ID: 1124146908

View in Genome Browser
Species Human (GRCh38)
Location 15:27136442-27136464
Sequence TTTTAACTTTAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124146902_1124146908 29 Left 1124146902 15:27136390-27136412 CCCTTAAATTATGTCTGAACATA 0: 1
1: 0
2: 0
3: 22
4: 302
Right 1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 216
1124146903_1124146908 28 Left 1124146903 15:27136391-27136413 CCTTAAATTATGTCTGAACATAA 0: 1
1: 0
2: 3
3: 23
4: 336
Right 1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124146908 Original CRISPR TTTTAACTTTAGAGGGTGGA AGG Intronic
900510766 1:3059813-3059835 TTTTCATTTTAGAGGATGGAAGG - Intergenic
901488519 1:9582707-9582729 TTTTAACTTAAGAGGATTCAGGG + Exonic
901622785 1:10602201-10602223 TTTTATTTTTAGGGGCTGGAAGG - Intronic
903048030 1:20579053-20579075 CTTGTACTTTAGAGGCTGGACGG - Intergenic
904451847 1:30618293-30618315 TTATAATTTTAGAAGTTGGAAGG - Intergenic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
906754882 1:48302224-48302246 TTATAGATTTAGAGGGTGCAAGG + Intronic
906821428 1:48934406-48934428 ATTTCACTTTAGAGAGTGAAAGG - Intronic
912022538 1:105123150-105123172 TATTATCTTTATATGGTGGAAGG + Intergenic
912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG + Intronic
912750606 1:112284050-112284072 TTGTAACTTGAGGGGGTTGAAGG - Intergenic
916496066 1:165348399-165348421 TTTTAATTTTGGAGGGTGATTGG - Intronic
916850479 1:168698111-168698133 TTTTCAGTTTAGAAGCTGGATGG - Intronic
917195975 1:172466116-172466138 TTTTATCTTAAGAGGTTGCAGGG + Intronic
917318475 1:173754160-173754182 TTTTAACAGGAGAGGCTGGAGGG + Intronic
919816572 1:201444494-201444516 TATGAACTTTAGAGGGAGGCTGG - Intergenic
920248001 1:204602735-204602757 TTTTAACTTGATATGGTGGCAGG + Intergenic
920352374 1:205345765-205345787 TTTATACTTTTGGGGGTGGAAGG - Intronic
923350735 1:233103137-233103159 TTTTAACTTTTGTGAGTGCATGG + Intronic
924114402 1:240730887-240730909 TTTTAAATTTAGAGATTAGAGGG - Intergenic
1062979371 10:1708996-1709018 TTTTAAATATGGAGGGAGGAGGG + Intronic
1063897989 10:10702284-10702306 ATTTAACTTTAGAGAGAGGAAGG + Intergenic
1065108843 10:22420075-22420097 TTTTAATTTTAGTGGGTTTAGGG + Intronic
1066303731 10:34119091-34119113 GTTTAACTTTAGAGGGTCTCAGG - Intronic
1067010358 10:42706275-42706297 TTTTCATTTGATAGGGTGGAGGG + Intergenic
1067312433 10:45126733-45126755 TTTTCATTTAATAGGGTGGAGGG - Intergenic
1067313392 10:45137296-45137318 TTTTCATTTGATAGGGTGGAGGG - Intergenic
1068923968 10:62515762-62515784 TTTTAACTTCCCAGGGAGGATGG + Intronic
1070214112 10:74357817-74357839 GTTTAACTTATGAGGATGGAGGG - Intronic
1071466051 10:85940665-85940687 CTTTAAATTTAAAGGGTGCAGGG + Intronic
1071661889 10:87512623-87512645 TGTTAATTTTAGAGGGTTCAAGG - Intronic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1073296850 10:102445477-102445499 TTTTATTATTAGTGGGTGGAGGG - Intergenic
1081769303 11:45637984-45638006 TTTTATCTTCAAAGGGTGCATGG + Intergenic
1082973376 11:59047720-59047742 TATGGACTCTAGAGGGTGGAGGG - Intergenic
1082977789 11:59091496-59091518 TATGGACTCTAGAGGGTGGAGGG - Intergenic
1085014376 11:73163264-73163286 TTTTACCTTAAGCTGGTGGAGGG + Intergenic
1086476037 11:87175757-87175779 ATTTAAGTTTAGTGGGTGGTTGG - Intronic
1087150546 11:94855616-94855638 ATCTAACTTTAGGGTGTGGACGG - Intronic
1087474031 11:98615192-98615214 TTTTTTCTTTAGTGGGTGGCTGG + Intergenic
1087551492 11:99656297-99656319 TTTGAAATTAAGAAGGTGGAGGG - Intronic
1088221402 11:107573935-107573957 TTTTAATTTTATAAGGTGCAAGG + Intergenic
1088354019 11:108922652-108922674 TGATAATTTTAGAGGGTCGAAGG - Intronic
1088856587 11:113760679-113760701 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
1089479212 11:118791499-118791521 TTTTTACTTTGGAGGGGCGAAGG - Intergenic
1090696365 11:129247026-129247048 TATTTACTATAGAGCGTGGAAGG - Intronic
1090934342 11:131328592-131328614 TTTGAACTTTTAGGGGTGGAGGG - Intergenic
1092597196 12:10020752-10020774 TTTTGACTGGAGAGGGTGTAGGG - Intergenic
1093183258 12:15990597-15990619 TTTGGAGTTTGGAGGGTGGAAGG - Intronic
1094592379 12:31833822-31833844 TTTTACCTTTAGCGGATAGAAGG + Intergenic
1094779957 12:33779306-33779328 TTTTAATTATAGAGGCTGTATGG + Intergenic
1094821698 12:34231246-34231268 TTTTAACTTTAGATCATGGAGGG + Intergenic
1097692650 12:62747683-62747705 TTTTACCTTGAGAGGGCAGAAGG - Intronic
1106034041 13:26027777-26027799 TTGTAGCTTTAGTAGGTGGAAGG - Intergenic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1107579163 13:41763789-41763811 TAATAACTTTAGAGGTGGGAAGG - Intronic
1108924435 13:55722707-55722729 TTTTTACTCTAAAGGGTAGAAGG - Intergenic
1109247488 13:59973827-59973849 TTTTATGTGTAGAGGGTGCATGG + Intronic
1112490686 13:99860614-99860636 CTTTAACTTAAGATGGGGGAGGG + Intronic
1113175846 13:107562980-107563002 TTTTGAATTCAGAGGTTGGAAGG + Intronic
1114158855 14:20139702-20139724 TTTTTACTTCACAGGGTAGAGGG - Intergenic
1114814530 14:25941851-25941873 TTTTGTCTTAAGTGGGTGGAGGG - Intergenic
1115053877 14:29098695-29098717 CTTTAATTTGAGAGGGTGGGAGG - Intergenic
1115300101 14:31875672-31875694 TTTTAAGTTGGGAGGGTGGGTGG + Intergenic
1115796328 14:36940446-36940468 TTTTAACTTTAAAGGCATGAGGG + Intronic
1116147927 14:41099567-41099589 CTGTGACTTCAGAGGGTGGAAGG + Intergenic
1116183309 14:41564149-41564171 TTTTAACTTTATAGGGAAGTTGG + Intergenic
1117712438 14:58545337-58545359 CTATAACTTTTTAGGGTGGAGGG - Intronic
1120863965 14:89279642-89279664 TGTTAATTTTTGAGAGTGGAGGG + Intronic
1121675638 14:95750508-95750530 TTATGACTTCAGAGGGAGGAAGG + Intergenic
1123951481 15:25281763-25281785 CTCTAACTTTATAGTGTGGATGG - Intergenic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1126521596 15:49601498-49601520 TTTTAATTTTTGTGGGTGCATGG + Intronic
1127382229 15:58439983-58440005 TTCTAACTTTCTAGGGTTGAAGG + Intronic
1128411112 15:67398711-67398733 TTTTAACTAAAGAGTGTGAAAGG - Intronic
1128443552 15:67737044-67737066 TTTTTACTTTAGAGGGATGGTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1138019942 16:53469836-53469858 TTTTAACATAAGAGCTTGGACGG + Intronic
1139412151 16:66772169-66772191 TTTTAACAGTAGAGGTTGGAGGG - Intronic
1140217638 16:73021303-73021325 TTTTAACTTGAGTGACTGGAAGG - Intronic
1144622816 17:16829322-16829344 TTTCTACATTGGAGGGTGGAAGG - Intergenic
1144883615 17:18443394-18443416 TTTCTACATTGGAGGGTGGAAGG + Intergenic
1145148613 17:20500992-20501014 TTTCTACATTGGAGGGTGGAAGG - Intergenic
1146089788 17:29865304-29865326 TTTTAACATCAGAGCTTGGAGGG + Intronic
1148003656 17:44407136-44407158 TTTTAAATTGGGAGGGGGGAAGG + Intronic
1151236586 17:72724522-72724544 TTTCCATTTCAGAGGGTGGAGGG - Intronic
1151632453 17:75320204-75320226 TTGGAACTTTAGGGGGTGGGAGG - Exonic
1153508090 18:5823941-5823963 TTTTAACTAGAGAGAGTGAATGG - Intergenic
1153510675 18:5848350-5848372 TTCTATCTTTGGAGGGTGAAAGG - Intergenic
1155109334 18:22698457-22698479 TTTTAAGATTAGAGAGTGGGTGG + Intergenic
1155727141 18:29101115-29101137 ATTTCACTTGAGAGGTTGGAGGG + Intergenic
1158164672 18:54526938-54526960 TTTTAACTTTAGAGACTGACAGG + Intergenic
1158194937 18:54874225-54874247 ATTTAACCTTATAGCGTGGAGGG - Intronic
1159888205 18:73930161-73930183 TTTTATCTTCAGAGGGTGTTTGG + Intergenic
1161831614 19:6609205-6609227 GCTTAACTTTAGTGGGTGCAGGG + Intergenic
1161860872 19:6797329-6797351 TTCTTACTTTAGAGTGTGAAGGG - Intronic
1163211516 19:15844355-15844377 TTTTTAATTTAGAGGCTGGGTGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164775835 19:30852973-30852995 TTCAAACATTTGAGGGTGGAGGG - Intergenic
1166616232 19:44249873-44249895 CTGTAACTCTAGGGGGTGGAGGG - Intronic
1168127344 19:54292796-54292818 TCTTTACTCTAGAGGGTAGACGG + Intergenic
1168127347 19:54292833-54292855 TGTTTACTCTAGAGGGTAGATGG + Intergenic
1168173028 19:54602121-54602143 TGTTTACTCTAGAGGGTAGACGG - Intronic
1168173037 19:54602232-54602254 TGTTTACTCTAGAGGGTAGACGG - Intronic
1168387563 19:55978220-55978242 TTTAAGTTTTAGAGGGGGGAGGG + Intronic
925619462 2:5777030-5777052 TTTCAGATTTAGAGGGTGGGTGG - Intergenic
925762868 2:7203377-7203399 TCTTAACTTTGGGGGGGGGAAGG - Intergenic
927277811 2:21276405-21276427 TTTTAAACTTTGAGGGTGAAGGG + Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
928502770 2:31914613-31914635 TTTTAATTTTTGTGGGTGCATGG - Intronic
929145813 2:38706307-38706329 TTTTAACTTTAGATCATGGAGGG + Intronic
931803878 2:65785866-65785888 TTTTAGCCTGAAAGGGTGGAGGG + Intergenic
932849240 2:75168240-75168262 TTTAAACTTTTGGGAGTGGAGGG - Intronic
934072432 2:88396858-88396880 TTTTATTTTTGGAGGGAGGATGG - Intergenic
937721704 2:125104738-125104760 TTTTAATCTTAGAGGGAGGGAGG + Intergenic
938003016 2:127761001-127761023 TTTGAAATTTAGAGTGTGCAGGG - Intronic
938990825 2:136627999-136628021 TTTTAACTTTAGTGAGCAGATGG + Intergenic
940414943 2:153408775-153408797 TGTTAACTTTATTGGGTTGAAGG + Intergenic
940650956 2:156439986-156440008 TTTTGAATTTAGCGGGTTGAGGG - Intronic
941269874 2:163411969-163411991 TTTCAACTAGACAGGGTGGAAGG + Intergenic
942238310 2:173934537-173934559 AGTTAACTTTAAAGGGTGTAAGG - Intronic
943839759 2:192564231-192564253 TATTAAATATAGAGGGGGGAGGG - Intergenic
944192491 2:197018364-197018386 ATTTAACTATAGAGGGAGGCTGG - Intronic
944468178 2:200024731-200024753 TTATAACTTAAAAGGATGGATGG - Intergenic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1170219098 20:13922944-13922966 TTAGAGCTTTATAGGGTGGATGG + Intronic
1170238890 20:14140628-14140650 TTTTTGCTTGAGAGGGTGGTAGG + Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1173922724 20:46758180-46758202 TTTGAAATTTAGGGGGTGGGGGG + Intergenic
1174277057 20:49411546-49411568 TTTTGAGCTTAGAGGGTGGAGGG + Intronic
1175744704 20:61447642-61447664 TTTTAGCTTGAGATGGTGCATGG + Intronic
1178128846 21:29546408-29546430 TTTTTACTTCACAGGGTGAAGGG - Intronic
1184942612 22:47780276-47780298 TTTCAACATCACAGGGTGGAAGG + Intergenic
951712220 3:25594826-25594848 TTTTTTTTTTAGAGGGGGGAGGG - Intronic
957228416 3:77478880-77478902 TTAAACCTTTAGAGGGTGAAGGG - Intronic
957525293 3:81371892-81371914 TTATGACTTTGGAGGGTGGATGG - Intergenic
957566545 3:81891432-81891454 TGTTACCTTTAGAGTGTGGTTGG - Intergenic
960379087 3:116938270-116938292 TTTTGTGATTAGAGGGTGGAGGG - Intronic
962122234 3:132574074-132574096 CATTAACTTTAAAAGGTGGAAGG + Intronic
964223654 3:154372371-154372393 TTTTAGTTTTGGAGGGCGGAAGG - Intronic
965055891 3:163715675-163715697 TTTTATTTTTGGGGGGTGGAGGG - Intergenic
970598114 4:17618313-17618335 TTTTTTCTTGAGTGGGTGGAGGG + Intronic
970737203 4:19186622-19186644 TTTTAAATTTAGCAGGTGAAAGG - Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972625803 4:40797505-40797527 TTTTAGCCTAAGCGGGTGGAAGG - Intronic
973294129 4:48496698-48496720 TTTTAAGTTGAGAGGTTAGAAGG + Intergenic
974175462 4:58316448-58316470 TTTTTACATTAAATGGTGGATGG + Intergenic
975810096 4:78159136-78159158 TTCTTTCTTCAGAGGGTGGAGGG - Intronic
976100659 4:81559493-81559515 TATTAAATTAAAAGGGTGGAAGG + Intronic
976111387 4:81677532-81677554 ATTTAAATTTAGTGTGTGGAAGG - Intronic
976459419 4:85291507-85291529 TTTTAACTTTAGGGTGTTGTAGG + Intergenic
977807205 4:101315175-101315197 TTGTAACTTCACATGGTGGAAGG - Intronic
978378279 4:108098221-108098243 TATGCAGTTTAGAGGGTGGAAGG + Intronic
979744082 4:124188077-124188099 TTTTAACTTTAGAAGTAGAATGG - Intergenic
982042502 4:151409506-151409528 CTTTTATTTTAGAGGGTTGAAGG + Intronic
983008668 4:162518352-162518374 TTTTAACTGTGGAGGTTGTAGGG + Intergenic
983880456 4:172926325-172926347 TTTGAATTTGATAGGGTGGATGG + Intronic
986314628 5:6578295-6578317 TGTTCATTTTAGAGGATGGATGG - Intergenic
987206780 5:15635549-15635571 TTTTTAATTTATAGAGTGGATGG + Intronic
987377758 5:17252266-17252288 TTCTAACTTTAGAGGTGGGCAGG + Intronic
987885941 5:23812273-23812295 TTTTATTTTTAGGGGGTGAAAGG + Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
989446228 5:41532714-41532736 TTTTATTTGTAGAGGGTTGACGG - Intergenic
989709855 5:44385258-44385280 TTATAATTTTTGAGGGTGGGGGG - Intronic
990231068 5:53713143-53713165 TTTTAACTTTTTTGGGTGGGTGG - Intergenic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
995825405 5:116291997-116292019 TTTTAAAGTTGGGGGGTGGAGGG - Intronic
996558736 5:124805783-124805805 TTTTAACTCTAGAGATTGAAGGG + Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
999463314 5:151775780-151775802 TTTTAACTTTGGAGTGGGGAAGG + Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1000692462 5:164340578-164340600 GTTTAACTTTAGGGCATGGAAGG - Intergenic
1003378642 6:5602686-5602708 TTTTAACCTTGGAAGGTGCATGG + Intronic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1004382971 6:15148462-15148484 ATTTCACTTTAGAGGAGGGAGGG + Intergenic
1005002845 6:21260084-21260106 TTTTAACTGTGGGGAGTGGAGGG + Intergenic
1006264461 6:32907205-32907227 TTTTATCTGAATAGGGTGGATGG - Intergenic
1011168424 6:84477529-84477551 TTTTAATTTTTGAAGGTAGAAGG - Intergenic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014974217 6:127859065-127859087 TTTTAACTTTGTAGGGAAGATGG - Intronic
1015217206 6:130763759-130763781 TTTTTCCTTTAGTGGGTGGTTGG - Intergenic
1018426059 6:163682133-163682155 TTTTAACTTTATACGTTGGTGGG + Intergenic
1019902439 7:4032153-4032175 TTTTATCTTAAGAGTGTTGATGG + Intronic
1021007402 7:15415779-15415801 TTTTAACTTAAAACTGTGGAAGG - Intronic
1021203318 7:17751207-17751229 TTTTATCTTTTGTGGGTGGGTGG + Intergenic
1023619799 7:42058638-42058660 TATTAACTTTGGAGGGGGCAGGG + Intronic
1023857836 7:44195819-44195841 TATTAATCATAGAGGGTGGAAGG - Intronic
1027772242 7:82421483-82421505 TTTGAATTTTAGAGGGGAGAGGG + Intronic
1030421051 7:109306707-109306729 TTGTCACTTTACATGGTGGAAGG + Intergenic
1031146481 7:118002699-118002721 TTTTAAATTTACAGGGTACAAGG + Intergenic
1033248032 7:139735089-139735111 TTTTCACTGTCGAGGGGGGAAGG + Intronic
1034097545 7:148424202-148424224 GGGTACCTTTAGAGGGTGGAGGG + Intergenic
1035682865 8:1501266-1501288 TTTGAACTGTTGAGTGTGGAGGG + Intergenic
1039014125 8:33127299-33127321 TTTTGACTTGATAGGGTCGAGGG - Intergenic
1041269754 8:56099815-56099837 TTTTGACTTTAGAAAGTGGCTGG + Intergenic
1042164446 8:65932004-65932026 TTATAACTTTACAGAGAGGAAGG + Intergenic
1042411397 8:68470641-68470663 TTATAATTCTGGAGGGTGGATGG + Intronic
1043138825 8:76562219-76562241 TTTTAATTATAGTGGGCGGAAGG + Intergenic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1044386124 8:91590844-91590866 TACTGACTTTGGAGGGTGGAAGG + Intergenic
1048934493 8:139343782-139343804 TTCTAACTTCACAGGGAGGAGGG + Intergenic
1052240945 9:26272645-26272667 TTTTAACTTTGTAAGCTGGATGG - Intergenic
1053390924 9:37735535-37735557 CTGTAACTGCAGAGGGTGGAAGG - Exonic
1056200231 9:84268462-84268484 TTATGACTTTAGAGTGGGGATGG + Intergenic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057236974 9:93368865-93368887 TTTTAACTTTTGTGGGTACATGG + Intergenic
1057349694 9:94285428-94285450 TTATATCTTTGGAGGTTGGAAGG + Intronic
1058732375 9:107862480-107862502 ATGTGACTTCAGAGGGTGGAAGG - Intergenic
1059906157 9:118989199-118989221 TTTTGACCTTAGAAAGTGGAGGG + Intergenic
1060154008 9:121306288-121306310 CTCTGAGTTTAGAGGGTGGAGGG + Intronic
1186340774 X:8644197-8644219 TTTTTACTTTACAGGCTGAATGG - Intronic
1186439793 X:9575931-9575953 TTTTACCTTTAAATGGAGGAGGG + Intronic
1186642506 X:11471283-11471305 TTTTAACTTTCAAGTGTGAAAGG - Intronic
1187010144 X:15270256-15270278 TTGTAACTTTTGAGAGTGAAGGG + Intronic
1188013840 X:25086069-25086091 ATTTATTTTTAGGGGGTGGAGGG + Intergenic
1188604016 X:32006008-32006030 CTTTAGCTTTAGACGGTGGGTGG + Intronic
1189703709 X:43738309-43738331 TTTTAATTTTAAAGGGAAGAAGG + Intronic
1190846410 X:54196030-54196052 TTTTCACTTTATAGGTTGTATGG + Exonic
1190847498 X:54207894-54207916 TTTTACCTGTAGTGGGTTGAGGG - Intronic
1192276959 X:69642192-69642214 TTTTAGCTTTAGAGGCTGAAAGG + Intronic
1193098997 X:77586272-77586294 TTTTAATTTTTGTGGGTGCATGG - Intronic
1194318840 X:92417644-92417666 TTTTACCTTTAGAGTGAGCAAGG - Intronic
1194487968 X:94509960-94509982 TGTTAACACTAGTGGGTGGAGGG + Intergenic
1194837582 X:98699569-98699591 ATTTCAGTTTAGAGGGTGGCTGG - Intergenic
1195532058 X:105968775-105968797 AATGAAATTTAGAGGGTGGAGGG + Intergenic
1196322702 X:114360977-114360999 TTTTAACTTTTGTGGGTACATGG - Intergenic
1197291283 X:124661588-124661610 TCTTAACTTTGGATGGTGGCAGG + Intronic
1198370432 X:135984340-135984362 TTTTTAGTTTTGAGGGTGGTAGG + Intergenic
1200626973 Y:5530799-5530821 TTTTACCTTTAGAGTGAGCAAGG - Intronic
1201773977 Y:17644722-17644744 ATGAAACTTCAGAGGGTGGAAGG - Intergenic
1201827580 Y:18261267-18261289 ATGAAACTTCAGAGGGTGGAAGG + Intergenic