ID: 1124156340

View in Genome Browser
Species Human (GRCh38)
Location 15:27228218-27228240
Sequence TGGGGTCTGCTTAAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 1, 2: 9, 3: 59, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124156340 Original CRISPR TGGGGTCTGCTTAAGGCAGG AGG (reversed) Intronic
900011207 1:110773-110795 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900027311 1:287337-287359 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900041269 1:466781-466803 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900062700 1:701757-701779 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900155009 1:1200400-1200422 TGGGGTCTGCTGAGGGCCAGTGG + Intergenic
900935024 1:5759549-5759571 TGGGGTCTGTGTCAGGCAGAGGG + Intergenic
901931223 1:12596979-12597001 GGGGGTCTCCTTGAGCCAGGGGG - Intronic
902164347 1:14557937-14557959 TGGGGTCTTCTAAATGGAGGGGG - Intergenic
902634485 1:17726183-17726205 TGGGGTCTGCCTTTGGGAGGGGG - Intergenic
903005552 1:20295791-20295813 TGGGGCCTGAATAAGGAAGGGGG - Intronic
903666382 1:25010051-25010073 TGGGGACTTCCTAAGGGAGGTGG - Intergenic
903997438 1:27316343-27316365 TGGGGTCTGCTGGAGGGTGGAGG + Intergenic
904566819 1:31433273-31433295 TGATGTCTGCTTAAGGCTTGGGG + Intronic
904627746 1:31816482-31816504 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
904795873 1:33055991-33056013 TGGTCTCTGCTTACGGTAGGTGG + Intronic
905027945 1:34864207-34864229 TTGGGTCTCATTGAGGCAGGTGG - Intergenic
906737753 1:48148699-48148721 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
906838524 1:49110261-49110283 TGGGGCCTGGATAAGGTAGGTGG - Intronic
906887916 1:49672328-49672350 TGGGGTCTACTTGAGGGGGGAGG + Intronic
907569412 1:55468995-55469017 TGGTTTCTGCAGAAGGCAGGTGG + Intergenic
908083064 1:60601019-60601041 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
908664143 1:66471058-66471080 TGGGTTCTACTTAAGGGTGGAGG - Intergenic
908666172 1:66493666-66493688 CTGGGTCTGCTTAAGACTGGAGG - Intergenic
908686720 1:66728941-66728963 TAGGGCCTGCTTGAGGGAGGAGG + Intronic
908905469 1:69003877-69003899 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
909125270 1:71660313-71660335 TGGGGTCTGCTTGAGAGGGGAGG + Intronic
909210831 1:72820741-72820763 TGGGGTCTACTTGAGGCAGGAGG + Intergenic
910041974 1:82863482-82863504 TGGGGCCTTCTTCAGGGAGGAGG - Intergenic
910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG + Intergenic
910889897 1:92007391-92007413 TGGGGTCTACTTGAGGGTGGAGG - Intronic
911639739 1:100275219-100275241 TGGGGACTGCTAATGGGAGGAGG + Intronic
912891195 1:113533421-113533443 TGGGGTCTCCTTCAGGGTGGAGG + Intronic
914984966 1:152448596-152448618 TAGGGAGTGCTGAAGGCAGGTGG + Intergenic
915305641 1:154975913-154975935 TGGGGCCTGCTTGAGGGAGGAGG + Intronic
915696211 1:157745162-157745184 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
916501072 1:165387306-165387328 TTGGGTCTGTCTGAGGCAGGTGG - Intergenic
916568240 1:166001588-166001610 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
916807616 1:168274205-168274227 TGGGGCCTACTTGAGGCTGGAGG - Intergenic
917228337 1:172808172-172808194 TGGGGCCTACTTGAGGAAGGAGG - Intergenic
917253563 1:173089340-173089362 TGGGGTCTACTTGAGGGAGGAGG - Intergenic
917990163 1:180367544-180367566 TGGGGTCTGCTTGAGGGTGGAGG - Intronic
918259930 1:182786493-182786515 TGGTGGCTGCTTATGGCTGGGGG + Intergenic
918466677 1:184827782-184827804 CGGGGCCTGCTTCAGGAAGGAGG - Intronic
918581992 1:186142158-186142180 TGGGGCCTACTTGAGGGAGGAGG - Intronic
919965086 1:202515130-202515152 TGGGGTCTACTTGAGGGAGGAGG + Intronic
920763024 1:208804123-208804145 TGGGGTCTACTTGAGGGCGGTGG - Intergenic
921336197 1:214089002-214089024 TGGGATCTGCTTGAGGGTGGAGG - Intergenic
922259649 1:223926775-223926797 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
922380834 1:225023076-225023098 TGGAGACTGCTTGAGGGAGGAGG + Intronic
924340812 1:243029331-243029353 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1063962363 10:11317610-11317632 TGTGGTCTGCTTATGGCACTTGG + Intronic
1064113693 10:12559850-12559872 TGAGGACTGCTAAAGGCAGCAGG + Intronic
1064898346 10:20264302-20264324 TGGGGTCTGCTTGAGGGGGAAGG + Intronic
1065059824 10:21888763-21888785 TGGGGTCTACTTGAGGTTGGAGG + Intronic
1065232785 10:23615611-23615633 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
1066161350 10:32734426-32734448 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1066735659 10:38476076-38476098 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1067070724 10:43129153-43129175 TGGGGTGTGCTGCAGGCTGGTGG - Exonic
1067162651 10:43840380-43840402 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1067852252 10:49761589-49761611 TAGGGCCTGCTTGAGCCAGGTGG + Intronic
1068850794 10:61737792-61737814 TGGGGTCTACTTGAAGCAGGAGG + Intronic
1070871124 10:79754445-79754467 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071343546 10:84669928-84669950 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071410539 10:85388173-85388195 TGGGGTCTACTTGAGGGGGGAGG + Intergenic
1071638058 10:87276653-87276675 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071657186 10:87461299-87461321 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1071710771 10:88046944-88046966 TGGGGACTGCTAGAGGAAGGAGG + Intergenic
1072400645 10:95096022-95096044 TGGGTTCTCCTCAAGGCAGTGGG + Intergenic
1073196080 10:101693799-101693821 GGGGGCCTGCTTGAGGCAGGAGG - Intronic
1073232096 10:101980653-101980675 TGGTGTCTGCTAAAGTCAGTAGG - Intronic
1073669520 10:105572096-105572118 TGGAGCCTGCTTAAGGATGGAGG + Intergenic
1073992122 10:109273787-109273809 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1075006220 10:118832031-118832053 TGGGGGCTGCTTTAGACAGGTGG + Intergenic
1075342468 10:121658427-121658449 TGGGGCCTGCTTGAGGGTGGAGG + Intergenic
1075569676 10:123530724-123530746 TGGAGCCTGCTTCAGGAAGGGGG - Intergenic
1076169837 10:128309903-128309925 TGGGGTCTGCTCAAGGCGGGTGG - Intergenic
1076967540 11:103011-103033 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1077706513 11:4491769-4491791 TGGGGCCTATTTAAGGTAGGAGG + Intergenic
1077978968 11:7279463-7279485 TAGAATCTGCTTAAGGCAGCGGG + Intronic
1078464774 11:11541980-11542002 TGGGGTCTTCTGAAGGGTGGGGG - Intronic
1079623357 11:22583265-22583287 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1079663768 11:23076836-23076858 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1079809766 11:24982590-24982612 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1080195907 11:29608461-29608483 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1080777373 11:35398498-35398520 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1080864399 11:36180515-36180537 TGGGGACAGCTGAAGACAGGAGG + Intronic
1081425513 11:42922048-42922070 TGGGGTCTACTTCAGGGTGGAGG - Intergenic
1082712064 11:56565105-56565127 TGGGGTCTTCTTGAGGGGGGAGG - Intergenic
1082761169 11:57128240-57128262 TGGGGTCTACTCAAGGGTGGAGG - Intergenic
1082912897 11:58396717-58396739 TGGGGCCTACTTAAGGGTGGAGG - Intergenic
1085965862 11:81525252-81525274 TGGGATCTGCTTGAGGAGGGAGG - Intergenic
1086031840 11:82368699-82368721 TGGGGTCTCCAAAAGGGAGGAGG + Intergenic
1087131014 11:94669294-94669316 AGAGGCCTGCTTAAGGGAGGAGG - Intergenic
1087167111 11:95016003-95016025 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1087699165 11:101415985-101416007 TGGAGTCTACTTAAAGCTGGAGG + Intergenic
1087842819 11:102937507-102937529 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1088157266 11:106822519-106822541 TGGGTCCTGCTTGAGGGAGGAGG - Intronic
1088620390 11:111675907-111675929 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1089291805 11:117441781-117441803 TGGGGTCTGCTTGGAGCAGTGGG + Intronic
1089397368 11:118145244-118145266 TGGGGTTTTATTAAGGGAGGCGG - Intronic
1089629754 11:119777142-119777164 TAGGGTCTCCTTAAGGGTGGAGG - Intergenic
1090538026 11:127667390-127667412 TGGGGTCTGCTTGAGGGTGGAGG + Intergenic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1091901780 12:4149886-4149908 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1092029124 12:5269155-5269177 TGGGATGTGCTCAGGGCAGGTGG + Intergenic
1092181881 12:6451824-6451846 TGGGGCCTGCTTAAGGGCGGGGG + Intronic
1092438546 12:8475035-8475057 TGGGGCCTGCGTAGGGTAGGGGG - Intronic
1093429044 12:19063448-19063470 TGAGGTCTACTTGAGGGAGGAGG - Intergenic
1093605169 12:21079965-21079987 TGGGGTCTGCTTGTGGGTGGAGG + Intronic
1093753669 12:22829604-22829626 TGGAGGCTGCATAAAGCAGGGGG - Intergenic
1094171121 12:27493166-27493188 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1094485051 12:30918709-30918731 TGGGGTCTTCTTGAGGGTGGAGG - Intergenic
1095357755 12:41296378-41296400 TGGGGGCTGCTCAAGGCATTTGG + Intronic
1095515792 12:43003845-43003867 TGGGGTCTACTTGAGGTGGGTGG + Intergenic
1095620068 12:44242294-44242316 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1095799865 12:46260615-46260637 TGCGTTCTGCTTCAGGCATGTGG - Intronic
1097292887 12:57934069-57934091 TGGGGTCTGCTTGAGGGTGGAGG - Intergenic
1097554031 12:61115373-61115395 TGGGGGCTGCACAAAGCAGGTGG - Intergenic
1097670314 12:62529010-62529032 TGGGGTGTACTTGAGGCGGGAGG - Intronic
1098772041 12:74564635-74564657 TTGGGCCTTGTTAAGGCAGGAGG - Intergenic
1098776522 12:74627036-74627058 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1099391047 12:82078702-82078724 TGGGATCTACTGAAGGTAGGAGG - Intergenic
1100001771 12:89845186-89845208 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1100098985 12:91079321-91079343 TGGGGACTGGGTGAGGCAGGAGG + Intergenic
1103051778 12:117786486-117786508 TAGGGTCTGCTTAAGGGTGGAGG - Intronic
1104155787 12:126130401-126130423 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1104419547 12:128623983-128624005 TGGAGTTTGCGTAAGGTAGGAGG + Intronic
1104537378 12:129630859-129630881 TGGGGCCTGCTTGAGGGTGGAGG - Intronic
1104895921 12:132163550-132163572 TGGGGGCTGCTCAGGCCAGGGGG + Intergenic
1105336651 13:19477197-19477219 TGGGGTCTACTTAAGTGGGGAGG + Intronic
1105727585 13:23180032-23180054 TGGGGCCTGCTTGAGGAAGGAGG - Intergenic
1106366449 13:29085440-29085462 TGGGGTCTACTTAAGCAGGGAGG - Intronic
1107269611 13:38599817-38599839 TGGGGACTGCTTGAGAGAGGGGG + Intergenic
1107435762 13:40379588-40379610 AGGGGTTTTCTTAAGGCAGTTGG + Intergenic
1107642183 13:42454628-42454650 TGAGGTCTTCTTAATGCGGGAGG + Intergenic
1108787795 13:53926958-53926980 TGGGGTCTACTTGAGGCTGGAGG - Intergenic
1108795762 13:54028373-54028395 TGGTGTCTGCATACTGCAGGTGG + Intergenic
1109291047 13:60475244-60475266 TGGGGACTGCTTAAGGGAGAAGG - Intronic
1109598602 13:64592525-64592547 TGGGGTCTACTTAAGAGTGGAGG - Intergenic
1110406728 13:75159303-75159325 TGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1110866469 13:80401647-80401669 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1110961813 13:81636259-81636281 TGGTCTCTGCTTTAGGCAGGTGG + Intergenic
1112831748 13:103460863-103460885 TGGGGGCTGCTAGAGGGAGGAGG + Intergenic
1113090914 13:106616982-106617004 ATGGGTCTGGTCAAGGCAGGAGG + Intergenic
1113363255 13:109651538-109651560 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1113477227 13:110592756-110592778 TGGGTTCTGCTTAGGGGATGTGG - Intergenic
1113793262 13:113041778-113041800 TGGGGGCTGCGCAGGGCAGGAGG + Intronic
1113988250 13:114336818-114336840 TGGGGTCTACTTGAGGGGGGAGG + Intergenic
1114159668 14:20150393-20150415 TGGGGTCTACTTGAGGATGGAGG + Intergenic
1114406501 14:22462031-22462053 AGGGATCTGCTGAAGGTAGGTGG - Intergenic
1114958989 14:27859233-27859255 TGGGGTGTGCTTGAGGGAGGAGG + Intergenic
1115177011 14:30574578-30574600 TGGGGTCTACCTGACGCAGGAGG - Intronic
1115913532 14:38283575-38283597 TGGGATGTGATTAAGTCAGGAGG + Intergenic
1116687551 14:48059770-48059792 TGGGGTCTCCTTAAGGGTGGAGG + Intergenic
1116695667 14:48173996-48174018 TGGGGACTGGGTGAGGCAGGTGG + Intergenic
1117664300 14:58040317-58040339 TGGGGCCTGTTTAAGGGTGGAGG - Intronic
1118527461 14:66661910-66661932 CGGGGACTGCTTAAGGAAGCAGG - Intronic
1118877885 14:69799776-69799798 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1119115984 14:72021932-72021954 TGGGGTCTACTTGAGGGTGGGGG - Intronic
1120377852 14:83732320-83732342 TGGGGTCTACTTGAGGAGGGAGG + Intergenic
1121083335 14:91126424-91126446 TGGGGTGTGCTCAGAGCAGGGGG + Intronic
1122209397 14:100165355-100165377 TGGGGTCTGCTGAAGTCAGGGGG - Intergenic
1122286967 14:100658112-100658134 TGGGGTCTGGACAAGCCAGGAGG + Intergenic
1122342895 14:101039904-101039926 AGGGGTCTCCTCAAGGCGGGTGG - Intergenic
1123111068 14:105867051-105867073 TGGTGTGTGCTTGTGGCAGGTGG - Intergenic
1123450610 15:20357241-20357263 TGGGGGCTGCTCAGGGCAGGTGG + Intergenic
1123500753 15:20878569-20878591 CGGGGGCTGCTTGAGGCCGGGGG + Intergenic
1123557999 15:21452262-21452284 CGGGGGCTGCTTGAGGCCGGGGG + Intergenic
1123594227 15:21889543-21889565 CGGGGGCTGCTTGAGGCCGGGGG + Intergenic
1123886243 15:24730714-24730736 TGAGGCCTCTTTAAGGCAGGAGG + Intergenic
1124156340 15:27228218-27228240 TGGGGTCTGCTTAAGGCAGGAGG - Intronic
1124379804 15:29155822-29155844 GGGGGGCTGTTTCAGGCAGGAGG + Intronic
1124447850 15:29754356-29754378 TGGGGTCTACTTGAGGGGGGAGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1125891708 15:43271462-43271484 TGGGGTCTACTTGAGGGATGAGG - Intergenic
1126223767 15:46245490-46245512 TGGGGTCTGCTTGATGGGGGAGG - Intergenic
1128271178 15:66311270-66311292 GGAGGATTGCTTAAGGCAGGGGG + Intronic
1129707652 15:77803954-77803976 TGGGCCCTTCTTAAGGCAGCAGG + Intronic
1129760380 15:78125799-78125821 TGGGGTCTGCTGAGGGATGGGGG - Intronic
1130332428 15:82932835-82932857 TGGGGTGTGCACAGGGCAGGAGG - Intronic
1130405339 15:83595339-83595361 TGGGGCCTGCTTGAGGGTGGAGG + Intronic
1130638368 15:85646790-85646812 TGGAGGCTGCCTAAGGGAGGTGG + Intronic
1202966350 15_KI270727v1_random:179434-179456 CGGGGGCTGCTTGAGGCCGGGGG + Intergenic
1132602594 16:780248-780270 GGGGGTCTGCTTGAGGCCAGAGG + Intronic
1132715124 16:1286308-1286330 TGGGGTCTGCATGATCCAGGAGG - Intergenic
1132907221 16:2288902-2288924 TGGTGTCTCCTTGTGGCAGGGGG - Intronic
1134272524 16:12745660-12745682 TGGGGTCCGCTTAAGGCGGGAGG + Intronic
1134766670 16:16764863-16764885 TGGGACCTGCTTGAGGGAGGAGG - Intergenic
1135533012 16:23270646-23270668 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1135847250 16:25929957-25929979 TGGGGCCTACTTAAGGGTGGAGG - Intronic
1136601380 16:31292417-31292439 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1138106675 16:54290731-54290753 AGGGGGCTGCTCAAGTCAGGTGG - Intergenic
1138742625 16:59328500-59328522 TGGGGACTGCTAAAGAGAGGAGG - Intergenic
1139650495 16:68359809-68359831 TGGAGTCTCTTAAAGGCAGGTGG + Exonic
1141571595 16:84937297-84937319 TGGGACCTGCTCAAGGGAGGAGG - Intergenic
1142318551 16:89365864-89365886 TGGGGTCTGCTTGAGGGTTGGGG - Intronic
1142453142 16:90196132-90196154 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1143130216 17:4672926-4672948 TGGGGCCTGCTGAAGGCATGGGG + Exonic
1145246962 17:21275740-21275762 CGGGGTCAGCTCAGGGCAGGCGG - Intergenic
1146320851 17:31845240-31845262 TGGGGGATGCTAAGGGCAGGTGG - Intergenic
1146538924 17:33678059-33678081 TGGGGACTGTTGAAGGCTGGGGG - Intronic
1146784120 17:35703667-35703689 TGGGGTCTGCTAGAGGGTGGAGG + Intronic
1147759370 17:42787696-42787718 TGGGGCCTGCCTAAGCAAGGAGG - Intronic
1148156281 17:45426817-45426839 AGGGGGCTGCTGAAGGCAGAGGG - Intronic
1148219921 17:45854017-45854039 CTGGGTCTTCTTAAAGCAGGAGG + Intergenic
1148894543 17:50832320-50832342 TGGGGTGTGCATAAGCCACGTGG + Intergenic
1149296509 17:55266009-55266031 GGGGGTCGGCTTGAGGGAGGGGG + Intronic
1149624591 17:58071582-58071604 TGGGGTCTACTTGATGGAGGAGG + Intergenic
1149949634 17:60971943-60971965 TGGTGGCTGCATCAGGCAGGTGG + Intronic
1150057147 17:62028380-62028402 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1150289630 17:63973817-63973839 TGGGGACTGCTTTTGGCTGGTGG + Intergenic
1150846777 17:68666471-68666493 TGGGGTCTACTTGAGGGGGGAGG - Intergenic
1151027290 17:70693355-70693377 TGGGGCCTACTTAAGGGTGGAGG - Intergenic
1151278411 17:73053756-73053778 TGGGGTGAGCTCAGGGCAGGGGG - Intronic
1152337829 17:79708093-79708115 TGGGGGCTGCTCAGGGCAGGTGG - Intergenic
1152569747 17:81116446-81116468 TGGGGCCTGCCCGAGGCAGGAGG - Exonic
1152637459 17:81436028-81436050 TGGGGTCATCTTTGGGCAGGGGG - Intronic
1152666337 17:81571888-81571910 TGGGCACTGCTCAAGGCAGAGGG + Intronic
1152666339 17:81571926-81571948 TGGTGGCTGCTCAAGGGAGGAGG - Intronic
1152783271 17:82235819-82235841 TGGTGTCTGGTGGAGGCAGGAGG - Exonic
1153969256 18:10210425-10210447 TGGGGGCTGCCTAGGGGAGGTGG - Intergenic
1154145814 18:11865422-11865444 TGGGGTTTGCTTAGCACAGGTGG - Intronic
1155315706 18:24568265-24568287 TGTGGGGTGATTAAGGCAGGGGG + Intergenic
1155335519 18:24760708-24760730 TGGGGCCTGCTTGAGGGTGGAGG + Intergenic
1155444709 18:25899098-25899120 TGGGATCGTCTAAAGGCAGGTGG + Intergenic
1155576917 18:27258618-27258640 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1155777870 18:29791158-29791180 TAGGGTCTGCTTGAGGAAGGAGG - Intergenic
1156125271 18:33897598-33897620 TGGGTTCTACTTGAGGAAGGTGG + Intronic
1156928491 18:42612258-42612280 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1157084341 18:44563632-44563654 CGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1157170193 18:45396824-45396846 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1158688758 18:59641434-59641456 TGGGGCCTGCTTGAGGGTGGAGG + Intronic
1158822978 18:61182237-61182259 TGGGGCCTGCTTGAGGAAAGAGG + Intergenic
1159524513 18:69570028-69570050 TGGGATCTACTTGAGGGAGGAGG + Intronic
1159949658 18:74473709-74473731 TGGGCTTTGCTTAAGGGAGATGG - Intergenic
1160218849 18:76957665-76957687 TGGGGCCTCCTTGAGGGAGGAGG - Intronic
1160644344 19:172634-172656 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1161358149 19:3831271-3831293 TGGGGCCTGCCCATGGCAGGAGG + Intronic
1161621463 19:5299476-5299498 TGGGTGCTGCTTGAGCCAGGTGG - Intronic
1161723979 19:5918027-5918049 TGTGTTCTGCAGAAGGCAGGAGG - Intronic
1162834112 19:13305010-13305032 CAGGGTCTGCCTCAGGCAGGGGG - Intronic
1163674320 19:18647768-18647790 TGGGATCTACTGAAGGCAAGGGG + Intronic
1165221145 19:34317612-34317634 TAGAGTCTGCTGAAGGCAGTGGG + Intronic
1166623319 19:44325220-44325242 TAGGGTCTGGGTAAGGTAGGGGG - Intergenic
1167989166 19:53343159-53343181 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1168208775 19:54873295-54873317 TGGGGTCTCCTTTAGGGTGGAGG + Intergenic
1168280550 19:55303298-55303320 TTGGTTCTCCCTAAGGCAGGGGG - Exonic
1168317672 19:55491105-55491127 TGGGGTCTGAGGAAGACAGGAGG - Intronic
1168383911 19:55946715-55946737 TGGAGTCTGCTAGAGGCTGGAGG - Intergenic
924959622 2:22255-22277 TGGGGTCTGCTTGAGGGGGGAGG - Intergenic
925139423 2:1539749-1539771 TGTGGTCCTCTTCAGGCAGGCGG + Intronic
925565728 2:5252191-5252213 TGGGGTCTACTTGAGGGCGGAGG - Intergenic
926929114 2:18018371-18018393 TGGGGACTGCTTGAGGAGGGAGG - Intronic
927384966 2:22522207-22522229 TGGGGTCTGCTTGACGGGGGAGG + Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
927846823 2:26476444-26476466 TGGGGTCCGGTGGAGGCAGGAGG + Intronic
928209764 2:29314820-29314842 TGGGGTGTGTGAAAGGCAGGGGG + Intronic
928470649 2:31572290-31572312 TGGGGTCTACTTGAGGGTGGAGG + Intronic
930450496 2:51530623-51530645 TGGGGTCTTCTTGAGGGTGGAGG - Intergenic
930453209 2:51570705-51570727 TGGTTTCTGATTAAGGCATGAGG - Intergenic
930926533 2:56824653-56824675 TGGGGCCTGCTGGAGGCTGGAGG + Intergenic
931543778 2:63358071-63358093 TGGGGTCTACTTGAGGGTGGAGG + Intronic
931547309 2:63403260-63403282 TGGGGTCTACTTGAGGGAGGAGG + Intronic
931577921 2:63739180-63739202 TGGGGTCTACTTGAGGTGGGAGG - Intronic
932647302 2:73516887-73516909 TTGTACCTGCTTAAGGCAGGGGG - Intronic
932913304 2:75828318-75828340 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
933401684 2:81806558-81806580 TGGGGTCTACTTGAGATAGGAGG - Intergenic
933544075 2:83687285-83687307 TGGGATCAGATTATGGCAGGAGG + Intergenic
933619434 2:84520578-84520600 TGGAGTCTACTTGAGGGAGGAGG - Intronic
934478351 2:94609258-94609280 TGGGGTGTGCTTGAGGGAGGAGG - Intergenic
935877636 2:107528705-107528727 TGGGGGCTGCGTAAGGAAGAAGG + Intergenic
937160840 2:119759806-119759828 GGGGGTGTGCTTGAGGGAGGAGG + Exonic
937932294 2:127216524-127216546 TGGTGGTTGCTTAAAGCAGGGGG + Intronic
938095839 2:128462711-128462733 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
938696353 2:133838647-133838669 AGGAGTTTGCTTAAGGCAAGAGG + Intergenic
939900959 2:147848645-147848667 TGGGGTCTACTCAAGGATGGAGG + Intronic
940198712 2:151126261-151126283 TTGGGACTGCTTGAGGGAGGAGG + Intergenic
941034970 2:160558646-160558668 TGGGGTCTACTTAACGTGGGAGG + Intergenic
942256730 2:174109959-174109981 TGGGGTCTACTTGAGGAAAGAGG - Intronic
942414568 2:175745402-175745424 TGGGCTCTGCTCAAGCTAGGTGG + Intergenic
942607508 2:177708470-177708492 TGGGGTCTGTTTGAGGCAGGAGG + Intronic
942638888 2:178039366-178039388 TGGGGTCTACTTAAGGATGGAGG + Intronic
942719523 2:178935277-178935299 TGGGGTCTTCTTGAGGGTGGAGG - Intronic
942884276 2:180903308-180903330 TGGGGTCTGCTTGAGGTGGGAGG + Intergenic
942908555 2:181213071-181213093 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
943375331 2:187069183-187069205 TGGGGTCTACTTGAGGTTGGAGG + Intergenic
943947472 2:194086629-194086651 TGGGGTCTACTTGAGGTGGGAGG - Intergenic
944198123 2:197076658-197076680 TGGGGCCTACTTAAGGGTGGAGG - Intronic
944269538 2:197765848-197765870 TGGGGTCTACTTGAGGGTGGAGG - Intronic
945031150 2:205664882-205664904 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
945672463 2:212818791-212818813 TGGGGTCAGCTTGGGGTAGGAGG + Intergenic
946964275 2:225021013-225021035 GGGAGTTTGCTAAAGGCAGGAGG + Intronic
947327025 2:228990846-228990868 TGGGGCCTACTTGAGGGAGGAGG + Intronic
947349093 2:229223936-229223958 TGGGGTCTTCAAAAGCCAGGAGG - Intronic
947477664 2:230465578-230465600 TGGGGTCTACTTGAGGATGGAGG + Intronic
948508580 2:238448120-238448142 TGGGTCCTGCTGAAGCCAGGAGG + Exonic
948512128 2:238475535-238475557 TGGGGACTGGGTAAGGGAGGAGG + Intergenic
948534445 2:238635554-238635576 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
948954330 2:241274894-241274916 TTGGGTCTGCTCAAGGTAGGAGG + Intronic
949035328 2:241813521-241813543 TGGGGTCTGCTTGTTGCAGGCGG - Intronic
949079057 2:242082210-242082232 TGGGGCCTACTTGAGGCTGGAGG + Intergenic
949084580 2:242140797-242140819 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1169947595 20:11006024-11006046 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1169996475 20:11563188-11563210 TGGGGACTACTAAAGGGAGGAGG + Intergenic
1170143243 20:13146263-13146285 TGGGATCTGCTTGAGGGAGGAGG + Intronic
1170307051 20:14950163-14950185 CAGGGTCTGATTAAGGCAGATGG + Intronic
1171546118 20:26002907-26002929 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
1172846094 20:37930737-37930759 TGGGCTCTGCATGGGGCAGGAGG + Intronic
1173528141 20:43748480-43748502 GGAGGGTTGCTTAAGGCAGGAGG - Intergenic
1176281160 20:64313291-64313313 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1176736902 21:10557910-10557932 TGGGGTCTACTTAAGTGGGGAGG - Intronic
1177121107 21:17138106-17138128 TGGGGACTACTAAAGGGAGGAGG + Intergenic
1177593191 21:23200719-23200741 TGGGGGCTACTAGAGGCAGGAGG + Intergenic
1177688547 21:24472394-24472416 TGGGGTCTACTTGAAGGAGGAGG - Intergenic
1178203447 21:30435719-30435741 TGGGATCTACTTGAGGGAGGAGG - Intergenic
1178546257 21:33495405-33495427 TGGGGTCTGCTTGAGGTGGGAGG + Intergenic
1178562251 21:33649608-33649630 TGGGGTCTGCTGGAGTCATGTGG + Intronic
1179092174 21:38276543-38276565 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1179174510 21:38997959-38997981 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1179633118 21:42690900-42690922 TGGATGGTGCTTAAGGCAGGTGG - Intronic
1180562903 22:16635450-16635472 TGGGGTCTACTTAAGTGGGGAGG - Intergenic
1180699985 22:17775984-17776006 TGGGGTGGCCTGAAGGCAGGAGG + Intergenic
1182263122 22:29090368-29090390 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1182947791 22:34340924-34340946 TGGGGTCTCCCTAAGACTGGGGG + Intergenic
1184490926 22:44808470-44808492 TGTGGGCTGCTTGTGGCAGGAGG + Intronic
1184744044 22:46445906-46445928 AGGGGGCTGCTGGAGGCAGGAGG - Intronic
949392941 3:3582940-3582962 TCGGCTCTGACTAAGGCAGGTGG - Intergenic
951555299 3:23915754-23915776 AGGGGTCTGATTCAGGCAGAGGG - Intronic
951732810 3:25829365-25829387 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
952228094 3:31399929-31399951 TGGGATCTGCTTGAGGGTGGAGG - Intergenic
953745221 3:45568794-45568816 TGGGGCCTGCTTGAGGGTGGAGG - Intronic
953979223 3:47405382-47405404 TTTGGGCTGCTTCAGGCAGGAGG + Intronic
954756370 3:52842592-52842614 TTGGGCCTGCCTAGGGCAGGAGG - Intronic
954879265 3:53822823-53822845 TGGGGTCCCCTGGAGGCAGGTGG + Intronic
955245181 3:57218260-57218282 TGGGGCCTGCTTGAGGGTGGAGG - Intronic
955442140 3:58967864-58967886 TGGGGTCTACTTGAGGGTGGAGG - Intronic
956964531 3:74443486-74443508 TGGGTTCATCTTAAGGCTGGTGG - Intronic
957030368 3:75234015-75234037 CGGTGTCTACTTGAGGCAGGAGG - Intergenic
957159918 3:76597697-76597719 TGGGGCCTGCTTAAGCGGGGAGG - Intronic
957746488 3:84349518-84349540 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
958514964 3:95102452-95102474 TGGGGTCTGCTTGAGAGTGGAGG + Intergenic
959098335 3:101981838-101981860 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
959482785 3:106893979-106894001 TGGAGTCTACTTGAGGGAGGAGG + Intergenic
959943401 3:112103198-112103220 TGGGGCCTACTTAAGGGCGGAGG + Intronic
960475178 3:118116013-118116035 TGGGGCCCACTTGAGGCAGGAGG + Intergenic
960782680 3:121337083-121337105 TGGGGTCTACTTGAGGGTGGTGG + Intronic
961590531 3:127976996-127977018 TGGGGCCTACTTAAGGGTGGAGG - Intronic
961865123 3:129948270-129948292 GGGGAGCTGCTAAAGGCAGGTGG + Intergenic
962270887 3:133977375-133977397 CAGGATCTGCTTAAGACAGGAGG - Intronic
962451726 3:135524357-135524379 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
962881883 3:139586211-139586233 TGGGGTCTACTTGAGGGTGGAGG + Intronic
963674400 3:148290945-148290967 TGGGGTCTCCTTGAGGGTGGAGG + Intergenic
964505641 3:157395867-157395889 TGGAGTCTACTTGAGGCGGGAGG - Intronic
964529865 3:157655853-157655875 TGGGGTCTACTTGAGGGTGGAGG - Intronic
965058814 3:163755872-163755894 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
965392190 3:168118525-168118547 TGGGGTCTACTTAAGGGGGAGGG - Intergenic
965563232 3:170081728-170081750 TGGGGTCTACTTGAGGGAGGAGG - Intronic
965615533 3:170588245-170588267 TGGAATCTGCTTAAGGTTGGAGG - Intronic
966453539 3:180089843-180089865 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
966671779 3:182535330-182535352 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
967411469 3:189170303-189170325 TGGGGTCTGTATTAGGGAGGGGG + Intronic
968078408 3:195829844-195829866 GGGGGGCTCCTCAAGGCAGGGGG - Intergenic
968391902 4:199770-199792 TGGGGTGGGCAAAAGGCAGGAGG - Intergenic
968536102 4:1130696-1130718 GGGCGTGTGCTTAAGGCTGGAGG - Intergenic
970631605 4:17952893-17952915 TGGGGCCTACTTGAGGGAGGAGG - Intronic
970742511 4:19254759-19254781 GAGGGCCAGCTTAAGGCAGGAGG - Intergenic
970945297 4:21683963-21683985 TGGGGCCTGCTTGAGGGAGGAGG + Intronic
971610423 4:28718151-28718173 TGGGGACTGCTTGAGGGTGGAGG + Intergenic
973062011 4:45738580-45738602 TGGGGCCTACTTGAGGCTGGAGG - Intergenic
973594841 4:52477474-52477496 TCTGGTCTGCTTAATGCAGAGGG + Intergenic
974748777 4:66109876-66109898 TGGGGACTGCTTGAAGGAGGAGG - Intergenic
974750530 4:66134738-66134760 TGGGGTGTGATTAAGTCATGAGG - Intergenic
974944192 4:68506183-68506205 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
974954740 4:68623496-68623518 TGGGGTCTACTTGAGGGTGGAGG + Intronic
976015840 4:80553155-80553177 TGGGGTCTACTTGAGGGTGGAGG - Intronic
976318353 4:83683595-83683617 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
977582408 4:98739965-98739987 TGGGGCCTACTTAAGGGTGGAGG - Intergenic
977732362 4:100368962-100368984 TGGAGTCTACTTAAGGGTGGAGG - Intergenic
978320631 4:107490796-107490818 TGGGGCCTACTTGAGGCTGGAGG + Intergenic
978727620 4:111988160-111988182 TGTGGTATGCTTGAGGTAGGAGG + Intergenic
978870659 4:113573030-113573052 TGGGGTCTACTTGAGGAAGGAGG + Intronic
979262010 4:118659029-118659051 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
980816078 4:137947898-137947920 TGGGGCCTACTTAAGGGTGGAGG - Intergenic
981000393 4:139823547-139823569 TGGGCTCTGCTCTGGGCAGGAGG + Intronic
981629403 4:146801068-146801090 TGTGGTATGCTGAGGGCAGGGGG + Intronic
981834182 4:149036184-149036206 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
983006711 4:162493236-162493258 TGGAGGCTGCATAAAGCAGGGGG - Intergenic
983447287 4:167869497-167869519 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
984056322 4:174933631-174933653 TGGGGTCTCCTTGAGGATGGAGG - Intronic
985305186 4:188531660-188531682 TGGGGACTGCTTGAGGGGGGAGG + Intergenic
986029370 5:3880961-3880983 AGGGGTCTGAGGAAGGCAGGAGG - Intergenic
986311468 5:6554019-6554041 TGGGGTCTCTTTAAGGCTGAAGG + Intergenic
986374546 5:7116656-7116678 TGGGGCCTACTTAAGGGTGGAGG - Intergenic
986614972 5:9606715-9606737 TGGGGTCTGCTTTGGGAAGGTGG - Intergenic
987018557 5:13846288-13846310 TGGGGTCTACTTGAGGGTGGAGG - Intronic
987501243 5:18711976-18711998 TGGGGCCTACTTAAGGGTGGAGG + Intergenic
987939280 5:24511971-24511993 TGGGGCCTACTTGAGGCTGGAGG + Intronic
987966969 5:24890092-24890114 TGAGGCCTACTTGAGGCAGGAGG + Intergenic
989734132 5:44682547-44682569 TGGGGCCTACTTAAGGTTGGAGG + Intergenic
990224870 5:53638535-53638557 TGGGGCCTACTTGAGGTAGGAGG + Intronic
990731335 5:58812189-58812211 TGGGGGCTGGTGGAGGCAGGAGG + Intronic
991413888 5:66371573-66371595 TGGGGTCAGCTTAAGCCAACAGG + Intergenic
991455632 5:66800530-66800552 TGGGGCCTGCTTGAGGGTGGAGG + Intronic
991510233 5:67368256-67368278 TGGGGACTACTAGAGGCAGGTGG - Intergenic
991673451 5:69070088-69070110 TGGGGCCTGCTTAAGGATGGAGG - Intergenic
992280489 5:75170664-75170686 TGGGGACTACTTATGGGAGGAGG - Intronic
993446837 5:88023369-88023391 TGGGGTCTACTTAGGGGTGGAGG - Intergenic
993671179 5:90763680-90763702 TGGGGACTACTTGAGGCAGCAGG - Intronic
993944926 5:94106970-94106992 TGGGGTCTACTTCAGGGTGGAGG + Intronic
994467418 5:100155619-100155641 TGGGGTCTACTTGAGGGAGGAGG - Intergenic
994618870 5:102138808-102138830 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
995700451 5:114929238-114929260 TGGGGCCTCCTTAGAGCAGGGGG - Intergenic
996893375 5:128450209-128450231 TGTGCTCTGCTTAAGTGAGGTGG - Intronic
996990797 5:129628289-129628311 TGGGGCCTACTGAAGGCTGGAGG + Intronic
997447017 5:133947830-133947852 TGGAGTCTGCTAAAGGCAGGGGG + Intergenic
997609466 5:135204812-135204834 TGGGGTCTACTTGAGGGTGGAGG - Intronic
997641859 5:135454510-135454532 TGGGGTCTACTTGAGGGTGGGGG - Intergenic
997933548 5:138091273-138091295 GGGGGTCTGCCAAAGTCAGGAGG - Exonic
999056039 5:148577805-148577827 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1000276492 5:159740815-159740837 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1002197314 5:177508502-177508524 TGGGCTCTGCTGTATGCAGGAGG - Exonic
1002732577 5:181352147-181352169 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1002751960 6:121960-121982 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1002981513 6:2143017-2143039 TGGGGTCTGATGCAGGCTGGAGG - Intronic
1003551620 6:7106956-7106978 TGGGGTGTGGGTAAGGGAGGGGG + Intergenic
1004076694 6:12350451-12350473 TGGGGCCTGCTTGTGGGAGGAGG - Intergenic
1004299400 6:14443705-14443727 CGGGGTCTGCTTCTGTCAGGTGG + Intergenic
1005178000 6:23070082-23070104 TGGGGTCTACTTGAGGATGGAGG - Intergenic
1006208564 6:32372764-32372786 TGGGGCCTACTTAAGGGTGGAGG + Intergenic
1007504952 6:42328500-42328522 TGGGGCCTGCTTGAGGGTGGAGG - Intronic
1007624363 6:43235095-43235117 TGGGGGTTGCCTAAGGCTGGGGG + Intergenic
1008068881 6:47079390-47079412 TTGGTTCTGCTTCAGGCAAGGGG + Intergenic
1009753625 6:67905117-67905139 TGGGGTCTACTTGAGGGGGGAGG + Intergenic
1011042590 6:83047416-83047438 TACTGGCTGCTTAAGGCAGGAGG + Intronic
1011716952 6:90116480-90116502 TGGGGTCTACTTGAGGAAGGAGG + Intronic
1011911585 6:92447488-92447510 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1012337473 6:98078972-98078994 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1012406601 6:98907419-98907441 AGGGGTCTGCTTAAGGCAGCTGG + Intronic
1012744638 6:103069978-103070000 TGGGGTCTGCTTGAGGCAAGAGG - Intergenic
1013278257 6:108607873-108607895 TGGGATCTCCTTTAGGCAGGGGG - Intronic
1013314794 6:108931077-108931099 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1014124890 6:117765531-117765553 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1014376890 6:120687186-120687208 TGGGGCCTGCTTAAGGGTGGAGG + Intergenic
1014707025 6:124760238-124760260 TGGCGTCTACTTGAAGCAGGAGG + Intronic
1014961208 6:127687479-127687501 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1015302804 6:131673508-131673530 TGGGGTCTGCTTGAGGCAGGAGG + Intronic
1015834582 6:137406313-137406335 TGGGGTCTACTTGAGGATGGGGG - Intergenic
1015985391 6:138879400-138879422 TGGGGTATACTTAGGGCTGGAGG + Intronic
1016298574 6:142602979-142603001 TGGGGTCTACTTAAGGGTGGAGG - Intergenic
1016453123 6:144203888-144203910 TGGGGTCTACTTGAGGGAGAAGG - Intergenic
1017928299 6:158929722-158929744 TGGGGAGTGATTAAGTCAGGAGG - Intergenic
1019099326 6:169615380-169615402 TGGGGTCTGCTTGAGGGTGGAGG - Intronic
1019236832 6:170624465-170624487 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1019478873 7:1256969-1256991 TGGGGCCTGGTGCAGGCAGGGGG - Intergenic
1020503344 7:8951914-8951936 TGGGGACTACTAGAGGCAGGAGG + Intergenic
1020861367 7:13495990-13496012 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1020862406 7:13511270-13511292 TGGGATCTACTTGAGGGAGGAGG - Intergenic
1021293962 7:18880638-18880660 TGGGGTCTACTTGAGAGAGGAGG + Intronic
1021407711 7:20292420-20292442 TGGGGTGGGGTTAGGGCAGGTGG + Intergenic
1021572489 7:22080605-22080627 TGGGGTCTACTTGAGGGAAGAGG + Intergenic
1021646967 7:22798042-22798064 TGGGCTATTCTTGAGGCAGGAGG + Intergenic
1021750235 7:23791452-23791474 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG + Intronic
1023174746 7:37425022-37425044 CTGGGTCTTCTTAAGGCAGAGGG - Intronic
1024208034 7:47180481-47180503 TGGGGTCTGATTAATGCAGAAGG + Intergenic
1024217730 7:47262218-47262240 TGGGGCCTACTTAAGGGTGGAGG + Intergenic
1024620980 7:51157444-51157466 TGGTGTCTTCTGAGGGCAGGGGG + Intronic
1024947221 7:54820880-54820902 TGCGGCCTGCTTAAGGGTGGAGG - Intergenic
1026149071 7:67772845-67772867 TTGGGGCTGCATCAGGCAGGTGG - Intergenic
1026161868 7:67876503-67876525 TGGGGTCTCCTTGAGGGAGGAGG - Intergenic
1027141037 7:75657726-75657748 TGGGGACTCCAAAAGGCAGGAGG + Intronic
1027683308 7:81247718-81247740 TGTGGTCTACTTGAGGGAGGAGG + Intergenic
1028342273 7:89736054-89736076 TGGGGTCTACTTGGGGCCGGGGG - Intergenic
1029054429 7:97726365-97726387 TGGTGTCTGCTTGAGGGGGGAGG - Intergenic
1031002824 7:116437186-116437208 TGGGGTCTGTTTGAGGGTGGAGG + Intronic
1031268634 7:119615567-119615589 TGGGGTCTCCTTGAGGAAGGAGG - Intergenic
1031288086 7:119898081-119898103 TGGGGTCTTCTTGATGGAGGAGG - Intergenic
1033278509 7:139990007-139990029 GGGTGTGTGCTTAAGGCCGGCGG - Intronic
1033286193 7:140042568-140042590 TAGGGTCTGAGTACGGCAGGAGG + Intronic
1033807242 7:144968685-144968707 TGGGGTCTACTTAAGGGCTGAGG - Intergenic
1033818971 7:145110258-145110280 TGGGGTCTGCTTGAGGGAGGAGG - Intergenic
1034156182 7:148957926-148957948 TGGGATCTGCTTGAGGGTGGAGG - Intergenic
1034646933 7:152656053-152656075 CGGGGCCTGCTGAAGGCATGAGG + Intronic
1035510940 8:182145-182167 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1035552204 8:537328-537350 TGGGGTGTGGTGCAGGCAGGAGG - Intronic
1035578850 8:727511-727533 AGGGGTCTGCAGCAGGCAGGCGG - Intronic
1036578205 8:10048193-10048215 GGGAGTCTGATTAAAGCAGGGGG + Intergenic
1036654769 8:10671085-10671107 TCACGTCTGCTTAAGGTAGGCGG - Intronic
1036791475 8:11723983-11724005 TGGGGGCTGCCTGAGGCTGGAGG - Intronic
1036920413 8:12848299-12848321 TGGGGTCTACTTGAGGATGGAGG + Intergenic
1036994669 8:13641823-13641845 TGGGGACTGCTTATGACAAGTGG + Intergenic
1037114362 8:15206014-15206036 TGGGGTCTACTTGAGGATGGAGG + Intronic
1038817561 8:30920791-30920813 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1038852931 8:31297699-31297721 TGGGGCCTACTTAAGGATGGAGG + Intergenic
1038949774 8:32401722-32401744 TGGGGTCTGCTGAGGGCAGAAGG + Intronic
1039206158 8:35157909-35157931 TGGGGACTGCTTGAGGTGGGAGG + Intergenic
1039571523 8:38590467-38590489 TTGGGCCTGCTTCAGGCAGAGGG + Intergenic
1039704141 8:39989881-39989903 TGGGCTCTGCTTAGGGGAAGAGG + Intronic
1039864466 8:41489504-41489526 TGGGGTCTGGGAGAGGCAGGAGG + Intergenic
1041013494 8:53567921-53567943 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1041039088 8:53827765-53827787 TGGGGTCTACTCAAGGGTGGAGG - Intronic
1041162188 8:55056617-55056639 TGGGGCCTGCTTGAGGGTGGAGG + Intergenic
1041180629 8:55244221-55244243 TGGGGTCTACTTGAGGCTGGAGG - Intronic
1041221395 8:55655161-55655183 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1041572058 8:59348896-59348918 TGGGGCCTACTTAAGGATGGAGG + Intergenic
1041695244 8:60728972-60728994 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1041749707 8:61246961-61246983 TGGGGTCTGCTTGAGTGGGGAGG - Intronic
1041914040 8:63121695-63121717 TGGGGCCTCCTTGAGGGAGGAGG - Intergenic
1042046299 8:64655997-64656019 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1042198774 8:66259001-66259023 TGGCTGCTGCTTAGGGCAGGAGG - Intergenic
1043407819 8:79956635-79956657 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1043474474 8:80592910-80592932 GGAGGATTGCTTAAGGCAGGAGG - Intergenic
1043586756 8:81779103-81779125 GGAGGTCAGCTTAAGGCATGTGG - Intergenic
1043663039 8:82770338-82770360 TGGGGTCTGCCTGAGGAGGGAGG - Intergenic
1043737959 8:83770530-83770552 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1043810955 8:84739948-84739970 TGGGGTTTGCTTGAGGGTGGTGG + Intronic
1043840568 8:85098867-85098889 TGGGGCCTACTTAAGGATGGAGG - Intergenic
1043994610 8:86797563-86797585 TGGGGTCTACTTGAGGTGGGAGG + Intergenic
1045186282 8:99841781-99841803 TGGGGTCTGCTTCAGGCCTTTGG + Intronic
1045619549 8:103958391-103958413 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1045819905 8:106324347-106324369 TGGGGTCTACTTGAGGGAGGAGG + Intronic
1046103846 8:109644486-109644508 TGGGGTCTGGAGAAGGCAGGAGG - Intronic
1046164274 8:110409516-110409538 TGGGCTCTACTTAAGGGTGGAGG + Intergenic
1047264887 8:123297232-123297254 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1047660379 8:127027361-127027383 TGGGGTCTACTTGAGGATGGAGG + Intergenic
1048079670 8:131111762-131111784 TAGGGACTACTAAAGGCAGGAGG - Intergenic
1048357450 8:133665131-133665153 TGGGGTTTGCATGAGGAAGGAGG + Intergenic
1048403275 8:134092507-134092529 TAGGGACTGCTTGAGGCAGGGGG + Intergenic
1048452104 8:134542454-134542476 TGGGGCCTGCTTGAGGGTGGTGG - Intronic
1048723043 8:137348937-137348959 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1049765412 8:144353113-144353135 TGGGGTTTGCTTCAGTCAGCTGG + Intronic
1050181714 9:2930137-2930159 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1050407558 9:5326409-5326431 TGTGGTCTGCCTATGGCAGTGGG - Intergenic
1050498078 9:6265531-6265553 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1052071454 9:24086775-24086797 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1053679706 9:40476832-40476854 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1053929699 9:43105160-43105182 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1054143055 9:61543590-61543612 TGGGGGCTGCCTGGGGCAGGGGG + Intergenic
1054284014 9:63148113-63148135 TAGGGTGTGCTTGAGGGAGGAGG - Intergenic
1054390806 9:64616843-64616865 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1054504916 9:65899466-65899488 TAGGGTGTGCTTGAGGGAGGAGG - Intergenic
1054907225 9:70421592-70421614 TGGGGTGAACTTCAGGCAGGCGG - Intergenic
1055133159 9:72798671-72798693 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1055934471 9:81592008-81592030 CGGAGTCTGCTTAAGGCCAGTGG + Intronic
1056485312 9:87051036-87051058 TGGGGTCTACTTGAGGATGGAGG - Intergenic
1057096218 9:92312486-92312508 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1058199028 9:102015428-102015450 TGGGGTCTACTTGAGGGTGGCGG + Intergenic
1058346157 9:103965543-103965565 TGGGGTCTACTTAAGGGTGGAGG - Intergenic
1058669954 9:107352426-107352448 TGGGGTCTGCTTGAGGGTGGAGG - Intergenic
1059753172 9:117268209-117268231 TGGGGACTGATGAACGCAGGTGG - Intronic
1060502181 9:124167621-124167643 TGCGGTCTACTTAAGGGTGGAGG - Intergenic
1061123532 9:128659123-128659145 AGGGGTGTGCTTGAAGCAGGTGG - Intergenic
1061570312 9:131473988-131474010 TGGGGGCTTCACAAGGCAGGTGG + Intronic
1062031771 9:134365083-134365105 TGGGGTCTGGTGCTGGCAGGAGG + Intronic
1062072956 9:134568229-134568251 TAGGGTCTGCTGAGGGCATGTGG - Intergenic
1062088122 9:134659003-134659025 TGGCCTCTGTGTAAGGCAGGAGG + Intronic
1062299165 9:135854924-135854946 TGGGGTCTCCTTGAGGGTGGAGG - Intronic
1062756982 9:138304471-138304493 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1185714914 X:2333748-2333770 TGGGGTCTGCTTGAGGGTGAAGG - Intronic
1185845567 X:3434548-3434570 TGTGGTCTGTTTAAAGCAGTGGG + Intergenic
1186012485 X:5150509-5150531 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1187597174 X:20785559-20785581 TGGGGCCTACTTAAGGGTGGAGG - Intergenic
1187880169 X:23839374-23839396 GGGAGTCTGCTTGAGGCTGGGGG + Intronic
1188859264 X:35237751-35237773 TGGGGTCTACTTGAGGGAAGAGG + Intergenic
1188879355 X:35472728-35472750 TGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1188982641 X:36740647-36740669 TGGGGTCTACTTCAGGATGGAGG - Intergenic
1189191380 X:39110668-39110690 TGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1189238084 X:39503989-39504011 TCTGGTCTGCTTAGGGCAGCTGG + Intergenic
1189319731 X:40080473-40080495 AGGTGTCTACTTAAGGGAGGTGG - Intronic
1189624725 X:42884264-42884286 TGGGGACTGCTTCAGTCGGGAGG - Intergenic
1189874651 X:45423248-45423270 TGGGGTCTACTAGAGGGAGGAGG + Intergenic
1190085112 X:47388648-47388670 TGGGGTGTGCTCAGAGCAGGGGG + Intronic
1190469268 X:50761193-50761215 TGGGGTCTGCTTGAGGATGGAGG - Intronic
1190597525 X:52063453-52063475 TGGGGTGTGCTCAGAGCAGGGGG - Intronic
1190599191 X:52072000-52072022 TGGGGTCTCCTTAAGGGGGAGGG - Intergenic
1190609633 X:52182073-52182095 TGGGGTCTCCTTAAGGGGGAGGG + Intergenic
1190611299 X:52190620-52190642 TGGGGTGTGCTCAGAGCAGGGGG + Intronic
1190916400 X:54814369-54814391 TGGGGTGTGCTCAGAGCAGGGGG + Intronic
1190929478 X:54935338-54935360 TGGGGTCTGCTGAAGGCCCCAGG - Intronic
1191818752 X:65278804-65278826 TGGGGTCTACTTGAGGGGGGAGG - Intergenic
1192072032 X:67951113-67951135 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1192418188 X:71003486-71003508 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1193825378 X:86219464-86219486 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1194032976 X:88838266-88838288 TGGGGTCAGATTAATGCAGTTGG - Intergenic
1194214745 X:91115973-91115995 TGGGGTCTGCTTAAAGGTGGAGG + Intergenic
1194593455 X:95830021-95830043 TGGGGTCTGCTTGAGGGTGGAGG - Intergenic
1194780858 X:98024040-98024062 TGGGGTCTACTTGAGGGAGGAGG - Intergenic
1195761941 X:108255891-108255913 TGGAGTCATCATAAGGCAGGAGG + Intronic
1195994121 X:110714166-110714188 TGGGGTCTTCTTGAGGATGGAGG - Intronic
1197621326 X:128752976-128752998 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1197926154 X:131648529-131648551 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1198076578 X:133199058-133199080 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1198195313 X:134354792-134354814 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198383842 X:136108917-136108939 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1198511758 X:137359044-137359066 TGAGATCTGGTTAAGGCAAGAGG - Intergenic
1198714825 X:139546079-139546101 TGGAGTCTACTTGAGGGAGGAGG - Intronic
1199306550 X:146273534-146273556 TGGAGTCTACTTGAGGGAGGAGG - Intergenic
1199718019 X:150520388-150520410 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1200035389 X:153324727-153324749 TGGGGTCTACTTGAGGATGGAGG - Intergenic
1200102583 X:153695315-153695337 TGGGGTCTGCCTGGGGGAGGAGG + Exonic
1200703938 Y:6425555-6425577 TGGAGTCTGCTTAAGGAATGTGG - Intergenic
1200749884 Y:6935111-6935133 TGGGAGGTGCTTGAGGCAGGAGG - Intronic
1200982187 Y:9272552-9272574 TGGGGTCTGCTTAAAGGAATGGG - Intergenic
1201030173 Y:9739153-9739175 TGGAGTCTGCTTAAGGAATGTGG + Intergenic
1202096588 Y:21256601-21256623 TGGGGTCTACTTGAGGATGGTGG - Intergenic
1202128224 Y:21587175-21587197 TGGGGTCTGCTTAAAGGAATAGG + Intergenic
1202300718 Y:23410951-23410973 TGGGGTCTACTTCAGGGTGGAGG + Intergenic
1202570093 Y:26259647-26259669 TGGGGTCTACTTCAGGGTGGAGG - Intergenic