ID: 1124139993

View in Genome Browser
Species Human (GRCh38)
Location 15:27068677-27068699
Sequence CCCTGCCAGTGCAACATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124139993_1124139997 5 Left 1124139993 15:27068677-27068699 CCTTACATGTTGCACTGGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1124139997 15:27068705-27068727 TAGCTAGTCATGGATATGACAGG 0: 1
1: 0
2: 0
3: 3
4: 63
1124139993_1124139995 -5 Left 1124139993 15:27068677-27068699 CCTTACATGTTGCACTGGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1124139995 15:27068695-27068717 CAGGGCCTCTTAGCTAGTCATGG 0: 1
1: 0
2: 1
3: 11
4: 177
1124139993_1124139998 6 Left 1124139993 15:27068677-27068699 CCTTACATGTTGCACTGGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1124139998 15:27068706-27068728 AGCTAGTCATGGATATGACAGGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124139993 Original CRISPR CCCTGCCAGTGCAACATGTA AGG (reversed) Intronic
902936139 1:19766206-19766228 CCCAGCAAGTGCAACACGGATGG - Intronic
904359311 1:29961680-29961702 CCCTGAGAGAGCATCATGTAAGG + Intergenic
906961149 1:50420150-50420172 CCCTGGCAGTGCAGCCTGTAAGG + Intronic
910281468 1:85506172-85506194 GCCTGACAGGGCAACATGAATGG + Intronic
918995556 1:191754195-191754217 ACCTGCAAGTGCAAGATGAAAGG + Intergenic
919243148 1:194940530-194940552 CACTGGCTGTGCAACATGTCTGG + Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
921528408 1:216247136-216247158 CCCTGCCAGTGTAACCTCCATGG - Exonic
922695127 1:227727454-227727476 CCCAGCCTGGGCAACATGGAGGG + Intergenic
922800540 1:228362807-228362829 CCCTGGCTGTGCAACATGAGGGG + Intronic
1066186658 10:33016091-33016113 GCCTGCCAGTGCAGCCTGCAAGG - Intergenic
1067522563 10:47019360-47019382 CCTGGCCAGTGCGACATGGAGGG - Intergenic
1067733397 10:48830277-48830299 CCCTGAGAGGTCAACATGTAAGG + Intronic
1070109875 10:73474820-73474842 ACTTTACAGTGCAACATGTAAGG - Intronic
1074461801 10:113645063-113645085 GGCAGCCAGTGCAGCATGTAAGG + Intronic
1076202867 10:128572233-128572255 GCCTGGCAGTGCCACAGGTACGG + Intergenic
1078154819 11:8790280-8790302 TCCTCCCAGTGAAACATCTAGGG + Intronic
1079004947 11:16784929-16784951 CCCTGCCAAGGCAGCATGTTGGG + Intronic
1079666454 11:23112531-23112553 CTCTGCCACAGCAGCATGTATGG + Intergenic
1082102342 11:48183129-48183151 CCCTTCCAGAGCAACCTGTGTGG + Intergenic
1084275995 11:68051261-68051283 CCCGGCCAGTGCTCCATGCAGGG + Intergenic
1085758671 11:79223230-79223252 CCCTGCCAGTGCTTCTTGTTAGG - Intronic
1087263208 11:96033752-96033774 CCCAGCCAATGCAACCTGGAAGG - Intronic
1089628599 11:119769587-119769609 CCCAGCCTGTGCAAAATGCAGGG + Intergenic
1091668633 12:2437071-2437093 CCCTGCCAGTGTGGCATGAAGGG - Intronic
1092783397 12:12007545-12007567 CCCTCCCAGAGCAACATGAGGGG - Intergenic
1095517888 12:43027254-43027276 CCTTGTTAGAGCAACATGTATGG + Intergenic
1100008146 12:89919614-89919636 CCCTCCCAGTCCAACCTGTTCGG + Intergenic
1101507904 12:105363848-105363870 TCCTGCCAGTTATACATGTAAGG + Intronic
1109996508 13:70134404-70134426 ACCTGCCTGTGCAGCATTTAGGG - Intergenic
1116528082 14:45932402-45932424 TCCTACCAATGCAACATGTCTGG + Intergenic
1116752030 14:48898885-48898907 CCCTGCATTTGCAACATGGATGG + Intergenic
1122131999 14:99609645-99609667 CCCTGGCGGTCCAGCATGTAGGG - Intergenic
1124139993 15:27068677-27068699 CCCTGCCAGTGCAACATGTAAGG - Intronic
1125190117 15:36981970-36981992 AACTCCCAGTTCAACATGTAAGG - Intronic
1133077336 16:3289887-3289909 CCCTATCAGTGCAACATTTGCGG + Exonic
1139318774 16:66096070-66096092 CCCTCACAGTGCAACAAGGAAGG + Intergenic
1141576147 16:84964603-84964625 CCCTCCCAGGGCAGCACGTATGG - Intergenic
1141923755 16:87153578-87153600 CCTTGTCAGTGCAACACGGAGGG + Intronic
1143498576 17:7326174-7326196 CCCTGCCAGGGCACCAAGCAGGG - Intronic
1147719734 17:42531631-42531653 CCCAGGCAGTGCAACTTGTCAGG - Intergenic
1149261879 17:54888924-54888946 CCCTGCCAGGCCAACATATTGGG + Intergenic
1149775022 17:59350444-59350466 CCCTGCCACAGCAAAATGTAAGG + Intronic
1153048931 18:882848-882870 CCATGCCTGTGGAACATGGAAGG - Intergenic
1153192187 18:2553429-2553451 CCCTATCAGTGCAACATATCAGG + Intronic
1155128123 18:22900992-22901014 CCCTGCCAGTGCTGCCTGGATGG - Intronic
1157450669 18:47785112-47785134 CACAGCCACTGGAACATGTAAGG - Intergenic
1157576166 18:48745272-48745294 CCTTCCCAGTGCACCATGTCAGG + Intronic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160710140 19:547616-547638 CCCTGCCAGTGCCTCTTGCAAGG - Intronic
1161107446 19:2451675-2451697 CCCTGCCAGGCCCACATGTGTGG - Intronic
1166380645 19:42353542-42353564 CCCTGCCAGTGCAACGGGCACGG + Exonic
925012853 2:498656-498678 CCATGCCAGGGCAACAGGAAGGG + Intergenic
925040641 2:731167-731189 CCCAGACAGTGCAAGATGTTAGG + Intergenic
925793971 2:7523057-7523079 CGCTGCCAAAGCAACATGCATGG - Intergenic
928456059 2:31423537-31423559 CACTGCCTTTGCAACATGAACGG - Intergenic
932271710 2:70416106-70416128 CCATGCCTGTGCACCATGGAGGG - Intergenic
934951895 2:98581186-98581208 CCCTGTCTGTGCAGCATGTGGGG + Intronic
935825852 2:106948475-106948497 CCATGCATGTGCAACTTGTAAGG + Intergenic
942689767 2:178573022-178573044 CCCTGCCAGAGGAAGATGAATGG - Exonic
1173417059 20:42866066-42866088 CCATCCCAGTGCCACATGTTGGG + Intronic
1175510269 20:59519381-59519403 CCCTTGCAGTGCAACTTGGAAGG - Intergenic
1178627610 21:34231368-34231390 CCCTTTCACTGCAACAGGTAGGG + Intergenic
949737326 3:7188563-7188585 CCCTGCAGGTGAAAGATGTAAGG + Intronic
949880995 3:8660542-8660564 CCCTGCCAGAGCAAGATTGAAGG + Intronic
950673092 3:14538912-14538934 CCCTGGCAGTGCCCCAGGTAAGG + Intronic
956313440 3:67907550-67907572 CACTGCCTGTGCACCAAGTATGG - Intergenic
959472846 3:106773770-106773792 CTCTGCCAGACCAACATGTCTGG - Intergenic
963914038 3:150841338-150841360 TCCTGCCAGTGCAGAATCTATGG + Intergenic
972165642 4:36280864-36280886 GCCTGCCAGCGCATCATATATGG - Intergenic
975643253 4:76521912-76521934 CCTTGCCAGTGCATCATATCAGG - Intronic
976632677 4:87254811-87254833 GCCTGGCAGTGCAAGATGAATGG - Intergenic
981205690 4:142036939-142036961 CCCTGCAAGTGCAAAATGCAAGG + Intronic
992497572 5:77308820-77308842 CCCCGCCAGCCCACCATGTAAGG + Intronic
994116561 5:96067803-96067825 CCCTCCCAGTGCAAAATGGCAGG - Intergenic
995835950 5:116399752-116399774 CCTTGGCAGTGTAAAATGTAGGG - Intronic
997347155 5:133200327-133200349 CCCTGGAAGGGAAACATGTAGGG + Intronic
997387745 5:133486946-133486968 TCCTGCCAGTGTCACATGTCAGG - Intronic
1005684963 6:28245441-28245463 CCATACCAGTGCAATATGTGTGG - Exonic
1007135189 6:39513734-39513756 CCCTGGCATTGCAACATGCCAGG + Intronic
1016212340 6:141553342-141553364 CCCTCCCACTGCAACATGAGTGG - Intergenic
1023721564 7:43100401-43100423 CCCTGTCACTGAAAGATGTAAGG - Intergenic
1034362809 7:150515441-150515463 CCCTAACAGTGTAACATGTGGGG + Intronic
1037649642 8:20824771-20824793 CCCTGCCAGTGCAACCAAGAGGG - Intergenic
1046032089 8:108794786-108794808 TCTAGCCAGTGCAACATGTGTGG + Intergenic
1048151125 8:131895567-131895589 CCCTGCCAGTTCAAGATTCAAGG + Intergenic
1053072350 9:35108673-35108695 CCTTGCCAGTGCAGCAGGCATGG - Exonic
1186935942 X:14450169-14450191 CCATGGCTGTGCAACTTGTATGG - Intergenic
1187237109 X:17477715-17477737 TCATGCCAGTTCCACATGTAGGG - Intronic
1188444287 X:30240256-30240278 AATTGCCAGGGCAACATGTAAGG + Intergenic
1195749813 X:108152561-108152583 CAGTGGCAGTCCAACATGTATGG - Intronic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic