ID: 1124147163

View in Genome Browser
Species Human (GRCh38)
Location 15:27138607-27138629
Sequence GTGTCCAGATGAAGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124147163_1124147166 0 Left 1124147163 15:27138607-27138629 CCTGGATGCCTTCATCTGGACAC 0: 1
1: 0
2: 4
3: 8
4: 158
Right 1124147166 15:27138630-27138652 CTTTCTTCACCCTGAAGTGTTGG 0: 1
1: 0
2: 2
3: 13
4: 194
1124147163_1124147169 23 Left 1124147163 15:27138607-27138629 CCTGGATGCCTTCATCTGGACAC 0: 1
1: 0
2: 4
3: 8
4: 158
Right 1124147169 15:27138653-27138675 ACGTCCTTTGTGCCAATCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124147163 Original CRISPR GTGTCCAGATGAAGGCATCC AGG (reversed) Intronic
900538439 1:3190656-3190678 GTGTCCAGATGGAGGAGGCCAGG - Intronic
900902412 1:5526196-5526218 GTGTCCAGAAAAAGGCACCTTGG - Intergenic
901989077 1:13097830-13097852 GTCTCCTGCTGAAGGCCTCCAGG + Intergenic
901992736 1:13128937-13128959 GTCTCCTGCTGAAGGCCTCCAGG - Intergenic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907183298 1:52589613-52589635 GTTACCAGTTGAAGGTATCCAGG - Intergenic
910085318 1:83395003-83395025 GTTTGAAGATGAAGGCAACCAGG - Intergenic
910213405 1:84817035-84817057 GTGTCCAGAGGTACGCATCTGGG - Intronic
911091443 1:94020567-94020589 GTGTCCAGAGGAAGACACCAAGG + Intronic
916252891 1:162755545-162755567 GTGTCCAGATGGAGTCCTGCTGG + Intronic
917185273 1:172346970-172346992 ATGTCCAGAAGAATGCAGCCAGG + Intronic
918041350 1:180916040-180916062 CTGTCCAGATGAAAGTAACCTGG - Intronic
918573621 1:186028193-186028215 GTGTCAAGAAGAAGGTATTCTGG + Intronic
919475216 1:198024473-198024495 GTATCCAGATGAATGCATCCAGG + Intergenic
920292192 1:204930975-204930997 TTGTCCAGAAAAAGTCATCCAGG - Intronic
920674431 1:208029437-208029459 TTGTCCGGAAGAAGGCAGCCAGG + Intronic
922556037 1:226532776-226532798 GTGTCTAGATAAAAGGATCCTGG + Intergenic
923034871 1:230278840-230278862 GTGCCCAGACCAAGGCCTCCAGG + Intronic
923053034 1:230402074-230402096 GAGTCCAGATGAAGCCTTTCAGG + Intronic
1064192522 10:13220077-13220099 GTGTCCACAGGAAGGAATGCAGG - Intergenic
1070046832 10:72846778-72846800 GGGTCCAGATGGAGGGAACCAGG + Intronic
1071459182 10:85876250-85876272 GTCTCCAAAGGAGGGCATCCTGG - Intronic
1073392567 10:103192024-103192046 TTATCCAGATGAAGACATCCAGG - Intronic
1073584373 10:104694459-104694481 TTGTCCTGAGGAAGGGATCCTGG - Intronic
1073831836 10:107393440-107393462 GGATCCCGATGAAGCCATCCAGG + Intergenic
1075602416 10:123779971-123779993 GTGACCAGAGGAAGGCTTCCTGG - Intronic
1075797438 10:125130795-125130817 CTGTTCAGATCAAGGCAACCTGG - Intronic
1076518307 10:131062489-131062511 GTCTCCAGGTGAGGGCCTCCAGG + Intergenic
1077958377 11:7046501-7046523 GTGCCCAGAGGAAGACTTCCTGG + Intronic
1078724459 11:13917167-13917189 ATGTGCAGATGAGGTCATCCAGG + Intergenic
1080895300 11:36444111-36444133 GTGTGCAAATGAAAGCATCTTGG + Intronic
1081659917 11:44881789-44881811 GTCTCCAGTTGCAGGCACCCAGG + Intronic
1081879367 11:46434906-46434928 CTTTCCTGATGAAGGCATCCTGG - Exonic
1084618113 11:70250089-70250111 ATCTCAAGATGAAAGCATCCTGG - Intergenic
1090359462 11:126162555-126162577 GTGTGCAGATGGAGGCAGCAAGG - Intergenic
1091685353 12:2557597-2557619 TTCTCCAGATGAAGGCATGGGGG - Intronic
1094028541 12:25984978-25985000 GTGTCCAGAGGAAAGCATCCAGG + Intronic
1095245214 12:39911881-39911903 CTGTCCATCTGAAAGCATCCTGG - Intronic
1096067897 12:48755612-48755634 GATTCCATAGGAAGGCATCCAGG + Intergenic
1096474353 12:51899084-51899106 GTGTCCACATGATGGCATGGAGG - Intergenic
1097603468 12:61723762-61723784 ATGTCCAAATGAATGCATCAAGG + Intronic
1099001188 12:77179706-77179728 GTCCCCAGCTGAAGCCATCCTGG - Intergenic
1099838186 12:87934394-87934416 GTCTCCAGAGGAAAGTATCCTGG + Intergenic
1101800696 12:108019521-108019543 CTGTGCAGTTGAAAGCATCCAGG - Intergenic
1104050279 12:125189978-125190000 GTGGCGAGATGGAGGCACCCTGG + Intronic
1104645612 12:130495260-130495282 GTGTCCAGAGGCATGAATCCAGG - Intronic
1108559266 13:51627124-51627146 GTGTCCAGATGAGGGGAACATGG + Intronic
1113552862 13:111206525-111206547 CTGTTCAGATGAAAGCATCGAGG + Intronic
1113863838 13:113508662-113508684 GTGTTCAGATGAAGTGAGCCCGG + Intronic
1113946169 13:114044769-114044791 CTGTCCAGCTGAAGGCGTCTTGG - Intronic
1115718625 14:36134650-36134672 GTGTACAGATGAGGGCATTGTGG - Intergenic
1118441162 14:65812939-65812961 TTTTCCAGATGAAGGCATTGAGG + Intergenic
1124147163 15:27138607-27138629 GTGTCCAGATGAAGGCATCCAGG - Intronic
1125081791 15:35683088-35683110 GCATCCAAATGAAGCCATCCTGG + Intergenic
1129908027 15:79203399-79203421 GTGTCCAGAGCAAGGCATGGAGG + Intergenic
1130964682 15:88688192-88688214 ATCTCAAGATGAAGTCATCCTGG - Intergenic
1131553264 15:93375936-93375958 ATCTCCAGATGAAGTCCTCCTGG + Intergenic
1140795801 16:78436313-78436335 GCGTCCAGGTGAAGGGACCCTGG + Intronic
1141805343 16:86337998-86338020 GTGTCCAGGTGGTGGCACCCAGG - Intergenic
1142602710 17:1062168-1062190 GTGTCTAGAGGAAGGCACCACGG - Intronic
1142608679 17:1096300-1096322 GTGTTCAGATGAAAGCAAACAGG + Intronic
1144589315 17:16510776-16510798 GTGTCAAGATTAAGAAATCCTGG + Intergenic
1145389386 17:22444017-22444039 GTTTCCAGAGGAAAGCAGCCCGG - Intergenic
1146550610 17:33777373-33777395 GGGTCATGATGAAGGCAGCCAGG + Intronic
1147117433 17:38311898-38311920 CTGAACAGATGAAGGCATCTAGG + Intronic
1148412253 17:47477690-47477712 CTGAACAGATGAAGGCATCTAGG - Intergenic
1148566744 17:48637383-48637405 GTGCCCAGATGAAGACCTACTGG + Intergenic
1151122515 17:71808559-71808581 GGGTACAGGTGGAGGCATCCTGG - Intergenic
1154159786 18:11972578-11972600 GTGTCCTGAGGAAGGAAACCAGG - Intergenic
1158058380 18:53309386-53309408 ATCTCAAGATGAAGTCATCCTGG - Intronic
1158629115 18:59096627-59096649 GTGTCCAAATGGAAGCATGCAGG - Intergenic
1160513064 18:79463301-79463323 GTGTTCAGAGGAAGGAGTCCCGG + Intronic
1161275475 19:3414123-3414145 ATGTACAGATGAAGAAATCCAGG + Intronic
1161849627 19:6731721-6731743 GAGGCCAGATAAAGGCATTCGGG + Intronic
1162562393 19:11424164-11424186 GGGGCCAGATAAAGGCACCCGGG + Intronic
1162721604 19:12666116-12666138 GTTTCCAGATGAAGGCACTGAGG + Intronic
1164377963 19:27706064-27706086 GTTTCCAGATGGATGCAACCAGG + Intergenic
1164532605 19:29059758-29059780 GTCACCAGATGAGGGCAGCCTGG - Intergenic
1165417782 19:35705381-35705403 GTGTGCACATGAAGGTTTCCTGG + Intronic
1165953942 19:39489942-39489964 GTCTCCAGATGGGGGCATCAGGG + Exonic
925053294 2:834150-834172 GTTTCCTGATGGTGGCATCCTGG - Intergenic
926102388 2:10126910-10126932 GTGTCAAGAAGAAGGCAGACTGG + Exonic
929939993 2:46326338-46326360 GTGTACAGAAGACTGCATCCTGG - Intronic
931093765 2:58916398-58916420 TTTTGCAGATGAAGACATCCAGG - Intergenic
936034264 2:109098084-109098106 GAGTCCTGAGGAAGGGATCCTGG - Intergenic
936055847 2:109261301-109261323 GTGTGCGGATCAAGGCTTCCTGG - Intronic
939873799 2:147554070-147554092 ATGTTTAGATGAAGGCGTCCCGG + Intergenic
940111083 2:150154791-150154813 ATCTCCAGATGAAATCATCCTGG + Intergenic
940552033 2:155171462-155171484 TTGTCCAGATGAAGCCAACCAGG - Intergenic
941451361 2:165664641-165664663 GTATCCAGAGGAAGGAAACCAGG - Intronic
942816989 2:180063623-180063645 GTGTCCAGGTCATGGCATGCTGG + Intergenic
1170316023 20:15042403-15042425 GTGGCCAGGTGAGGGCATACTGG - Intronic
1170356932 20:15503000-15503022 TTGTCCAGAAAAAGGCACCCAGG + Intronic
1172998771 20:39090753-39090775 GTCCCCAGAAGAAGCCATCCAGG - Intergenic
1178538451 21:33429540-33429562 GTGTCCAGGGGTAGGCTTCCAGG + Intronic
1181034062 22:20161563-20161585 GTGCCCACATGCAGGAATCCAGG + Intergenic
1182287176 22:29255339-29255361 CTGGCCAGATGATGGCTTCCAGG - Intronic
1183425745 22:37738577-37738599 GTGGACAGATGCATGCATCCTGG + Intronic
1184583316 22:45431170-45431192 GTGTCCAGATGAGGACCACCAGG - Intronic
952372219 3:32733809-32733831 ATGTCCAGAAGAGGGCATCTTGG + Intronic
953467223 3:43133097-43133119 GTGGGCAGATGAAGGCATGGGGG + Intergenic
956608940 3:71102234-71102256 CTGTCTAAATGAAGTCATCCCGG - Intronic
956775222 3:72559341-72559363 ATTACCAGATGAAGGCATTCAGG - Intergenic
959630377 3:108500796-108500818 GTCTCAAGATGATGACATCCAGG + Intronic
961043985 3:123696307-123696329 GTGACAACAGGAAGGCATCCTGG + Intronic
961134760 3:124499917-124499939 AAATCCAGATGAAGGCAACCTGG - Intronic
962975425 3:140442008-140442030 GGGCCCTGATGAAGACATCCTGG + Intronic
963065004 3:141256702-141256724 GGCTCCAAAAGAAGGCATCCTGG + Intronic
968869692 4:3235409-3235431 GTGTGCAGAGGAAGACAGCCAGG - Intronic
969069823 4:4527099-4527121 GTCCCCAGATGAAGGCGTCGTGG - Intronic
969940178 4:10724243-10724265 GTATCCAGCAGAAAGCATCCTGG - Intergenic
971016138 4:22491059-22491081 GTGTCCAGCTGAAAACATCCAGG + Intronic
974043629 4:56879013-56879035 GAGTTCAGATGAATGCTTCCTGG + Intergenic
979492154 4:121340289-121340311 GTGTGGAGATGAAGGCAAACAGG + Intronic
979760993 4:124404843-124404865 ATCTCAAGATGAAGTCATCCTGG + Intergenic
980294462 4:130892952-130892974 GCCTCAAAATGAAGGCATCCGGG + Intergenic
982293729 4:153805916-153805938 GCGTACAGATGAAGACAGCCAGG + Intergenic
984814584 4:183824861-183824883 GTGCCCAGATGGGGGCTTCCAGG + Intergenic
986572505 5:9180160-9180182 AAGTCCAGATGAAGTCATACTGG - Intronic
986716597 5:10528784-10528806 TTGTCAAGATGAAGTCATGCTGG + Intergenic
990739025 5:58893511-58893533 GTATCCAGAAGCAGGCATCAGGG + Intergenic
996835476 5:127787230-127787252 GTGACCAGGTGGAGGCATCAGGG - Intergenic
1000338505 5:160259628-160259650 GGTTCCAGCTGAAGGCCTCCAGG + Exonic
1000846876 5:166292611-166292633 GTGTTCAAATCAAGGCAGCCAGG - Intergenic
1001811576 5:174632618-174632640 GGACCCAGATGCAGGCATCCAGG - Intergenic
1002108024 5:176889783-176889805 GTGGCCAGAGGAGGGAATCCAGG + Intronic
1002870651 6:1164676-1164698 CTGTCCAGATGAAAGCGTCATGG - Intergenic
1003050290 6:2774555-2774577 GTCTCAAGATGAAATCATCCTGG - Intronic
1003168233 6:3699972-3699994 CTGTCCAGATGGAGGGATCAGGG + Intergenic
1005391617 6:25339701-25339723 GTGTCCAGATGCAGGGATAGTGG + Intronic
1005519403 6:26585847-26585869 GTATCCAGATGGATACATCCAGG - Intergenic
1006097286 6:31664043-31664065 GGGTCCACCAGAAGGCATCCCGG + Exonic
1006190370 6:32203971-32203993 ATGTGCAGGTGAAGGGATCCTGG + Intronic
1007546582 6:42698933-42698955 GTGTAGAGGTGAAGGCACCCAGG - Intronic
1008154739 6:48000117-48000139 GTTACAAGATGGAGGCATCCTGG + Intronic
1017655877 6:156629208-156629230 GTATCCAGAAGAAGGCATTGCGG + Intergenic
1020032864 7:4945075-4945097 GTGTCCAGAAGAAGGGGTCGGGG - Intronic
1020187402 7:5969826-5969848 GTGTCCAGAGGATGGCATCCAGG - Intronic
1020295514 7:6754944-6754966 GTGTCCAGAGGATGGCATCCAGG + Intronic
1023772499 7:43571010-43571032 CTGTCCAGATGTAGGAGTCCAGG + Intergenic
1025262412 7:57427513-57427535 GTCTCCTGATGAAGTCACCCTGG - Intergenic
1027302192 7:76851469-76851491 GTTTGAAGATGAAGGCAACCAGG - Intergenic
1030084357 7:105804072-105804094 TTGGCCAGGTGGAGGCATCCTGG - Intronic
1034672944 7:152871449-152871471 GTGGCCAGATGCAAGCATACGGG - Intergenic
1035068215 7:156123109-156123131 GTGTCCTGCTGAAGCCACCCTGG + Intergenic
1035226866 7:157438506-157438528 GGGCTCAGATGAAGTCATCCTGG + Intergenic
1035542791 8:454932-454954 GTATCCAGGTGATGGCCTCCTGG + Intronic
1035724889 8:1818150-1818172 CGGTGAAGATGAAGGCATCCTGG - Intergenic
1039573149 8:38602928-38602950 GAGTTCAGATGAGGTCATCCTGG + Intergenic
1039761603 8:40582874-40582896 GTGTCCAGTTGAAGCCCTACTGG + Intronic
1039764993 8:40619123-40619145 GTGGCCAGCTGAAAGCATCAGGG - Intronic
1039940379 8:42085192-42085214 GCCTCCTGATGCAGGCATCCAGG + Intergenic
1040587447 8:48756965-48756987 GTGTCCTGATGGAGCCATCTTGG - Intergenic
1041151865 8:54943674-54943696 GTGTCCAGATGAGGGGAACGTGG + Intergenic
1041807644 8:61870701-61870723 GTTACCAAATGAAGGCATCCTGG - Intergenic
1047783518 8:128131250-128131272 GTGTTCAGAAGAAAGCATCCAGG - Intergenic
1051911269 9:22155238-22155260 GTCTCCTGATGAAGTCACCCCGG - Intergenic
1056926122 9:90835785-90835807 GTGTCCAGATGGAGGCTAACAGG - Intronic
1060055897 9:120412708-120412730 GTCTGCAGCTGAAAGCATCCTGG + Intronic
1060723760 9:125994526-125994548 GTGGCCAAATGCAGGCATCCAGG - Intergenic
1062149214 9:135008931-135008953 TAGTCCAGATGAGGTCATCCCGG + Intergenic
1062251364 9:135596998-135597020 GAGTCCAGATGGAGGGAACCAGG - Intergenic
1062545688 9:137062917-137062939 GTCTCCTGATGAAGTCACCCCGG + Exonic
1203769505 EBV:41674-41696 GTGTGCAGATGCAGGTCTCCGGG + Intergenic
1185838830 X:3369741-3369763 ATGTCAAGATGAAGTCATGCTGG - Intergenic
1186182713 X:6988574-6988596 GGCTCCAGAGGAAGGCCTCCAGG - Intergenic
1187666775 X:21621150-21621172 GAGTCCAGATGAGGGTAGCCAGG - Intronic
1188242395 X:27808510-27808532 GTCAGCAGAGGAAGGCATCCAGG + Intronic
1188310981 X:28616341-28616363 ATGTACAGATCAAAGCATCCTGG + Intronic
1200790019 Y:7291377-7291399 ATCTCCAGATGAGGCCATCCTGG - Intergenic
1201236942 Y:11921054-11921076 ATGTCAAGATGAAGTCATGCTGG + Intergenic