ID: 1124147683

View in Genome Browser
Species Human (GRCh38)
Location 15:27143328-27143350
Sequence CCCAGTGCTTAGAGAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29035
Summary {0: 1, 1: 14, 2: 246, 3: 3277, 4: 25497}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124147683_1124147687 4 Left 1124147683 15:27143328-27143350 CCTTAGCCTCTCTAAGCACTGGG 0: 1
1: 14
2: 246
3: 3277
4: 25497
Right 1124147687 15:27143355-27143377 CAGGTGTGAGCTACCATATCTGG 0: 2
1: 101
2: 1863
3: 18075
4: 61187
1124147683_1124147689 9 Left 1124147683 15:27143328-27143350 CCTTAGCCTCTCTAAGCACTGGG 0: 1
1: 14
2: 246
3: 3277
4: 25497
Right 1124147689 15:27143360-27143382 GTGAGCTACCATATCTGGCTGGG 0: 1
1: 0
2: 23
3: 291
4: 1664
1124147683_1124147688 8 Left 1124147683 15:27143328-27143350 CCTTAGCCTCTCTAAGCACTGGG 0: 1
1: 14
2: 246
3: 3277
4: 25497
Right 1124147688 15:27143359-27143381 TGTGAGCTACCATATCTGGCTGG 0: 2
1: 2
2: 40
3: 410
4: 1355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124147683 Original CRISPR CCCAGTGCTTAGAGAGGCTA AGG (reversed) Intronic
Too many off-targets to display for this crispr