ID: 1124152708

View in Genome Browser
Species Human (GRCh38)
Location 15:27196241-27196263
Sequence CTCTTCCTTATACCAGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124152705_1124152708 -2 Left 1124152705 15:27196220-27196242 CCTCTTCTTATAAATAACACCCT 0: 1
1: 0
2: 2
3: 24
4: 218
Right 1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 192
1124152704_1124152708 23 Left 1124152704 15:27196195-27196217 CCTGGTCAGCTCTTTTGTCTGAT 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124152708 Original CRISPR CTCTTCCTTATACCAGTGTT AGG Intronic
905525834 1:38638865-38638887 CTCTTCCCTTTCCCAATGTTAGG + Intergenic
907966856 1:59340082-59340104 CTCTTCCTTTTCCCAGTGGTGGG + Intronic
908710521 1:67009303-67009325 TTCTTCCTTATACTATTATTAGG - Intronic
909965881 1:81909747-81909769 CTCTTCCTTATAACCATCTTGGG - Intronic
911617444 1:100030032-100030054 CTCTTCCTTATAATGGTGATAGG - Intergenic
912837893 1:113012652-113012674 CTCTACATTATACACGTGTTTGG - Intergenic
915348498 1:155210281-155210303 CTCTTCTTGATACCACTGTGGGG + Intronic
918026632 1:180755926-180755948 CTCTTCCTGATTCCAGGGCTGGG + Intronic
918622681 1:186623330-186623352 CTATTGTTTATACCAGTCTTGGG + Intergenic
919804135 1:201370804-201370826 CACTTCCTTATAACAGGTTTAGG - Intronic
920333990 1:205231758-205231780 CCCTACCTCATACCTGTGTTTGG + Intronic
920586083 1:207162794-207162816 TTCTTCCTTATACCAATTTTAGG - Intergenic
921420839 1:214946069-214946091 ATCTTCCTTTTACCAGAGGTAGG - Intergenic
921495862 1:215840784-215840806 GTCTTCTTTTGACCAGTGTTCGG - Intronic
921707301 1:218338174-218338196 CTTTTCCTTATAACCCTGTTAGG + Intergenic
923302870 1:232658853-232658875 CTGTTCCTTAAAACTGTGTTTGG + Intergenic
1065756438 10:28935348-28935370 TTCTTTCTTATGGCAGTGTTTGG + Intergenic
1067845148 10:49713628-49713650 CTCTGCTTAAAACCAGTGTTGGG + Intergenic
1069279995 10:66643789-66643811 CTCTTCATTCTACCTTTGTTAGG + Intronic
1069991367 10:72318613-72318635 CTCTTCCTAATTACAGTGTAGGG + Intergenic
1070637795 10:78143072-78143094 CTGTTCTTTATAGCAGTGTGAGG + Intergenic
1071013068 10:80961901-80961923 TTCTTCCATTCACCAGTGTTGGG - Intergenic
1071952490 10:90720922-90720944 CCTTTCCTTTTGCCAGTGTTAGG - Intergenic
1073421516 10:103427464-103427486 ATCTTGATTTTACCAGTGTTAGG + Intronic
1075314608 10:121442552-121442574 CTCTTCCTTATCCCATTATTGGG - Intergenic
1077962632 11:7090376-7090398 CTCTTCCTTGTACTAGTCCTTGG - Exonic
1079051707 11:17166616-17166638 CTCTGCCTTCTACCAGTGCAAGG + Intronic
1080481860 11:32659979-32660001 CTATTCCTCATGGCAGTGTTTGG - Intronic
1086029160 11:82332852-82332874 TTCTTCCATTTACCAGTTTTGGG + Intergenic
1086056455 11:82653168-82653190 CTCTTCTTTTTCCCAGTCTTGGG + Intergenic
1086739610 11:90351442-90351464 CTCTTCCTATTATCAGTGATAGG - Intergenic
1086859271 11:91906114-91906136 CTTTTCCTTATAAAAGTCTTTGG - Intergenic
1087611995 11:100446029-100446051 CTCTCCATTAGACCAGGGTTTGG - Intergenic
1087716062 11:101610360-101610382 ATCTTCATTGTACCAGTCTTGGG - Intronic
1090641479 11:128732842-128732864 CACTTCCTTTTACAATTGTTTGG + Intronic
1095343636 12:41122824-41122846 CTATTCCTTCTGACAGTGTTTGG + Intergenic
1095403045 12:41837354-41837376 CTGTTCATTATACCATTGGTGGG - Intergenic
1099107667 12:78517058-78517080 CACTGCTTTACACCAGTGTTTGG + Intergenic
1099762193 12:86938570-86938592 CTCTTTATTATACCCTTGTTTGG + Intergenic
1101330396 12:103753211-103753233 CTCATCCAGATACCACTGTTGGG + Exonic
1102227066 12:111236210-111236232 CCCTTTCTTAGCCCAGTGTTTGG - Intronic
1106792039 13:33165678-33165700 CTCATCCTTATTACAGTCTTAGG + Intronic
1107270141 13:38606696-38606718 GTCTTCCTTATAGGATTGTTTGG - Intergenic
1108517195 13:51214652-51214674 CTGTTCCTTATCTCAGTGTGCGG - Intergenic
1109033015 13:57218004-57218026 TTGTTTCATATACCAGTGTTTGG + Intergenic
1109094869 13:58101032-58101054 TTCTTCTTTATACCATGGTTAGG + Intergenic
1109142771 13:58735857-58735879 CTTTTCCTTATATCAGTGGTAGG + Intergenic
1109240384 13:59879588-59879610 CTCTTCCTGCTATCAGTTTTAGG - Intronic
1109947826 13:69461714-69461736 TTCTTCCTTAAAACAGTGTGAGG - Intergenic
1111095863 13:83515050-83515072 CTGTTTCTTATACCAGGGTAAGG - Intergenic
1114346159 14:21797425-21797447 CTGTTGCTCATACCAGTGCTGGG + Intergenic
1116090883 14:40305325-40305347 TTCTTCCTCATACAAGTGTTTGG - Intergenic
1116960929 14:50967882-50967904 CTGTTTCTTAAAGCAGTGTTAGG - Intergenic
1118434461 14:65756719-65756741 CTCTGAATTAGACCAGTGTTTGG - Intergenic
1123999754 15:25745548-25745570 CTCTTTCTTATAGCAGAGATGGG - Intronic
1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG + Intronic
1124851009 15:33339045-33339067 CTCTTTCTTATATCGGTGGTTGG + Intronic
1125187068 15:36943318-36943340 CACTTCATTATACCAGTATTTGG - Intronic
1125933316 15:43615455-43615477 ATCTTGCTTATACCAGAGCTGGG + Exonic
1125946414 15:43714917-43714939 ATCTTGCTTATACCAGAGCTGGG + Intergenic
1127265028 15:57354189-57354211 CTTTTCCTCATAGCAGTGTGTGG + Intergenic
1127967210 15:63931372-63931394 CTCTTCCTTTTTCAGGTGTTCGG - Intronic
1133754811 16:8754408-8754430 CTCTTCCTTCTACCAGTCACCGG - Intronic
1137230036 16:46556150-46556172 CTCTGTATTATTCCAGTGTTAGG + Intergenic
1141843042 16:86586675-86586697 CTCTTCCTTATGCCACTGAGTGG - Intergenic
1145012859 17:19379425-19379447 CAGTTCCTTATGCCAGTGTCTGG - Intronic
1147385380 17:40078124-40078146 CTCTACCTTATAGCATTGTTGGG + Intronic
1147385605 17:40079717-40079739 ATCTACCTTATAGCACTGTTGGG - Intronic
1147399197 17:40169326-40169348 CTCCTCCATATACCTGTGATGGG - Exonic
1147430985 17:40370656-40370678 CTCTTGCTTAAGCCACTGTTTGG - Intergenic
1148621603 17:49038656-49038678 CTCTTGCTAATACGAGTGTGTGG - Intronic
1148714884 17:49708834-49708856 CCCTTCCTCATGCAAGTGTTGGG + Intronic
1149012031 17:51866691-51866713 CCCTTCATTATACCACTTTTAGG + Intronic
1150496238 17:65609937-65609959 CTCTTGCACATACCACTGTTTGG + Intronic
1152493629 17:80654584-80654606 CTCTTCCTTATACAAGCCATGGG - Intronic
1155243005 18:23881389-23881411 CTCTTCAGTATATCATTGTTAGG + Intronic
1155395002 18:25377673-25377695 CTCTTGCTTGTAGCAGTGTGTGG + Intergenic
1158525431 18:58209082-58209104 ATCTTTCTTATCCCATTGTTAGG - Intronic
1158535773 18:58306943-58306965 AACCTCCTTATAGCAGTGTTTGG + Intronic
1159124929 18:64211784-64211806 CTCCTCGTTATCTCAGTGTTGGG - Intergenic
1159442463 18:68499129-68499151 CAATTCCTTGAACCAGTGTTTGG - Intergenic
1160039227 18:75330592-75330614 ATCTTCCTTCTACCACTGATAGG - Intergenic
1160903843 19:1442846-1442868 CTCTTCTTTAATCCAGTGTCAGG + Intergenic
1162626908 19:11891895-11891917 CTTTTCCCTATACAAGTGTTAGG - Intronic
1162631143 19:11927920-11927942 CTTTTGCCTATACAAGTGTTAGG - Intronic
925877900 2:8328063-8328085 CTCTTCCTTACACCAGCCCTTGG - Intergenic
928173153 2:29016337-29016359 CTCTTCCTGCTTCCAGTGTGAGG + Intronic
931416952 2:62090589-62090611 CTCTTCCAAATACCAGTATATGG - Intronic
932275872 2:70451888-70451910 CTCTTCCTAAGACCACTGTAAGG + Intronic
933463275 2:82616540-82616562 CTTTGCCTAGTACCAGTGTTAGG - Intergenic
937839522 2:126511523-126511545 CTCTGCCTTGTCCCAGTGTGTGG + Intergenic
939458067 2:142463678-142463700 CTCTTCCTATTACCAGTTATAGG + Intergenic
939700593 2:145386439-145386461 GTCTTAATTATACCAGTCTTTGG + Intergenic
939762163 2:146196259-146196281 CTCATCCTTATAACAATCTTAGG + Intergenic
939857269 2:147374392-147374414 CTCTTCCAGATACATGTGTTTGG - Intergenic
940334754 2:152514172-152514194 TTTTTCCTTATACCATTATTGGG - Intronic
941684218 2:168431069-168431091 GTCTACCATATACAAGTGTTTGG - Intergenic
942304792 2:174596298-174596320 CTCTTCCTTTTATCAGTCTAAGG - Intronic
945365162 2:208943983-208944005 CTCTTCCCCATCCCATTGTTAGG + Intergenic
945402370 2:209400357-209400379 TTCTTCCTTATAGCATTGATTGG + Intergenic
947326842 2:228988488-228988510 ATCATCCTTATACCAGTACTTGG + Intronic
947326847 2:228988531-228988553 ATCATCCTTATACCAGTACTTGG + Intronic
948973245 2:241445598-241445620 CTCTTCTTCAAGCCAGTGTTGGG + Intronic
1175080382 20:56415121-56415143 CTCTCCCTTGTACCAGGGGTTGG + Intronic
1175519694 20:59592293-59592315 TTCTTTCTAAGACCAGTGTTAGG + Intronic
1177616093 21:23522129-23522151 TTCCTCCTTATACCAATGTTGGG + Intergenic
1177789764 21:25710269-25710291 CCATTCCTTAGAACAGTGTTAGG - Intronic
1181939646 22:26465227-26465249 CTCTTACTTATACCAGCTATGGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1185365659 22:50435607-50435629 CTCCTCCCTATACCCGTGTAAGG + Intronic
950049002 3:9971876-9971898 CTCTTGTTTATGCCAGTCTTTGG + Intronic
950230777 3:11273913-11273935 CTTTTCTTTATTCAAGTGTTAGG - Intronic
952231818 3:31439284-31439306 CTTTTCCTTTTACCTGTGATAGG + Intergenic
952497739 3:33930691-33930713 CTCTGCTTTGTACCAGAGTTTGG - Intergenic
953429500 3:42827210-42827232 GTCTTACTTATATCAGTTTTAGG + Intronic
953798781 3:46005520-46005542 TTCTTCCTTATACCCACGTTGGG - Intergenic
956701539 3:71963427-71963449 CTCTTCCTGGTACATGTGTTTGG - Intergenic
957563235 3:81852577-81852599 TTCATCCTTATATCAGTTTTGGG + Intergenic
957566268 3:81888225-81888247 CTGTACCTTAGTCCAGTGTTTGG + Intergenic
958666392 3:97143642-97143664 TTCTTGATTATACCAGTTTTTGG - Intronic
961962138 3:130865797-130865819 CTCTTTTTTATCCCAGTCTTGGG + Intronic
962070598 3:132029610-132029632 CTCTTTCTTATCCAAGTGTAGGG - Intronic
963501876 3:146137654-146137676 CTCTTGTTTATACAAGTATTTGG - Intronic
964169677 3:153754773-153754795 CTTTTCTTTATACCAGTTTTGGG + Intergenic
964231760 3:154478375-154478397 GTCCTGCTTAGACCAGTGTTGGG - Intergenic
971960064 4:33474173-33474195 CTTTTCCTTTTACCATTATTAGG + Intergenic
974767344 4:66363972-66363994 CTCTTCCTCATAACAGTATTAGG - Intergenic
975508156 4:75162206-75162228 CACTTCATTCTGCCAGTGTTAGG + Intergenic
982496327 4:156097667-156097689 CTCTTTCTTAAACCAATCTTGGG - Intergenic
983322260 4:166210674-166210696 CTCTTCCTCTTCCCAGTCTTGGG - Intergenic
984719789 4:182958971-182958993 CTCTTCCCTAAGACAGTGTTTGG - Intergenic
985399341 4:189578961-189578983 GTATTCCTTCTACCAGTGTGAGG + Intergenic
985809368 5:2071669-2071691 CTCTTTCTTTTCCCAGTCTTGGG + Intergenic
985867906 5:2529705-2529727 CCCTGCCTTCTAACAGTGTTTGG + Intergenic
986275530 5:6271954-6271976 CTCTTTCTTCTCCCAGTTTTGGG + Intergenic
986627072 5:9732188-9732210 CTCTTGCTGCTTCCAGTGTTGGG - Intergenic
987141013 5:14946367-14946389 CTCATGCTTAGAGCAGTGTTTGG + Intergenic
987306347 5:16641241-16641263 CCCTTCCTCATACAAGTATTTGG - Intergenic
987864028 5:23517977-23517999 CTCCTCCTCTTACCTGTGTTTGG - Intronic
988423263 5:31032305-31032327 ATCTTCTTTATACCAGTGTCTGG - Intergenic
989121719 5:38010940-38010962 CTCCTCCTAATACCACTTTTGGG - Intergenic
990203375 5:53402807-53402829 CTTGTCCATATACCAGTGGTAGG - Intergenic
993689820 5:90986236-90986258 CTCTTCCTTATACCAAGAATTGG - Intronic
995498671 5:112778386-112778408 CTCTGCCTCATTCCAGTTTTAGG - Intronic
997231348 5:132245809-132245831 CACTTCCTTATGCCATGGTTTGG - Intronic
997307505 5:132849852-132849874 CTCATCCTTCTATCAGTTTTGGG - Intergenic
998014763 5:138723306-138723328 CTCTTTCTTATCCAAATGTTGGG - Intronic
998563618 5:143195563-143195585 CTCTTCCTTTTACCTGGGGTAGG - Intronic
999893477 5:156003811-156003833 CTCTCCCTTATAACAGTAATGGG - Intronic
1001985060 5:176067240-176067262 CTATTTCTTATAGCAGTTTTAGG + Intronic
1002231806 5:177770895-177770917 CTATTTCTTATAGCAGTTTTAGG - Intronic
1002263536 5:178012858-178012880 CTATTTCTTATAGCAGTTTTAGG + Intronic
1004327059 6:14684817-14684839 CTCTTCCTTTTACTGTTGTTTGG - Intergenic
1005604410 6:27461718-27461740 CACCTCCCTACACCAGTGTTTGG - Intronic
1007664855 6:43508193-43508215 CTCTTCCCTCTCCCAGTGTACGG + Intronic
1007969237 6:46034070-46034092 TTCTTCCTGTTACCAGTGTCTGG + Intronic
1010183509 6:73116117-73116139 TTCTTTCTTATACAAGTTTTTGG - Intronic
1010888779 6:81278385-81278407 TTCTTTGTTATACCAGTTTTGGG + Intergenic
1011293864 6:85806602-85806624 TTCTTCATTCTACCAGAGTTTGG + Intergenic
1014583933 6:123174908-123174930 TTCTTTCTTAACCCAGTGTTAGG - Intergenic
1018113750 6:160562650-160562672 CTCTTCTTTGTACCTCTGTTAGG + Intronic
1021565040 7:22008444-22008466 CTATTCCTGAAACGAGTGTTAGG - Intergenic
1023311687 7:38894078-38894100 CTTTTCCTTATTCAAGTGCTAGG - Intronic
1024511955 7:50211734-50211756 CTCCTCCTGATGCCAGTGTGTGG - Intergenic
1024956131 7:54923180-54923202 CTCTTTTTTATACCAGGCTTTGG - Intergenic
1027950436 7:84808320-84808342 CTCTTCCTTATTTCAGTTTAGGG - Intergenic
1031060508 7:117046113-117046135 CTCTTCCTTATACCACTTACAGG - Intronic
1033566072 7:142579363-142579385 CTCTGACTTATACCACAGTTAGG - Intergenic
1037452628 8:19031893-19031915 CTCTTCCTGATACAGTTGTTTGG + Intronic
1038061546 8:23919414-23919436 CTCTCCCTTAGACCTCTGTTGGG + Intergenic
1038738093 8:30190659-30190681 CATTTCCTTATACCACTGTTTGG - Intergenic
1039237686 8:35520392-35520414 CTCTTCCTTATTCCAGCCCTTGG - Intronic
1041458567 8:58086217-58086239 CTCTTACTTTTAGCAGTCTTTGG + Intronic
1041467684 8:58173461-58173483 ATCTTCCCTATATCAGTGATTGG + Intronic
1041870221 8:62625773-62625795 CTCTTCCTTTTTCCTTTGTTGGG + Intronic
1042041577 8:64597254-64597276 CACTTGATTATACCAATGTTAGG + Intronic
1045898807 8:107249823-107249845 CACTTTCTTAAACCAGTTTTTGG - Exonic
1046326899 8:112660808-112660830 CTCCTGATTATTCCAGTGTTTGG + Intronic
1046760118 8:118011958-118011980 CCCTTCCTTGCACCAGTGGTCGG - Intronic
1047012492 8:120687142-120687164 CTCCTCTTTTTCCCAGTGTTTGG - Intronic
1048984283 8:139725367-139725389 GTTTTCCTTATTCCAGTTTTGGG + Intergenic
1049965850 9:778699-778721 TTCTCCCTTCTACCAGTGTTGGG - Intergenic
1050783349 9:9367897-9367919 CTCTCCCTTATGACAGGGTTTGG - Intronic
1050986081 9:12084692-12084714 CTCTTCCTGAAAACAATGTTTGG - Intergenic
1052395146 9:27929489-27929511 CTCTTCCTTTTACCTGGGTGGGG + Intergenic
1054843329 9:69766105-69766127 CTCTTCATTATTCCAGTTGTTGG + Intergenic
1055134283 9:72809136-72809158 TTCTTCCTTAGACCATTGCTTGG + Intronic
1055329898 9:75172991-75173013 CTCTTCCCTATACCAGTAAATGG - Intergenic
1055800999 9:80035940-80035962 CTCTTCCTTTTTCCTGTCTTAGG - Intergenic
1055895939 9:81175808-81175830 CTGTTCCTTATTCCAATTTTTGG - Intergenic
1057457819 9:95230288-95230310 CTGTTCCTCATACCAGTGAGTGG + Intronic
1059443786 9:114325638-114325660 CTTTTCTTTAAACCTGTGTTTGG + Intronic
1059444987 9:114332415-114332437 CTTTTCTTTAAACCTGTGTTTGG + Intronic
1059874623 9:118620555-118620577 CTATTCCTTATACCTGAGTGTGG - Intergenic
1062621669 9:137425260-137425282 CTCTTCCTTAAACCAGACTCAGG - Intronic
1187988092 X:24836466-24836488 CACTTCCTACTAGCAGTGTTTGG + Intronic
1190170858 X:48110499-48110521 CTCTTCCTTAGAGAAGTATTTGG - Intergenic
1190190940 X:48277038-48277060 CTCTTCCTTAGAGAAGTATTTGG + Intronic
1190200181 X:48354708-48354730 CTCTTCCTTAGAGAAGTATTTGG + Exonic
1190666991 X:52705204-52705226 CTCTTCCTTAGAGAAGTATTTGG + Exonic
1190672427 X:52753204-52753226 CTCTTCCTTAGAGAAGTATTTGG - Exonic
1191042702 X:56102022-56102044 CCCTTCTTTATACCAGTCTCAGG - Intergenic
1194296201 X:92129414-92129436 CTCTTCCTTCTACCCATTTTAGG + Intronic
1198505621 X:137298251-137298273 CTCTTCATTAGACCTCTGTTAGG + Intergenic
1198516105 X:137408898-137408920 CCCATCCTTCTACCAGTTTTGGG + Intergenic
1199544531 X:148994004-148994026 CTCTTCAGTATACCAGTTTGTGG + Exonic
1200613709 Y:5354021-5354043 CTCTTCCTTCTACCCATTTTAGG + Intronic