ID: 1124142840

View in Genome Browser
Species Human (GRCh38)
Location 15:27092586-27092608
Sequence CCGTGTGAGCTGCCGTGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124142840 Original CRISPR CCGTGTGAGCTGCCGTGCAG CGG Intronic
900231101 1:1558326-1558348 TCGTGTGGGCTGCAATGCAGTGG - Intronic
900524030 1:3119830-3119852 CTGTGTCAGCTGCTGAGCAGGGG - Intronic
901531030 1:9852612-9852634 CCAACTCAGCTGCCGTGCAGGGG - Intronic
902148629 1:14424538-14424560 CCATGTGAATGGCCGTGCAGTGG - Intergenic
902397444 1:16140062-16140084 CTGTGTGAGCAGAGGTGCAGAGG + Intronic
903771407 1:25766719-25766741 CCCTGAGAGCTGCCGAGGAGGGG + Intronic
920087603 1:203429121-203429143 CCGTGTGAGGAGCAGCGCAGTGG - Intergenic
1065753363 10:28908826-28908848 AGGTGTGAGCTGCCGTGCACTGG + Intergenic
1065917265 10:30364524-30364546 CTGCATGAGCTGCTGTGCAGTGG + Intronic
1084352412 11:68611709-68611731 CCATGTGAGCTGGGGTGCGGGGG + Intronic
1084362922 11:68680728-68680750 ACGGTTGAGCTCCCGTGCAGTGG + Intergenic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085824807 11:79833720-79833742 CCGTGCTAGCTGACGTGAAGGGG - Intergenic
1086569371 11:88264374-88264396 CCCTGTGAGGTGCCATGGAGTGG + Intergenic
1102240893 12:111323995-111324017 CAGTGTGAGATGCACTGCAGTGG - Intronic
1106484095 13:30157463-30157485 CAGTGTTAGCTGCGGTGCAGAGG - Intergenic
1110383505 13:74881033-74881055 CCTTGTGAGATGCTGAGCAGAGG - Intergenic
1115489626 14:33946570-33946592 CTGTGTGGGATGCTGTGCAGGGG - Intronic
1119716442 14:76862923-76862945 CGGTGAGAGCTGCTGGGCAGTGG + Intronic
1122845882 14:104498644-104498666 CCATGTGTGCTGCTGTGCTGTGG - Intronic
1122848363 14:104513196-104513218 CCCTGTGAGCTGCCCTGCAGGGG - Intronic
1122893142 14:104742202-104742224 CCGTGTGAGCTCACGTGCTGTGG - Intronic
1123048111 14:105528147-105528169 GCGTGGGGGCTGCCGGGCAGGGG + Intronic
1123066072 14:105620083-105620105 CCGTGGGAGCTGCCCCGCTGTGG + Intergenic
1123089453 14:105735920-105735942 CCGTGGGAGCTGCCCCGCTGTGG + Intergenic
1123707995 15:22964534-22964556 CCCGGGGAGCTGCCGGGCAGGGG - Intronic
1124142840 15:27092586-27092608 CCGTGTGAGCTGCCGTGCAGCGG + Intronic
1124516777 15:30373233-30373255 CTGTGTTAGCTGCAGTGCGGAGG - Intronic
1124726139 15:32157498-32157520 CTGTGTTAGCTGCAGTGCGGAGG + Intronic
1130812423 15:87393820-87393842 TCATCTGAGCTGCAGTGCAGTGG - Intergenic
1131442145 15:92467293-92467315 CAGTGTGTGCTGATGTGCAGAGG - Exonic
1132657342 16:1046797-1046819 CCTTGTGAGCCGGCGGGCAGCGG + Intergenic
1133114643 16:3570247-3570269 AGGTGTGAGCTGCCGTGCCTGGG + Intronic
1136316509 16:29457682-29457704 CCATGTGATCTGCCTGGCAGAGG + Exonic
1136431086 16:30197024-30197046 CCATGTGATCTGCCTGGCAGAGG + Exonic
1137607577 16:49796794-49796816 GGGTGTGAGCTGCTGTGCACAGG + Intronic
1141441428 16:84031981-84032003 CCGTGTGAGGGGCTGCGCAGTGG + Intronic
1145282434 17:21477838-21477860 CCGTGAGATCTGCAGGGCAGGGG - Intergenic
1145395036 17:22487917-22487939 CCGTGAGATCTGCAGGGCAGGGG + Intergenic
1149922518 17:60672947-60672969 TCGTCTGAGCTGGAGTGCAGTGG - Intergenic
1151418815 17:73984269-73984291 CGGTGGGAGCTGCATTGCAGGGG - Intergenic
1152229704 17:79108318-79108340 CCGTGTGGCCTGCGGAGCAGAGG + Intronic
1152321915 17:79612478-79612500 CCGTCTCTGCTGCCCTGCAGGGG - Intergenic
1152509792 17:80778757-80778779 CTGTGTGGGCTGGAGTGCAGTGG - Intronic
1155474752 18:26226755-26226777 GCGCGTGTCCTGCCGTGCAGCGG + Exonic
1156498900 18:37544464-37544486 CTGTGTGAGGTGCTGAGCAGGGG + Intronic
1160904210 19:1444991-1445013 CAGTGTAAACTGCCGTCCAGGGG - Intergenic
1160976769 19:1796630-1796652 CCGGGTGAGCTGCGGGGCTGGGG + Intronic
1161356334 19:3821222-3821244 CCGTGTGAGCTCTCGAGCAGTGG - Intronic
1161392658 19:4029230-4029252 CAGTGGGAGCTGCTGTGCGGAGG + Intronic
1161459716 19:4389498-4389520 CTGTGTGAGTTCCCATGCAGGGG + Intronic
1162028318 19:7906397-7906419 CTGGGTGAGCGGCCCTGCAGGGG + Intronic
1165526328 19:36358148-36358170 TCGTCTGAGCTGGAGTGCAGTGG + Intronic
1166975079 19:46601201-46601223 CCGTGGGAGCCGCAGTGCGGCGG + Intronic
1167512512 19:49903278-49903300 CCGGGTGCGCTGCCGTGATGGGG - Intronic
930738417 2:54803190-54803212 CCGTGTGAGCTGCCATAGTGTGG + Intronic
932282587 2:70507052-70507074 CTGTGAGTGCTGCTGTGCAGGGG + Intronic
932888940 2:75573711-75573733 AGGTGTGAGCTGCCTTGGAGTGG - Intergenic
936972073 2:118185763-118185785 CAGTGGGAGCTGCAGTGCTGAGG + Intergenic
937953520 2:127406320-127406342 CTCTGTGGGCTGGCGTGCAGTGG - Intergenic
947822939 2:233084699-233084721 CCGTCTGAGCCGCCGGGCAAAGG + Intronic
948232400 2:236359627-236359649 CCGTGTGAGCTGCAGAACACGGG - Intronic
948384633 2:237573915-237573937 CAGTGAGAGCTGGCGTGCAGAGG - Intergenic
1171360119 20:24581635-24581657 CCGTGTGTGATGAGGTGCAGCGG + Intronic
1172107275 20:32524264-32524286 CAGTGTGACCTGAGGTGCAGAGG - Intronic
1172972091 20:38881132-38881154 CCGGGGGAGCTGCCTGGCAGAGG + Intronic
1173539834 20:43843039-43843061 CGGTGTGAGATGCTGTACAGTGG + Intergenic
1174000474 20:47370961-47370983 CCCAGAGAGCTGCAGTGCAGGGG + Intergenic
1175581397 20:60102515-60102537 CTATGTGTGCTGCCATGCAGGGG + Intergenic
1179289147 21:40003634-40003656 CCTTGTGAGCCCCCCTGCAGAGG - Intergenic
1180708861 22:17826250-17826272 CCCTCTGAGCTGCCCTGAAGGGG + Intronic
1180817645 22:18801997-18802019 CCGAGTGGGCTGGAGTGCAGTGG - Intergenic
1181203860 22:21236452-21236474 CCGAGTGGGCTGGAGTGCAGTGG - Intergenic
1181967030 22:26664049-26664071 CTGTTTGGGCTGCAGTGCAGTGG + Intergenic
1184480584 22:44744599-44744621 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480608 22:44744726-44744748 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480632 22:44744853-44744875 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1184480692 22:44745195-44745217 CCGTGGGAGCATCTGTGCAGTGG - Intronic
1185203080 22:49520491-49520513 CCGTGTGAGATGCTGAGCTGAGG - Intronic
1203223061 22_KI270731v1_random:58962-58984 CCGAGTGGGCTGGAGTGCAGTGG + Intergenic
1203267768 22_KI270734v1_random:27858-27880 CCGAGTGGGCTGGAGTGCAGTGG - Intergenic
950076823 3:10193285-10193307 CCGTGAAAGCTGCCTTGCTGAGG - Intronic
950485171 3:13269109-13269131 CGGAGTGAGCTGCAGTGCAGGGG + Intergenic
963939817 3:151086740-151086762 GCGTGTCTGCTGCCGGGCAGCGG + Intronic
968577365 4:1374183-1374205 CCCTGTGGGCTGCCGGCCAGGGG - Intronic
969305181 4:6322244-6322266 CCATGGCAGGTGCCGTGCAGTGG - Exonic
969364634 4:6687059-6687081 CCCTGTGAGCTGCTGTAGAGTGG - Intergenic
969859477 4:10024225-10024247 CACAGTGAGCTCCCGTGCAGAGG - Intronic
971410224 4:26363177-26363199 TCGTCTGAGCTGGAGTGCAGTGG + Intronic
977607026 4:98994372-98994394 CCGTTTGGGCTGGAGTGCAGTGG + Intergenic
979291918 4:118987622-118987644 TCATGTGGGCTGCAGTGCAGAGG - Intronic
980520667 4:133929237-133929259 CCGTGTGATCTGCAGTGCTGTGG + Intergenic
985547093 5:515216-515238 CCGTTTGTGCTGCTGTGCTGGGG - Intronic
990168648 5:53022340-53022362 ACGTGTGAGCTGCCATGCTCAGG + Intronic
990614066 5:57489129-57489151 CCCTGTGAGGTGCAGTTCAGGGG + Intergenic
991548934 5:67815507-67815529 CCGGGTGAGCAGCCGTGAAGAGG - Intergenic
995858314 5:116616184-116616206 CAGTGAGAGCTGCCATGCTGAGG - Intergenic
997262078 5:132473106-132473128 CGGTGTGAGCTGCGGGGCGGTGG + Intronic
997335665 5:133107411-133107433 CAGTGGGAGCTGCTTTGCAGGGG + Intergenic
1001656426 5:173354356-173354378 AGGTGTGAGCTGCCGTGCCCAGG + Intergenic
1002170307 5:177371028-177371050 CCGGGTGAGCTTCCGGGCCGCGG + Exonic
1003644996 6:7907604-7907626 CAGTTTCAGCTGCCGTGGAGTGG - Intronic
1003931813 6:10931129-10931151 TCGCCTGAGCTGCAGTGCAGTGG - Intronic
1007774411 6:44216967-44216989 CGGTGAGAGCTGCCGTGGATTGG + Intergenic
1013417433 6:109937578-109937600 AGGTGTGAGCTGCCGTGCTCAGG + Intergenic
1016465645 6:144322440-144322462 CCTTCTCAGCTGCCCTGCAGGGG + Intronic
1017916356 6:158834911-158834933 CCGTGTGTCCTGCCTGGCAGAGG - Intergenic
1018837165 6:167493939-167493961 CCCTCTGAGCTGGCTTGCAGGGG - Intergenic
1019258066 7:64288-64310 AGGTGGGAGCTGCAGTGCAGGGG + Intergenic
1019385494 7:753447-753469 CCTTGGGGGCTGCAGTGCAGAGG + Intronic
1019431076 7:1000152-1000174 CCGGGAGACCTGCCCTGCAGTGG + Intronic
1022171560 7:27836752-27836774 CAGTGTGTGCTGCTGTGCAGTGG - Intronic
1026925149 7:74186856-74186878 TCGCGTGAGCTGAAGTGCAGTGG + Intronic
1037589248 8:20299538-20299560 CCGTGTGAGGTGCCAGGGAGTGG - Intronic
1040585420 8:48736000-48736022 CGCTGTGACCTGCTGTGCAGGGG - Intergenic
1041032784 8:53755064-53755086 CAGTGAGAGCTGCCTCGCAGTGG + Intronic
1046857157 8:119045407-119045429 CAGTATGAGCTGCTGTGCTGTGG - Intronic
1049525983 8:143127284-143127306 CCGTGGGTGCTGCCGGGAAGGGG - Intergenic
1055574461 9:77647846-77647868 CCGGGTGAGCGGCCGGGCCGAGG - Exonic
1061227410 9:129288739-129288761 CCCAGGGAGCTGCCGGGCAGGGG + Intergenic
1062035324 9:134380264-134380286 CACTGTGAGCTGGCGTGCTGAGG + Intronic
1062121010 9:134834043-134834065 CCGAGGGAGGAGCCGTGCAGTGG + Intronic
1203560804 Un_KI270744v1:55387-55409 CTGTTTGATCTGCTGTGCAGAGG - Intergenic
1185595241 X:1302370-1302392 AATTGTGAGCTGCAGTGCAGTGG + Intronic
1192639008 X:72845863-72845885 CCTTGGGAGCTCCCCTGCAGGGG - Exonic
1192642704 X:72874945-72874967 CCTTGGGAGCTCCCCTGCAGGGG + Exonic