ID: 1124146124

View in Genome Browser
Species Human (GRCh38)
Location 15:27126932-27126954
Sequence GGGGCAATAACTTGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124146116_1124146124 9 Left 1124146116 15:27126900-27126922 CCTGGCATGTAGTGAGGTAGCAT 0: 1
1: 0
2: 0
3: 3
4: 107
Right 1124146124 15:27126932-27126954 GGGGCAATAACTTGGAAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 127
1124146115_1124146124 10 Left 1124146115 15:27126899-27126921 CCCTGGCATGTAGTGAGGTAGCA 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1124146124 15:27126932-27126954 GGGGCAATAACTTGGAAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124146124 Original CRISPR GGGGCAATAACTTGGAAGGC AGG Intronic
902821718 1:18947521-18947543 GGAGAAGTAACTTGGAAGTCAGG - Intronic
903178147 1:21592655-21592677 GGAGCTATAACTGGGCAGGCAGG - Intergenic
903758064 1:25676858-25676880 GGGGGTACAACTTGGAAGGAAGG - Intronic
910433302 1:87179821-87179843 GGGGCAATCAATGTGAAGGCAGG + Intergenic
916447668 1:164888787-164888809 GTGGGAATAACATGGAAGTCTGG - Intronic
918457794 1:184742176-184742198 GGGGAAATAACTTTCAAAGCAGG + Intronic
919755085 1:201061649-201061671 GGGGCAACCTCTTGAAAGGCAGG - Intronic
920350548 1:205335343-205335365 GGGCCAGTTACTTGGGAGGCTGG + Intergenic
922074602 1:222230959-222230981 TGGGAAATATCTTGGAAGGCAGG - Intergenic
924032035 1:239895370-239895392 TGAGCAGTAACTTGGAAGGATGG - Intronic
924396504 1:243626715-243626737 GAGGCAATAACTAGAAAGACAGG + Intronic
1064127981 10:12680944-12680966 GGGGCAGAAACAAGGAAGGCAGG - Intronic
1070006711 10:72431593-72431615 TGGGCATTATCTTGAAAGGCCGG - Intronic
1072512962 10:96147619-96147641 GGGGCAATACCTTCGAATTCTGG - Intronic
1078358700 11:10652014-10652036 GGGGCACTTACTTGGCCGGCAGG + Exonic
1088172131 11:107010163-107010185 TGGGAAATATCTTGGAAGGCGGG - Intronic
1088435572 11:109809092-109809114 GGGGCAAAAACATGGAAAACTGG + Intergenic
1089535399 11:119158010-119158032 GGGGCAAAAACTTGGGAGGGAGG - Intronic
1090090217 11:123690082-123690104 GGAGCAATAGCTTGAAAAGCTGG - Intergenic
1090905141 11:131068282-131068304 GGGGCAATATCATGCAAGGATGG + Intergenic
1092096863 12:5850038-5850060 GGGGATATAACTTGGTATGCTGG - Intronic
1093669678 12:21858657-21858679 GGGGGAATAACTTTGGAGACAGG + Intronic
1094226523 12:28052247-28052269 TGGGAAATGACTTGGTAGGCTGG + Intergenic
1096673913 12:53216246-53216268 GGGGCAATAACTCTGGGGGCAGG + Intronic
1099419362 12:82436251-82436273 AGGGCACTAAGTTGGAAGTCAGG - Intronic
1099479443 12:83147822-83147844 GCGGCAATACCTTGCAGGGCTGG - Intergenic
1100232133 12:92619248-92619270 GTGGCAATACCTTGCAGGGCTGG + Intergenic
1100421931 12:94443454-94443476 GGGGCAAGCACAAGGAAGGCAGG - Intronic
1103162513 12:118741339-118741361 AGGGAAATAACATGGAGGGCAGG - Intergenic
1104989081 12:132614953-132614975 GGGGAAGCTACTTGGAAGGCAGG + Intergenic
1107307263 13:39036625-39036647 GCAGCAAAAACTTGGAAAGCAGG + Intronic
1107838135 13:44428728-44428750 CCAGCAATAACTTAGAAGGCTGG - Intergenic
1112487854 13:99835930-99835952 GGGGCCAGGACTTGGAAGACAGG + Intronic
1117217033 14:53561506-53561528 GTGACAATAACTTGCAGGGCTGG + Intergenic
1119478214 14:74943513-74943535 TGGCAAATAACTTGGAAGGAAGG + Intronic
1120459293 14:84773436-84773458 ATGGCAACAACTTGGAAGGTGGG - Intergenic
1121215914 14:92247816-92247838 GGGGCAAGAATTTGGATGCCAGG - Intergenic
1124146124 15:27126932-27126954 GGGGCAATAACTTGGAAGGCAGG + Intronic
1124239314 15:28016997-28017019 GGGGCAAGAACATGCAAGGCAGG - Intronic
1128642982 15:69353572-69353594 GTGGCAATACCTTGCAGGGCTGG + Intronic
1135841669 16:25882401-25882423 GAGGAAATGAGTTGGAAGGCAGG + Intronic
1141835323 16:86534919-86534941 GGGGAAATAACTCAGGAGGCAGG - Intronic
1143539330 17:7559926-7559948 GGGGCAATAACCAGGAACTCGGG + Intronic
1144058382 17:11560523-11560545 GTGGCCATCCCTTGGAAGGCAGG + Exonic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145737100 17:27240644-27240666 AGGGCACTAACCTGGAAGACGGG - Intergenic
1146861265 17:36301157-36301179 GGGGCAATAGGAGGGAAGGCAGG + Intronic
1147091596 17:38105261-38105283 GGGGCAATAGGAGGGAAGGCAGG + Intergenic
1147105616 17:38215244-38215266 GGGGCAATAGGAGGGAAGGCAGG - Intergenic
1147181103 17:38686197-38686219 GAGGCATTGACTTGGAGGGCTGG - Intergenic
1148423887 17:47573258-47573280 GGGGCAATAGGAGGGAAGGCAGG + Intronic
1150422019 17:65045400-65045422 GTCCCAATAACTTGGGAGGCTGG + Intronic
1150942468 17:69707593-69707615 GGGGCAATAACTTACCTGGCCGG + Intergenic
1152140013 17:78530675-78530697 GGAACAATAACTTGGAATGAGGG - Intronic
1152233635 17:79127145-79127167 CGGGTGATAATTTGGAAGGCTGG - Intronic
1155669175 18:28348510-28348532 GGGGCAATATCTTGAAATGGGGG + Intergenic
1156088479 18:33438167-33438189 GGGGCAATAATTAGGAAAGCTGG - Intronic
1157627318 18:49061432-49061454 GTGAAAATAGCTTGGAAGGCAGG + Intronic
1164969748 19:32521575-32521597 GGGGCAATAGCTTGGGAGGTGGG - Intergenic
925444440 2:3915644-3915666 TGGGCTATAGCTTGGAGGGCTGG + Intergenic
926468378 2:13220351-13220373 GGGGCAATGACTTAGCAGGAGGG - Intergenic
926862687 2:17325642-17325664 GTGGTAATAACTGGGATGGCTGG - Intergenic
928166964 2:28978802-28978824 GGGGCAATGACTGGGAACACTGG + Intronic
932727627 2:74193218-74193240 TGGGGAATAAATTGGAAGGCAGG + Intergenic
933702286 2:85263983-85264005 GGGCCAGTGACGTGGAAGGCAGG + Intronic
937126566 2:119478502-119478524 GGGGCAGAAACATGGAAGGAAGG + Intronic
945745113 2:213711159-213711181 GAGGCAATAAGTTGGATGACTGG - Intronic
946304935 2:218851102-218851124 GGGGCAATGACATCAAAGGCAGG - Intergenic
946989282 2:225309750-225309772 GTGTGAATAACTTGGAAAGCAGG - Intergenic
948157055 2:235792100-235792122 AGGCCAGTAACTTGGGAGGCGGG - Intronic
948352081 2:237349111-237349133 GGGGTGATGACTTGGAAGGAAGG - Intronic
948657370 2:239485043-239485065 GGGGGAATGACTGAGAAGGCAGG + Intergenic
1169677129 20:8166735-8166757 GGGCCAAGAACTTGGAGGGAAGG - Intronic
1170697417 20:18671805-18671827 GGGGCAAGAAGTTTGAGGGCAGG + Intronic
1172577082 20:36017788-36017810 GGAGCAATAGGCTGGAAGGCTGG - Intronic
1173938610 20:46890978-46891000 AGGGCATTTACTTGGAAGACTGG + Intergenic
1178736598 21:35158048-35158070 GTGGCAATATCTTGTAGGGCTGG - Intronic
951453338 3:22864094-22864116 GGAGCAAACACTTTGAAGGCAGG + Intergenic
951986487 3:28627191-28627213 GTGGCAATACCTTGCAGGGCTGG + Intergenic
952965578 3:38619051-38619073 GAGGCTATATCTTGGAAGCCAGG - Intronic
953321145 3:41972915-41972937 GGGGCATAAATTTAGAAGGCAGG + Intergenic
953642783 3:44725193-44725215 GGGGCAAGAAACTGGAAGACTGG - Intergenic
954352159 3:50053669-50053691 GGGGCAGAAACTTGGTTGGCAGG - Intronic
955223687 3:57043949-57043971 GGGGCAAGAATTTGGAAGTGAGG + Intronic
957421691 3:79979601-79979623 GTGGCAATACCTTGCAGGGCTGG - Intergenic
957744167 3:84317248-84317270 GCGGCAATATCATGCAAGGCTGG - Intergenic
958451992 3:94284577-94284599 GTGGCAATAACTTTTAAGGATGG + Intergenic
958655695 3:97000080-97000102 TATGCAATAACTTGGAAGGCCGG - Intronic
959459481 3:106607206-106607228 GGGGGAATAACTAGGAATGGGGG - Intergenic
959991068 3:112632827-112632849 GGGGCCAGAACGTGGAGGGCCGG - Intronic
960126006 3:113999034-113999056 GTGGCAATACCTTGCAGGGCTGG + Intronic
961744871 3:129058213-129058235 GGGGCAATGTCCTGGAAGGATGG + Intergenic
968222909 3:196951659-196951681 GGGGTAAGAACTTGGAAGTGGGG - Intronic
971423739 4:26496476-26496498 GGGGGAAGAACTTGAAAGGGTGG - Intergenic
977976414 4:103271997-103272019 GTGGCAAGAACTTGCAAGGATGG - Intergenic
986570545 5:9160067-9160089 GGGGAAAGAACTTAGAAGACAGG + Intronic
988734538 5:34007629-34007651 GAGGCAAAAATCTGGAAGGCTGG + Intronic
990806220 5:59665782-59665804 GGAGCTATAACTTGGAAGAAGGG - Intronic
991427542 5:66507086-66507108 GTGGCAATATCTTGCAGGGCTGG - Intergenic
995483473 5:112615510-112615532 GTGGCAATACCTTGCAGGGCTGG - Intergenic
996061993 5:119042661-119042683 GGGACAATCTATTGGAAGGCGGG - Intronic
996522413 5:124441882-124441904 GGGGCAATAGACAGGAAGGCAGG - Intergenic
997179694 5:131815296-131815318 GTGGCAATAACTTGCAGGGAGGG + Intronic
998327262 5:141292355-141292377 GGGACAATAAGTTGGTAAGCAGG + Intergenic
1003283047 6:4710758-4710780 GAGGGAATAGCTTGGAAGGATGG - Intronic
1003352505 6:5331395-5331417 AGGGGTATAACTTGGCAGGCTGG - Intronic
1006899895 6:37493226-37493248 CGGGCGCTAACTTGCAAGGCTGG - Intronic
1007313382 6:40964279-40964301 GGGGGGATTTCTTGGAAGGCTGG - Intergenic
1007732511 6:43955788-43955810 GGGGCAATTCCTAGGAAGCCAGG + Intergenic
1012422847 6:99083972-99083994 GGAGCAATATGTTGCAAGGCAGG - Intergenic
1012505318 6:99939848-99939870 GATGCAATATCTTGGATGGCAGG + Intronic
1013208526 6:107966215-107966237 GGGGCAAAAAATTGGGAAGCTGG - Intergenic
1014151955 6:118067548-118067570 GGAGCAATATCTTGGAAGCCAGG + Intronic
1015242578 6:131042091-131042113 GGAGTAATTAGTTGGAAGGCGGG + Intronic
1015653829 6:135494967-135494989 GGGGCAGAAACTTAGCAGGCTGG + Intronic
1018422917 6:163654888-163654910 TGGGAAAAAAATTGGAAGGCGGG - Intergenic
1021121746 7:16803299-16803321 GGGGCCGTAACATGGAAGGCTGG + Intronic
1021304948 7:19021291-19021313 GTGGCAATACCTTGCAGGGCTGG - Intronic
1024736682 7:52312636-52312658 GTGGCAATAACTTGCATGGCTGG - Intergenic
1029358116 7:100067957-100067979 GGGGCAATAAATGGGAAAGTGGG + Intronic
1029477035 7:100791325-100791347 GGAAAAATAACTGGGAAGGCAGG - Intronic
1038444227 8:27592500-27592522 GTTGCAATAACGTGGAAGGATGG + Intergenic
1046521766 8:115334156-115334178 GGGTTAAAAACTTGGAAGGAAGG - Intergenic
1046606541 8:116377607-116377629 TTGGCAATAACTTAGGAGGCAGG + Intergenic
1056241062 9:84647072-84647094 GGGGCAATGACTTAGGTGGCTGG + Intergenic
1057004769 9:91547462-91547484 GTGGCAATACCTTGCAGGGCTGG - Intergenic
1060200470 9:121649371-121649393 GGGGCAGTAACTTGGAACTCAGG - Intronic
1060804941 9:126569383-126569405 GTGGCAATAGCTTGCAGGGCTGG - Intergenic
1062328127 9:136022517-136022539 GGGGCAACAGCAGGGAAGGCAGG - Intronic
1062696983 9:137880567-137880589 GAGGCAGGAACTTGCAAGGCTGG - Intronic
1189404373 X:40706388-40706410 GGGACTATAATTTGGAAGGAAGG - Intronic
1194448285 X:94012832-94012854 GAGGCAATAACTTTGCTGGCAGG - Intergenic
1194696199 X:97054175-97054197 AGGTCAATAACTGGAAAGGCTGG + Intronic
1196670424 X:118360906-118360928 GGAGCAATGACATGGAAGGAGGG - Intronic
1197522123 X:127511633-127511655 GTGGCAATATCTTGCAAGGCTGG + Intergenic
1198325285 X:135565182-135565204 CAGGGAATAATTTGGAAGGCAGG - Intronic
1198719306 X:139598282-139598304 GGCTCAATGACTGGGAAGGCTGG - Intronic
1199116995 X:144004507-144004529 TGGGCAGTATCTTGCAAGGCTGG + Intergenic
1201306554 Y:12555765-12555787 TGGGCAGTTACTTGGGAGGCTGG + Intergenic
1201368520 Y:13235083-13235105 GGGCCAAGAAGGTGGAAGGCTGG + Intergenic
1201904961 Y:19078089-19078111 GGAGAACTAACTTGCAAGGCAGG - Intergenic