ID: 1124149675

View in Genome Browser
Species Human (GRCh38)
Location 15:27166497-27166519
Sequence TAGGGTAATAAAGGTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124149669_1124149675 6 Left 1124149669 15:27166468-27166490 CCAAGCTTGAGACTCTTCAGGGG 0: 1
1: 1
2: 2
3: 9
4: 139
Right 1124149675 15:27166497-27166519 TAGGGTAATAAAGGTCTTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124149675 Original CRISPR TAGGGTAATAAAGGTCTTGC AGG Intronic
910332360 1:86089208-86089230 TAGGGTGATCAAGGCCTTTCTGG - Exonic
910675072 1:89808272-89808294 TAGGGTTACAAAGGTCTCACAGG + Intronic
915147984 1:153806718-153806740 TAAGCTAATGAAGGTCTTGATGG + Exonic
916117269 1:161497101-161497123 TAGGATGAGAAAGTTCTTGCAGG - Intergenic
919109616 1:193201306-193201328 AAGGGTAAAGTAGGTCTTGCAGG + Intronic
919190660 1:194214020-194214042 CAGGGCAAAAAAGGTCTTTCTGG + Intergenic
921993183 1:221389535-221389557 TAGGGGAATAAAGATTTTGGGGG + Intergenic
1062890798 10:1057882-1057904 TACGGTCATAAAAGTATTGCAGG + Intronic
1071085061 10:81860331-81860353 TAAGGTAATAAAGGTCATTAAGG - Intergenic
1071536870 10:86440694-86440716 AAGGGATATAAAGATCTTGCGGG + Intronic
1072759773 10:98046998-98047020 TTGGGTAATTGAGGTTTTGCCGG + Intergenic
1083412348 11:62502977-62502999 CAGGGAAAAAAAGGTCTTGGAGG - Intronic
1092316020 12:7414454-7414476 TAGTGTCATATAGGTCTTGTAGG - Intronic
1099566125 12:84248732-84248754 TATGGTAATAAAGCTGTTGTTGG - Intergenic
1100536194 12:95511859-95511881 TAGGGAAATAAAAGTCATTCAGG - Intronic
1104381763 12:128313547-128313569 TAGGGGGATTAAGGACTTGCTGG + Intronic
1107010747 13:35668418-35668440 TGGGGTAGTAGAGGTCTGGCAGG + Exonic
1107962141 13:45568002-45568024 CAGGGTAAGAAAAGGCTTGCAGG - Intronic
1108309641 13:49175419-49175441 TTGGTTAATACAGGACTTGCTGG - Exonic
1110224557 13:73105962-73105984 AAGGGAAATTAAGGTCCTGCAGG - Intergenic
1110822715 13:79934999-79935021 TAGCATAATAAAGGTTTTGAAGG + Intergenic
1112169001 13:96950068-96950090 TAGAGTAATACAGATTTTGCAGG + Intergenic
1114159621 14:20149811-20149833 TAGCCAAATAAATGTCTTGCAGG - Intergenic
1116380018 14:44255344-44255366 AAGGGAAATATTGGTCTTGCCGG + Intergenic
1117067483 14:52024855-52024877 GAAGGTAATCAAAGTCTTGCAGG + Intronic
1118413762 14:65510423-65510445 TAGGGTAATACTGGCCTTGCAGG + Intronic
1118908902 14:70045191-70045213 CAGGGTACTAAAGATCTTACAGG - Exonic
1120372907 14:83660897-83660919 TAGTTTAATAAAGGGCTTTCAGG + Intergenic
1121071782 14:91029941-91029963 TAGGGTTATAAATGTCTTTGTGG - Intronic
1121976201 14:98406220-98406242 TAGGGAAATAAAGGACTGGATGG + Intergenic
1124149675 15:27166497-27166519 TAGGGTAATAAAGGTCTTGCAGG + Intronic
1126525268 15:49647021-49647043 TGGGGTAATAAAGGTCTGGAAGG + Exonic
1127754594 15:62079118-62079140 TGGGGTAAGAAAGGACTTGTGGG + Intergenic
1128927896 15:71675494-71675516 TACAGAAATAAAGGTCGTGCTGG + Intronic
1131487952 15:92837686-92837708 TACGGTAATATATGCCTTGCTGG - Intergenic
1139778824 16:69334226-69334248 GAAGGTAATAAATGTGTTGCTGG + Intronic
1151281633 17:73079496-73079518 TAAGGTAATAAAAGTCATCCAGG + Intronic
1157200012 18:45652107-45652129 TTGGGTCATAAAGGTTTTGATGG + Intronic
1157214123 18:45768128-45768150 TAGGGAAAGAGAGGTCTTGCAGG + Intergenic
1159162258 18:64657771-64657793 TAAGGCAATAAAGGCCTTTCTGG + Intergenic
1160679299 19:405447-405469 TAGTGCAATAAAGGTGTTTCGGG - Exonic
1164166508 19:22681780-22681802 TAAGGGAATAGAGGACTTGCAGG - Intergenic
1165267689 19:34675542-34675564 TCAGGTCATAAAGGCCTTGCTGG + Intronic
927477162 2:23422953-23422975 TAGGGGCATAAATGGCTTGCTGG - Intronic
928868634 2:35948708-35948730 TAGGATAATGATGCTCTTGCAGG - Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932709783 2:74054107-74054129 TGGGGAAATACAGGTCATGCGGG + Intronic
943523749 2:188990304-188990326 TAGGGTATCAAAGGTCCAGCTGG + Exonic
943523805 2:188991484-188991506 TAGGGTGAAAATGGTCTTCCAGG + Exonic
947410948 2:229839112-229839134 TAGGGTATTAATAATCTTGCAGG - Intronic
1172921555 20:38487181-38487203 TAGGGTAAGAAAGGATTTGCTGG + Intronic
1177580102 21:23010703-23010725 TAGGGTCACTAAGGTCTTGAAGG + Intergenic
1183853354 22:40610789-40610811 TAGGGGAAAAAAAGTCTTGGAGG + Intronic
949307126 3:2654730-2654752 TAGGGTAAGAAAGGACTGGGGGG - Intronic
951765135 3:26189488-26189510 TATGAAAATACAGGTCTTGCTGG + Intergenic
953003610 3:38957580-38957602 TGGGCTCATGAAGGTCTTGCAGG - Intergenic
955043874 3:55341609-55341631 TATGAAAATAAAAGTCTTGCTGG - Intergenic
958556197 3:95680029-95680051 TTGGGAAAAAAAAGTCTTGCAGG - Intergenic
961061746 3:123834448-123834470 TAATTTAATAAAGGTCTTGGTGG + Intronic
961936796 3:130593196-130593218 TAGGGTGATAATGGTCTTCCTGG + Exonic
962810525 3:138955486-138955508 TAGACTAATTGAGGTCTTGCTGG + Intergenic
969086949 4:4663762-4663784 TAGGGGACTGAAGGCCTTGCTGG + Intergenic
970291187 4:14574159-14574181 TACTGTCATATAGGTCTTGCAGG + Intergenic
973168966 4:47114676-47114698 TAGACTAATAAAGGTCTCCCAGG - Intronic
975645335 4:76540250-76540272 CAGGGTAATAAAACTCATGCAGG - Intronic
975782487 4:77854136-77854158 TAGGGTAGTAGTGGTCTTGGAGG - Intergenic
978969222 4:114782530-114782552 TAGGCTAATAGGAGTCTTGCTGG + Intergenic
981132907 4:141177935-141177957 TATGGTAATTAAGGTTTTGGGGG + Intronic
982540833 4:156668440-156668462 TGAGGTCATAAAGGTCTTACAGG - Intergenic
987677947 5:21099210-21099232 TGGAGTAATAAGGATCTTGCAGG + Intergenic
987819334 5:22941773-22941795 TTGGGTTATAAACATCTTGCAGG + Intergenic
990131164 5:52586415-52586437 CAGGGTAATACTGGTCTTACAGG - Intergenic
991184051 5:63787083-63787105 TAGGGCAATAAAGGCTTTCCTGG - Intergenic
992414203 5:76537262-76537284 TAGGTTAATAAAGGCCTGTCCGG + Intronic
993684543 5:90922117-90922139 TAGGTTCATAAATGTCTTCCAGG + Intronic
993847915 5:92968501-92968523 TAGGCTAATATAGGGCTTGATGG - Intergenic
995029284 5:107461736-107461758 TAGGTTAATCAAGTTATTGCTGG - Intronic
1000415086 5:160975991-160976013 AAAGGTCATAAAGGTCTAGCGGG - Intergenic
1005384882 6:25276257-25276279 TTGGTTAATAAAGATCTTTCAGG - Intergenic
1011162744 6:84410421-84410443 TTGGGTTATAATGGTCTTGAAGG - Intergenic
1013335481 6:109154912-109154934 AAGGGTACTAAAGGTGTAGCAGG - Intronic
1013854364 6:114553786-114553808 TAGGGGAATTGAGGTCTTGTAGG + Intergenic
1017377341 6:153786616-153786638 CAGGGTACTAAAGTTATTGCAGG - Intergenic
1028753923 7:94413098-94413120 AACGGTGATAAAGGTCATGCTGG + Exonic
1028913643 7:96235519-96235541 TATGGTAATAAAAGTCTTTGTGG + Intronic
1032448471 7:132004767-132004789 ATGGTTAATAAAGGTCTGGCAGG + Intergenic
1038910152 8:31954328-31954350 TAGGATAATAAAGCTTTTACTGG + Intronic
1042396500 8:68296876-68296898 TAGTATAATAAAGGTTTTGCTGG - Intergenic
1043678571 8:82993225-82993247 AAGGATACTAAAGGTCTTGAAGG - Intergenic
1047635661 8:126759365-126759387 TAGAATAAAAAAAGTCTTGCAGG + Intergenic
1049648375 8:143748289-143748311 TAAAGAAATAAAGGACTTGCTGG - Intergenic
1052253875 9:26430698-26430720 TAAGGTAATAAAAGTCATCCAGG + Intergenic
1055399072 9:75904024-75904046 TAAAGAAAAAAAGGTCTTGCTGG - Intronic
1059544367 9:115161414-115161436 CAGGATAGTAAAGGTCTTCCAGG - Intronic
1203787569 EBV:136497-136519 CAGTGTCATAAAGGTGTTGCGGG - Intergenic
1189712709 X:43830405-43830427 TAGGGTATTAAAAGTCTGACTGG + Intronic
1189914442 X:45843073-45843095 GAGGGTGATAAAAGTCATGCAGG + Intergenic
1195689304 X:107610757-107610779 CAGGGAAAAAGAGGTCTTGCAGG - Intergenic
1197084292 X:122454185-122454207 TAGGACAGTAAAGGTATTGCTGG + Intergenic
1202102395 Y:21323961-21323983 TAGGGTAATATAAAACTTGCTGG + Intergenic