronic
989577365 5:43000696-43000718 CAGTAGGCTGACACTCTCAAAGG - Intergenic
993263002 5:85684784-85684806 AGATTAGCTGCCACTCTAAATGG - Intergenic
994507602 5:100662348-100662370 CTGTTAGCTGCCACTCTGAAGGG + Intergenic
998421786 5:141994214-141994236 ACTTTGGCTGCCACTCTGAGAGG + Intronic
1006402890 6:33828071-33828093 ACTTTGGCTTCCACTCTGAGTGG - Intergenic
1007073471 6:39052576-39052598 ACACTGGCTGCCAATCTGAAAGG - Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1018047658 6:159979493-159979515 ACGCTGCCTGTCACTCTAAAGGG - Intronic
1019911935 7:4106050-4106072 ACCTTGGCTGCCACCTTCAGTGG + Intronic
1019930356 7:4218713-4218735 ACGGTGGGTGCCACTCACCAAGG + Intronic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG + Intergenic
1027802019 7:82766182-82766204 GCCAAGGCTGCCACTCTCAAAGG - Intronic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1030830192 7:114210773-114210795 ATGGCGGCTGCCACTCTCCATGG + Intronic
1035616839 8:1008605-1008627 ACATTGGCTTCCACTGACAAAGG - Intergenic
1046355295 8:113076304-113076326 TCTTTTGCTGCCACTGTCAAGGG + Intronic
1047062338 8:121241634-121241656 ACTTTGGGTGCCAATTTCAAGGG + Intergenic
1060735116 9:126061789-126061811 CCAGTGGCTGCCACTCTCAGAGG - Intergenic