ID: 1124149161

View in Genome Browser
Species Human (GRCh38)
Location 15:27161382-27161404
Sequence CACACTGCCCCCATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124149161_1124149167 24 Left 1124149161 15:27161382-27161404 CCAAGTTCCATGGGGGCAGTGTG 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1124149167 15:27161429-27161451 AGCAGAGGAACCCTGAACTTAGG 0: 1
1: 1
2: 17
3: 102
4: 323
1124149161_1124149164 9 Left 1124149161 15:27161382-27161404 CCAAGTTCCATGGGGGCAGTGTG 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1124149164 15:27161414-27161436 ACCAGTTTGTGCCACAGCAGAGG 0: 1
1: 0
2: 2
3: 28
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124149161 Original CRISPR CACACTGCCCCCATGGAACT TGG (reversed) Intronic
902153016 1:14460288-14460310 CAAGCTGCCCCCAAGGCACTGGG + Intergenic
905292552 1:36932366-36932388 CACTCTGGCCCCGTGGGACTTGG + Intronic
913197911 1:116473375-116473397 GACCCTGTCCTCATGGAACTTGG + Intergenic
915599307 1:156912649-156912671 CCCATTGTCCCCAGGGAACTGGG + Intronic
919611630 1:199752140-199752162 CACATTGCTCACATGGCACTGGG + Intergenic
920705185 1:208245078-208245100 CCCAATGCCCCCATGCAAGTCGG - Intergenic
921814346 1:219546919-219546941 AACACTGCCTCAATGGATCTAGG - Intergenic
922235684 1:223720968-223720990 CTCAGTTCCCCCAGGGAACTTGG + Intronic
924721669 1:246628735-246628757 CACACTATCCCCTGGGAACTCGG + Intronic
1062818788 10:518931-518953 GACACGGCCACCATGGAAGTGGG - Intronic
1064160059 10:12937679-12937701 CATACTGTCCCTATGGAACAAGG - Intronic
1065687217 10:28298327-28298349 CACTCTGTACCCATGGATCTAGG - Intronic
1065770435 10:29073194-29073216 CCCACTGCAGCCATGGAACTTGG - Intergenic
1068163867 10:53303080-53303102 CACTTTCCTCCCATGGAACTGGG - Intergenic
1071025547 10:81108587-81108609 CACCCTGGGCCCATGGAACAAGG - Intergenic
1075315932 10:121453621-121453643 CACACTGCCCACAACCAACTTGG - Intergenic
1079485253 11:20929459-20929481 CACACTGCACCCATTGCTCTGGG + Intronic
1084052205 11:66607259-66607281 TACACTGCCTGCTTGGAACTGGG + Intergenic
1084605433 11:70169298-70169320 CACACTGCCCCCACTGACCAAGG + Intronic
1086931132 11:92694522-92694544 CACAATGCCTACATGTAACTGGG - Intronic
1092720100 12:11432942-11432964 CACACTCCCCCCAGGTAAGTGGG - Intronic
1096993009 12:55820352-55820374 GACACGAACCCCATGGAACTGGG - Exonic
1097455337 12:59792806-59792828 CACCCCTCCCCCAGGGAACTTGG + Intergenic
1101030735 12:100656323-100656345 GACCCTGCCCTCAGGGAACTCGG - Intergenic
1102452837 12:113054621-113054643 CACTCTGCTCCCAGGGAACTTGG - Intergenic
1104791344 12:131483918-131483940 GTCCCTGGCCCCATGGAACTAGG + Intergenic
1105500905 13:20970899-20970921 CACATTGCCCCGGTGGGACTAGG - Intergenic
1105893465 13:24698805-24698827 CACACAGCCTACATGGAGCTGGG + Exonic
1106518996 13:30480571-30480593 CACACTGCTCCTGTGAAACTGGG - Intronic
1107484443 13:40813053-40813075 CACACTTCTGCCATGGACCTTGG + Intergenic
1109515095 13:63433715-63433737 CACATTGCTCCTATGGGACTTGG - Intergenic
1109959574 13:69613134-69613156 CACAGTGCCCCCATTGCCCTTGG + Intergenic
1112149766 13:96745573-96745595 CACCATGCCCCCATTGAAATTGG + Intronic
1112302039 13:98239646-98239668 CCCACTGCCCCCAGGCCACTTGG - Intronic
1117547494 14:56805275-56805297 CACCCTGTTCCCATGGAACACGG - Intronic
1117645617 14:57848877-57848899 CATATTGTCCCCGTGGAACTTGG + Intronic
1121731893 14:96193086-96193108 CACGCTGCCCCAATGCATCTGGG - Intergenic
1121765126 14:96479443-96479465 AACACTGCTCCCAAGGAACCTGG - Intronic
1122288307 14:100665967-100665989 GACACTGCCACCAAGGCACTCGG - Intergenic
1124149161 15:27161382-27161404 CACACTGCCCCCATGGAACTTGG - Intronic
1127650769 15:61004461-61004483 CACTCTGCCCCCATGTGCCTTGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1130239120 15:82169074-82169096 CAGACTGACCCAATGGAGCTTGG + Intronic
1132294602 15:100726117-100726139 CACAGTGCCCAAATGGAACCAGG - Intergenic
1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG + Intergenic
1133879461 16:9766777-9766799 CACATTGCTCCCATAAAACTTGG + Intronic
1141459341 16:84168215-84168237 CACACTGCTGGCATGGAAGTTGG - Intronic
1143703955 17:8683618-8683640 CACACACCCCCCATGTACCTTGG + Intergenic
1147324291 17:39662985-39663007 CGCACTGCCCACATGGGACCTGG + Exonic
1147948514 17:44093780-44093802 CCCCCACCCCCCATGGAACTGGG + Exonic
1148855504 17:50576931-50576953 CTCACTGCCCCCACGACACTGGG - Intronic
1150168004 17:62963434-62963456 GACACTGCCCACATGAAAATGGG + Intergenic
1152966695 18:122640-122662 CACTCTGCCCACATGGGGCTTGG + Intergenic
1156487841 18:37477872-37477894 CACACTGCCCCAATGTGGCTTGG - Intronic
1157827167 18:50822839-50822861 CACTCTGCCTCCATGGAAGCAGG - Intronic
1158106259 18:53888336-53888358 CACACCACCCTCCTGGAACTGGG + Intergenic
1158393414 18:57061885-57061907 CACATGGCCCCCAGGGAGCTGGG + Intergenic
1161414014 19:4134559-4134581 CACACTGCCACCATGCCACGAGG - Intergenic
1164427572 19:28155738-28155760 CACGCTGCCTCCACGGTACTGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168187463 19:54709223-54709245 CACACGGCCCACAGGGAACAGGG - Intergenic
926988312 2:18648398-18648420 CACATTTCCCCCATGCTACTTGG + Intergenic
927436570 2:23071711-23071733 CACACTACCCCTATGCAGCTTGG + Intergenic
928113369 2:28527701-28527723 CCCACTGCTGCCAGGGAACTTGG + Intronic
928169026 2:28991640-28991662 CACTCTGCTCCCAAGGAGCTGGG - Intronic
931701181 2:64910369-64910391 CACACCCCACCCATGGAACCAGG + Intergenic
932272937 2:70426553-70426575 CACTCTACCACCATGGACCTTGG - Intergenic
932494107 2:72138123-72138145 CACACTGGCCCCAAGGGGCTGGG + Intronic
934724578 2:96607521-96607543 CACACTGTCCACACGGGACTTGG + Intronic
944408568 2:199413836-199413858 CACAATGCCGCCAGGGACCTGGG - Intronic
947542502 2:230988609-230988631 CACACTGAAGCCATGGAACGGGG - Intergenic
948112092 2:235464302-235464324 CACACTTCCACCTTGTAACTGGG - Intergenic
948489384 2:238302809-238302831 CACACTGCCCCAACGGTTCTGGG - Intergenic
948582337 2:238996740-238996762 CTCCCTGCCCCCATGGAAGTGGG - Intergenic
1169190377 20:3655164-3655186 CACACTGCCCTCCTGTGACTGGG - Intergenic
1170153369 20:13248045-13248067 CACATAGCCCACCTGGAACTTGG - Intronic
1170331229 20:15213129-15213151 TACACTGCTACCATGGAATTAGG + Intronic
1170857598 20:20071419-20071441 CAAAGTGCCCTCATGGACCTTGG + Intronic
1174098108 20:48105642-48105664 CACACTGCCCCCATGAGAAATGG + Intergenic
1180051686 21:45334610-45334632 CACACTGCACCTGTGGGACTCGG - Intergenic
1180120355 21:45741901-45741923 CCCACCGCCCCCAGGGCACTGGG - Intronic
1180137693 21:45871792-45871814 CACCTTCCCTCCATGGAACTGGG - Intronic
1182011187 22:27002013-27002035 CCCTCTGCCCCTATGGAACAGGG + Intergenic
1183288851 22:36985386-36985408 CACACTGCACGCATCGCACTTGG - Intergenic
1184035716 22:41917188-41917210 GTCTCTGCCCCCTTGGAACTGGG + Intergenic
950499554 3:13354960-13354982 CACACTGCCCCCATGCTATGTGG - Intronic
952564272 3:34635723-34635745 CAGCCTGTCCCCATGGACCTAGG - Intergenic
952900250 3:38107718-38107740 CACCTTGCCCCAGTGGAACTGGG - Exonic
953657671 3:44866412-44866434 CACACAGCCCACTTTGAACTAGG - Intronic
954916398 3:54151601-54151623 CACACTGCCCCCATGCATCCTGG - Intronic
955125430 3:56106291-56106313 TACACTGGCCCCATGGAAAAAGG + Intronic
955964138 3:64370698-64370720 CGCTCTTCCCCCATGGAATTTGG + Intronic
956093598 3:65693403-65693425 CACAGTGCCCCCATACAACCGGG + Intronic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
957417620 3:79927422-79927444 CATGCTGACACCATGGAACTGGG - Intergenic
959299008 3:104575845-104575867 CACTCTTCCCCCAGGGAACTCGG + Intergenic
960417133 3:117398425-117398447 ACCGCTGCCCTCATGGAACTTGG - Intergenic
961338465 3:126200302-126200324 CCCACTGATCCCCTGGAACTGGG - Intergenic
963409126 3:144906752-144906774 CACACTGCCCCCAAGGACAAAGG - Intergenic
971918754 4:32909795-32909817 CACTCTTCCCCCAAGGAACTTGG - Intergenic
982166444 4:152617780-152617802 CACACTGTCTCTCTGGAACTGGG + Intergenic
983162279 4:164431237-164431259 GACACTGCCCCCAAATAACTTGG + Intergenic
985558225 5:568582-568604 CACAGAGCCCCCCTTGAACTTGG + Intergenic
988076621 5:26362769-26362791 CACCCCTCCCCCTTGGAACTCGG + Intergenic
988524432 5:31974688-31974710 CATACTGCCCTGAAGGAACTGGG - Intronic
989190763 5:38667536-38667558 CACTCTTCCACCATGGAACAAGG + Intergenic
989392599 5:40917272-40917294 CACCCTGCCCCCATGGCCCTTGG + Intronic
990779168 5:59338718-59338740 CAGCCTGCCCCCTGGGAACTTGG - Intronic
995389525 5:111625280-111625302 CACAGTGCCTCCTTGGACCTTGG - Intergenic
1000952416 5:167500644-167500666 CACACTGCCTACCTGGAATTGGG - Intronic
1001589523 5:172855814-172855836 CTCACAGCCCACATGGAACCTGG - Intronic
1003684312 6:8285863-8285885 CACAATGCCCCCAAGGACCTGGG - Intergenic
1004817284 6:19325688-19325710 CCAACTGCCTCCATGGGACTTGG - Intergenic
1008953186 6:57183048-57183070 CACACAGGCCACATGGTACTGGG + Intronic
1011194500 6:84767247-84767269 CACACTGCCCCTCGGGACCTGGG - Intergenic
1011249718 6:85358432-85358454 CACACTGCCCCCATAAAGGTGGG + Intergenic
1014440244 6:121465509-121465531 TAAAATGCCTCCATGGAACTTGG - Intergenic
1015856050 6:137625554-137625576 CAAACTGCCCACACGAAACTTGG + Intergenic
1018333780 6:162762044-162762066 CTCCCTGCCCACGTGGAACTTGG - Intronic
1020035558 7:4960933-4960955 CCCTCTGCCCCCAGGGAGCTAGG + Intergenic
1020237835 7:6370178-6370200 CACCCTGGCCTTATGGAACTGGG - Intergenic
1020684365 7:11275031-11275053 TATATCGCCCCCATGGAACTTGG - Intergenic
1020699059 7:11454726-11454748 CACATTGCCTTCATGGTACTAGG - Intronic
1021202334 7:17741104-17741126 CACACTTCAGCCATGGATCTTGG + Intergenic
1021981095 7:26056276-26056298 CACACAGCCCTCATGAAAATGGG + Intergenic
1022524030 7:31026089-31026111 CACTCTGCCACCAAGGACCTTGG + Intergenic
1023318809 7:38971244-38971266 CTCACTGCCCTCATGGGACATGG + Intergenic
1024727227 7:52211867-52211889 CCCACTGGCCCCATAGCACTGGG - Intergenic
1027549702 7:79574983-79575005 CACACTTTCCCCATGGCCCTGGG + Intergenic
1029474616 7:100775703-100775725 GACACTGACCCCAGGGATCTGGG - Exonic
1030059718 7:105612942-105612964 CACACTGCCCTGATGGGTCTAGG + Intronic
1031700574 7:124919890-124919912 GTCCCTGCCCCCATGGGACTTGG + Intronic
1031966907 7:128033049-128033071 CCCGCTGCCCCCAGAGAACTGGG + Intronic
1033314460 7:140285981-140286003 CACACTGCACACATGGGAATGGG - Intergenic
1034106109 7:148491255-148491277 CACACTGTCCCCATGAGACCTGG + Intergenic
1035749161 8:1983608-1983630 CACACTGTCCCTATGGGACCTGG + Intronic
1037803450 8:22047297-22047319 CCCACTGGCCCCACTGAACTTGG - Intronic
1040886711 8:52271312-52271334 CACACTGCCACCATGGATCCAGG + Intronic
1042363924 8:67914713-67914735 CACACAGTCCCCATGGAATCAGG + Intergenic
1042637485 8:70894524-70894546 CACACTGCCCCCTGGGGAATTGG - Intergenic
1044485793 8:92752682-92752704 CACACTGCTACCCTGGGACTGGG + Intergenic
1047048764 8:121085172-121085194 CAGGCTGCCCCCATGGGACAGGG + Intergenic
1048301499 8:133254663-133254685 CACCCTGCACCCAGGGAAGTGGG - Intronic
1053039412 9:34857136-34857158 CACTCTTCCCCCTAGGAACTTGG + Intergenic
1053575406 9:39354419-39354441 CACCCTTCCCCCCAGGAACTTGG - Intergenic
1053839913 9:42182353-42182375 CACCCTTCCCCCCAGGAACTTGG - Intergenic
1054096967 9:60913102-60913124 CACCCTTCCCCCCAGGAACTTGG - Intergenic
1054118372 9:61188728-61188750 CACCCTTCCCCCCAGGAACTTGG - Intergenic
1054589384 9:66993836-66993858 CACCCTTCCCCCCAGGAACTTGG + Intergenic
1054960824 9:70967230-70967252 CTGACTGTCCCCAAGGAACTGGG - Intronic
1057212142 9:93206164-93206186 CACACTGTCCACATGGGCCTTGG - Intronic
1059428538 9:114236328-114236350 CAGACTGCCCTGATGGAGCTCGG + Intronic
1060405381 9:123370454-123370476 CACACTGCCCGCTGGGACCTTGG + Exonic
1061476608 9:130871749-130871771 CACACTTTCCCCAGGGAACCTGG - Intronic
1061727153 9:132588092-132588114 CACCCTGTCCCCAAGGAACAAGG - Intronic
1186032097 X:5379079-5379101 CACCCTGCCCTCTTGGTACTCGG - Intergenic
1187932200 X:24303765-24303787 CATGTTGCCCCCATGAAACTTGG + Intergenic
1188462161 X:30440977-30440999 CATTCTGCCCACCTGGAACTGGG + Intergenic
1190326517 X:49210146-49210168 CACACCGCCCCCATTGGACGGGG + Intronic
1193019113 X:76770513-76770535 CACATTCCCACCAGGGAACTGGG + Intergenic
1195541141 X:106064456-106064478 CACACTCCCACAATGGAACTAGG - Intergenic
1200058135 X:153472200-153472222 CACACTGGCTCCGTGGAGCTGGG - Intronic