ID: 1124156714

View in Genome Browser
Species Human (GRCh38)
Location 15:27232623-27232645
Sequence ATGATTAAAAGCAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 463}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124156714_1124156719 10 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156719 15:27232656-27232678 CTTGGGGATAGGAGACAACAAGG 0: 1
1: 0
2: 0
3: 22
4: 220
1124156714_1124156718 -1 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156718 15:27232645-27232667 TTCAGTCTTGACTTGGGGATAGG 0: 1
1: 0
2: 0
3: 12
4: 149
1124156714_1124156720 15 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156720 15:27232661-27232683 GGATAGGAGACAACAAGGCCTGG 0: 1
1: 0
2: 3
3: 12
4: 198
1124156714_1124156722 30 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156722 15:27232676-27232698 AGGCCTGGCTGAAAAAGGTGAGG 0: 1
1: 0
2: 0
3: 18
4: 236
1124156714_1124156716 -7 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156716 15:27232639-27232661 TAATCATTCAGTCTTGACTTGGG 0: 1
1: 0
2: 1
3: 13
4: 181
1124156714_1124156717 -6 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156717 15:27232640-27232662 AATCATTCAGTCTTGACTTGGGG 0: 1
1: 0
2: 0
3: 13
4: 153
1124156714_1124156715 -8 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156715 15:27232638-27232660 TTAATCATTCAGTCTTGACTTGG 0: 1
1: 0
2: 0
3: 12
4: 189
1124156714_1124156721 25 Left 1124156714 15:27232623-27232645 CCTACAATTCTGCTTTTAATCAT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1124156721 15:27232671-27232693 CAACAAGGCCTGGCTGAAAAAGG 0: 1
1: 0
2: 2
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124156714 Original CRISPR ATGATTAAAAGCAGAATTGT AGG (reversed) Intronic
900006608 1:59554-59576 ATGATCAAAAGAAGCATTGGTGG - Intergenic
902177730 1:14663798-14663820 ATAACTAGAAGCAGAATTGCTGG - Intronic
902475707 1:16685556-16685578 ATGATCAAAATCCAAATTGTAGG + Intergenic
905582844 1:39095251-39095273 ATGATTATAGTCAGAAATGTGGG + Intronic
905617600 1:39412217-39412239 ATGATTAAAAGCAAAACTGAAGG - Exonic
905976979 1:42182972-42182994 ATGATTAAAAACATTATTCTGGG + Intronic
906642814 1:47451588-47451610 TTGATTAAAAGAATAATTCTAGG + Intergenic
906902519 1:49851188-49851210 ATGATTAAAAATATAATTGATGG - Intronic
907543184 1:55235140-55235162 ATTATTAAAAGTTGAATTATAGG + Intergenic
908022656 1:59914590-59914612 ATGTTTACAAGCAGTATTCTTGG + Intronic
908328567 1:63048068-63048090 ATGCTAAAGAGCACAATTGTTGG - Intergenic
908803934 1:67910106-67910128 ATTATTAAATGCCCAATTGTAGG + Intergenic
908809553 1:67965920-67965942 ATGGTTAAAAGCACAGTTGCTGG + Intergenic
909154172 1:72049786-72049808 ATTAATAAAAGCTAAATTGTTGG + Intronic
909843435 1:80359068-80359090 ATGATTAAAAGTAAAATTGCTGG + Intergenic
910326611 1:86015707-86015729 ATGATTAAAATAAAAATTGTAGG + Intronic
911380749 1:97111026-97111048 AGGATGAAAAACAGAATAGTGGG - Intronic
911407020 1:97453685-97453707 ATTCTTAAAGGTAGAATTGTAGG - Intronic
911543971 1:99193472-99193494 GTGATTAAGAGCAGAGATGTTGG - Intergenic
911746729 1:101449086-101449108 ATGAATAAAATGAAAATTGTTGG - Intergenic
913356809 1:117930780-117930802 GTGGTTAAAAGCAGAAATTTTGG + Intronic
915057121 1:153143460-153143482 ATGGTTCAAAGCAGAACTGAAGG - Intergenic
915063570 1:153206549-153206571 AGGATTAAAGGGAGAACTGTAGG + Intergenic
915677486 1:157545252-157545274 AAGTTGAAAAGCAGAAATGTAGG + Intronic
917304308 1:173611164-173611186 ATGATCAAAAGTGGAAATGTGGG - Intronic
918176260 1:182048340-182048362 CTGATCAACAGCACAATTGTTGG + Intergenic
919072337 1:192772182-192772204 ATGATTACTATCAGGATTGTTGG - Intergenic
920984420 1:210872359-210872381 CTGTTTAAAAGCAGAAGTGAAGG - Intronic
921661763 1:217810998-217811020 AAAATTAAAAGAAAAATTGTAGG + Intronic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
921750357 1:218785028-218785050 ATGATTGAAATCAGAAGAGTGGG - Intergenic
921900657 1:220447075-220447097 TTGATTGAAAGCACAATGGTGGG + Intergenic
921972043 1:221160602-221160624 ATGGTTAAAAGCAGAGATGCTGG + Intergenic
922031589 1:221805865-221805887 ATTATTAGAAGTAGAATTGCTGG - Intergenic
922561207 1:226570928-226570950 ATTTTTAAAAGCAAATTTGTAGG + Intronic
922609617 1:226915668-226915690 CTGATGTATAGCAGAATTGTAGG - Intronic
1062845289 10:698642-698664 ATGTTTAAAAACAGCATTTTGGG - Intergenic
1063644852 10:7868946-7868968 ATGATTAAAAGCATAAATTCTGG - Intronic
1064313044 10:14228835-14228857 CTGTTCAAAAGCAGAATTCTAGG + Intronic
1064669345 10:17693827-17693849 GTGACTAAAAGCAATATTGTTGG + Intronic
1065310795 10:24414536-24414558 ATGATCAAAACGACAATTGTTGG - Intronic
1065927471 10:30448165-30448187 ATGATTAAAAGGATAAGTGCTGG + Intronic
1066175303 10:32897281-32897303 ATGCCTAAAAGAAGAATTGCTGG - Intergenic
1067302843 10:45028748-45028770 AAGTTTAAAAGCAAAATTGTGGG - Intergenic
1067413537 10:46085831-46085853 ATACCTAGAAGCAGAATTGTGGG + Intergenic
1068046875 10:51897247-51897269 AAGAATAAAAGCAGAAATCTCGG - Intronic
1068736952 10:60424625-60424647 AGAAATTAAAGCAGAATTGTGGG + Intronic
1069277588 10:66611889-66611911 ATGATTAGAACCATAAATGTGGG - Intronic
1071924438 10:90389622-90389644 ATGATTCACAACAGAATTATGGG + Intergenic
1072254539 10:93608850-93608872 ATTCATAAAAGCAGAATTGTGGG + Intergenic
1072785791 10:98280905-98280927 ATAATAAAAAGAAGAAATGTTGG - Intergenic
1073853387 10:107647066-107647088 AGGATTGCAAGCAGAATTGTGGG + Intergenic
1073864736 10:107788631-107788653 ATTATTACATGCAGAATTTTTGG - Intergenic
1073940178 10:108688848-108688870 GTAATTAAAAGCAGAATTTAAGG + Intergenic
1073940325 10:108690625-108690647 TTTTTTAAATGCAGAATTGTGGG + Intergenic
1074336654 10:112583129-112583151 ATGATCAAGAGCAGAGTTCTTGG + Intronic
1074604587 10:114948629-114948651 ATTAGTGAAAGCAGAATTTTAGG - Intronic
1074921221 10:118015596-118015618 AAGAATAAATTCAGAATTGTGGG + Intronic
1075390657 10:122088756-122088778 ATGACTAAAAGCTCCATTGTTGG + Intronic
1076593721 10:131610491-131610513 ATGATAAAAAGTAAAATTCTGGG - Intergenic
1076644404 10:131942564-131942586 ATAATTAAAAGAAGAAATCTTGG + Intronic
1077781888 11:5339261-5339283 ATGATGAAAAGCTGAATTACAGG + Intronic
1077940566 11:6836935-6836957 ATTTCTAAAAGCAGGATTGTTGG + Intergenic
1079736479 11:24003123-24003145 ATAATTAGAAGTGGAATTGTTGG - Intergenic
1081064661 11:38525576-38525598 ATGACTAAAAGTAGATTTCTCGG + Intergenic
1081473165 11:43395923-43395945 ATTTTTAATAGTAGAATTGTGGG + Intronic
1082228192 11:49732939-49732961 GTGATTAGATGCAGAAGTGTTGG + Intergenic
1084726404 11:70945297-70945319 TTGATTAAAAGCAAAAGTGGAGG + Intronic
1086088063 11:82976546-82976568 TTGATTTAAAGCAGAATTTTTGG - Exonic
1086532549 11:87802837-87802859 ATGACTAAAATAAGAAGTGTTGG + Intergenic
1087164874 11:94992062-94992084 ATAATTAAAATCAGAATTAAAGG + Intronic
1087506237 11:99026049-99026071 ATGATTAAAAGTAATATTATTGG + Intronic
1087620537 11:100536356-100536378 ATGATAAAACTCAGAATTGCAGG + Intergenic
1087716156 11:101611418-101611440 GTATTTAAAAGCAGAAATGTTGG + Intronic
1088749219 11:112829830-112829852 ATGATCATAACCAGAATTTTAGG - Intergenic
1091137780 11:133207622-133207644 ATGATTAGAATCAGAATTTGAGG - Intronic
1092250235 12:6891047-6891069 ATGTTTAAAACCAGGATTCTCGG + Intronic
1092436656 12:8452724-8452746 CAGAGCAAAAGCAGAATTGTGGG - Intergenic
1093214176 12:16343835-16343857 GTATTTAGAAGCAGAATTGTTGG + Intergenic
1093621823 12:21300633-21300655 ATTATTAAAATTAGAATTATCGG + Intronic
1094003812 12:25725843-25725865 ATGATTAAGAGCACAAGTCTAGG - Intergenic
1094350845 12:29523040-29523062 CTGAATAAAAGCAGTATTTTTGG + Intronic
1094824004 12:34253075-34253097 ATTATTCAAATCAGAATTTTGGG + Intergenic
1096321249 12:50615120-50615142 AAGAATAAAAGCAGAATAGTTGG + Intronic
1097547744 12:61025268-61025290 TAGATTAACAGCAGAATTCTTGG - Intergenic
1098239935 12:68456660-68456682 ATGAGTAAAAGAATAACTGTAGG - Intergenic
1098424725 12:70349055-70349077 ATGAAAACAGGCAGAATTGTTGG + Intronic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1099045647 12:77714644-77714666 TTGATTATAAGCAAAACTGTAGG - Intergenic
1099269591 12:80490849-80490871 AATATTAAAAGCAAAAATGTTGG - Intronic
1099693340 12:85989953-85989975 ATGAGAAAAAGCAGAATTATGGG + Intronic
1101653979 12:106703763-106703785 AAGATTAAAAGCTGAAATGAGGG + Intronic
1102249828 12:111379097-111379119 ATGGTTAAAATCAGAGGTGTGGG + Intergenic
1103040187 12:117688465-117688487 ATGATAAAATGCAGATTTGTGGG - Intronic
1105333884 13:19445638-19445660 ATTTTTAAAAGCAGTATTATTGG + Intronic
1105462014 13:20600742-20600764 ATACCTAAAAGCAGAATTGCTGG - Intronic
1105721760 13:23123666-23123688 AAGATTAGAAACAGAAGTGTAGG - Intergenic
1105861048 13:24413729-24413751 ATTTTTAAAAGCAGTATTATTGG - Intergenic
1105922535 13:24978168-24978190 ATTTTTAAAAGCAGTATTATTGG + Intergenic
1106543210 13:30708574-30708596 ATAACTACAAGTAGAATTGTTGG + Intergenic
1106678678 13:31987733-31987755 GTGATTAACAGCAGCAATGTGGG + Intergenic
1107089262 13:36459084-36459106 ATTATTAAAAATAAAATTGTAGG - Intergenic
1107112349 13:36711671-36711693 ACATTTAAAAGAAGAATTGTAGG - Intergenic
1107364843 13:39659132-39659154 ATTATTCACTGCAGAATTGTTGG - Intronic
1107398314 13:40041727-40041749 AAGGTTACAAACAGAATTGTAGG - Intergenic
1107488033 13:40850161-40850183 ATTTTTAAAAGCAGCATTATTGG + Intergenic
1107825021 13:44321015-44321037 CTAATTAAGAGCAGAACTGTAGG - Intergenic
1108060494 13:46528474-46528496 GTGATTAAAATCATAATTTTAGG + Intergenic
1108488636 13:50955551-50955573 AATGTGAAAAGCAGAATTGTGGG + Intronic
1108627886 13:52249626-52249648 ATTTTTAAAAGCAGCATTATTGG + Intergenic
1108658172 13:52556825-52556847 ATTTTTAAAAGCAGCATTATTGG - Intergenic
1108936399 13:55886542-55886564 ATTACTAAAAGTAGAAATGTTGG - Intergenic
1108950781 13:56089108-56089130 ATGATTAAAAAAAAAAATGTGGG + Intergenic
1109083279 13:57935363-57935385 ATGCTTAAGAGTAGAATTATAGG + Intergenic
1109863399 13:68229234-68229256 ATGAGAAAAAGCAAAATTTTGGG + Intergenic
1110382927 13:74875222-74875244 ATAATTAAAAAAAGAAATGTGGG + Intergenic
1110610069 13:77477779-77477801 ATGGCTAAAAGCAAAATTATAGG + Intergenic
1110678506 13:78279352-78279374 ATGAAAAAAAGCAGTATGGTGGG + Intergenic
1111807899 13:93060657-93060679 AAGATGAAAAGCTAAATTGTTGG - Intergenic
1112268283 13:97946029-97946051 ATGCTAAAGAGCAGAATTGCTGG + Intergenic
1112496883 13:99912291-99912313 CTGATTAAAATCTGCATTGTCGG + Intergenic
1113035894 13:106048316-106048338 ATGAATAAATGCACACTTGTGGG + Intergenic
1113155671 13:107318682-107318704 ATTAGTAAAAGTAGAATCGTTGG - Intronic
1113344025 13:109456111-109456133 ATGATTAGAAGGAGAATGGAGGG + Intergenic
1113454897 13:110441368-110441390 ATGGTCAAAAGCAGAATGCTGGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114817305 14:25975617-25975639 ATGAATAAAACCAGACTTCTAGG + Intergenic
1115370660 14:32610404-32610426 ATGAATAAAAGCAGTATAGATGG - Intronic
1115433976 14:33352613-33352635 AGTATGAAAAGCACAATTGTTGG - Intronic
1115568056 14:34641875-34641897 ATGACTAAAAATAGAATTTTGGG - Intergenic
1115923499 14:38405164-38405186 ATGATTATAATCATAATTTTTGG + Intergenic
1116093716 14:40340631-40340653 ATGACAAATAGCAGAATTGAAGG + Intergenic
1116207834 14:41890859-41890881 ATGACTAAAAGCAAATTTGAAGG - Intronic
1116342106 14:43736994-43737016 ATGATATAAAGCAGTATTATGGG - Intergenic
1117421742 14:55553414-55553436 ATTATTAGAAGTTGAATTGTTGG - Intergenic
1118537259 14:66781516-66781538 ATGATAAAAATCATAATAGTAGG - Intronic
1118863739 14:69685784-69685806 ATGTTTAAAAGCAGACTGCTTGG - Intronic
1120409767 14:84139262-84139284 ATTTTTAAAAGCAGATTTTTAGG + Intergenic
1120885293 14:89447221-89447243 ATTCCTAAAAGCAGAATTGCTGG + Intronic
1121030106 14:90651048-90651070 ATTAGTATAAACAGAATTGTGGG + Intronic
1121854001 14:97249634-97249656 ATGTTTATAAGCAGAGTTTTTGG + Intergenic
1122050923 14:99059204-99059226 ATCAATAAAAGTAGACTTGTGGG + Intergenic
1123146590 14:106137241-106137263 ATGGTTAAAGACAGAATTGAGGG + Intergenic
1124156714 15:27232623-27232645 ATGATTAAAAGCAGAATTGTAGG - Intronic
1125172258 15:36778948-36778970 ATAATTGAAAACAGGATTGTAGG + Intronic
1126601125 15:50428415-50428437 ATTATTAAAAACTAAATTGTAGG - Intronic
1128195328 15:65748687-65748709 GTGATTAAAAACCCAATTGTTGG + Intronic
1128899309 15:71405315-71405337 AAACCTAAAAGCAGAATTGTTGG + Intronic
1129135499 15:73546352-73546374 ATGCCTAAAAGCAGATTTGCTGG - Intronic
1129519748 15:76178165-76178187 AGGATTAAAAGCAGGACTGGGGG + Intronic
1130904505 15:88230557-88230579 ATGATTAAAATTAAAATTGATGG - Intronic
1131561400 15:93445702-93445724 ATGATTAAAGTAAGAGTTGTTGG - Intergenic
1131808532 15:96148162-96148184 AGAATTAAACGCAGAAATGTAGG - Intergenic
1131875691 15:96803829-96803851 ATAATGTAAAGCAGGATTGTAGG + Intergenic
1132446913 15:101931403-101931425 ATGATCAAAAGAAGCATTGGTGG + Intergenic
1133488618 16:6245221-6245243 ATGAATATAAGCAGAAATGATGG + Intronic
1133614770 16:7465711-7465733 CTCATTAAATGCAGATTTGTGGG + Intronic
1134878394 16:17722768-17722790 AGTATTAAAACCAGACTTGTTGG + Intergenic
1136692478 16:32044262-32044284 ATGGTTAAAGGCAGAATTGAGGG - Intergenic
1136792974 16:32987487-32987509 ATGGTTAAAGGCAGAATTGAGGG - Intergenic
1136876881 16:33866568-33866590 ATGGTTAAAGGCAGAATTGAGGG + Intergenic
1137230025 16:46556013-46556035 ATGAGTCAAAGCAAAATGGTTGG - Intergenic
1137513434 16:49121264-49121286 CTGATTAAAAACAAAGTTGTTGG - Intergenic
1138127464 16:54450769-54450791 ATTCTTAGAAGCAGAATTGCTGG + Intergenic
1138428682 16:56953494-56953516 ATTATTAAAAACAAAATTATAGG + Intergenic
1141003109 16:80326538-80326560 AGGATTAAAACTAGAATTTTGGG + Intergenic
1141363191 16:83416729-83416751 ATGAATAAAAGCACAAATGCTGG + Intronic
1141801410 16:86311824-86311846 ATCATTTAAAACAGAATTGTAGG - Intergenic
1203095231 16_KI270728v1_random:1249179-1249201 ATGGTTAAAGGCAGAATTGAGGG - Intergenic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1144172874 17:12676735-12676757 AAAATTAATAGCAGAGTTGTGGG - Intronic
1144286669 17:13782126-13782148 ATGATTAGAAGCAGAATTTTTGG - Intergenic
1144567384 17:16371146-16371168 GTGATTAAAAAATGAATTGTAGG - Intergenic
1144945643 17:18968258-18968280 CTGAGTCAAAGCAGAATGGTAGG + Intronic
1145065902 17:19761151-19761173 ATAATCAGAAGCAGAATTGCTGG + Intergenic
1146424611 17:32724762-32724784 GTGATTCAAAGCTGAATTATGGG - Intronic
1146617004 17:34364562-34364584 ATCAGGAAAAGCAGAAGTGTAGG + Intergenic
1149690049 17:58567975-58567997 ATGATTTAAGGCAGTATTGTAGG - Intronic
1150199225 17:63336056-63336078 AGGATTAGAATCAGAATTGAGGG + Intronic
1150606856 17:66699319-66699341 ATGAATAAAATCAGAAATGAAGG + Intronic
1150863547 17:68825700-68825722 ATGACTAAATGCAAAATTGTAGG - Intergenic
1154292679 18:13123780-13123802 ATGGTTAAAAACAGTATTCTAGG - Intronic
1154363593 18:13686482-13686504 ATTTTTAAAGGCAAAATTGTGGG - Intronic
1155013779 18:21811348-21811370 ATATTCAAAAGCAGAACTGTTGG - Intronic
1155070311 18:22309309-22309331 ATCATTAGAAACAGATTTGTAGG + Intergenic
1155073664 18:22337318-22337340 ATGATTAAATGCCCAATGGTTGG + Intergenic
1155192623 18:23444068-23444090 ATTATTAAAAAAAGATTTGTGGG - Intergenic
1155447813 18:25930218-25930240 TTTCTTAAAAGCAGAATTGTGGG - Intergenic
1155672988 18:28394949-28394971 ATCAATAAAAGAATAATTGTGGG + Intergenic
1155741961 18:29299440-29299462 AAGATTAACAGTATAATTGTGGG + Intergenic
1156525576 18:37764705-37764727 ATAATTAAAACCAGATTTGTAGG + Intergenic
1156618764 18:38822654-38822676 ATAATTAAGAGCACAATTGCTGG - Intergenic
1157265806 18:46220542-46220564 GTTAACAAAAGCAGAATTGTGGG - Intronic
1157414873 18:47493866-47493888 ATGATTCTCAGCAGACTTGTGGG + Intergenic
1157794645 18:50562093-50562115 CTGCTCAAAAGCAGAATTCTAGG - Intronic
1159197789 18:65141027-65141049 TTGAGTAAAAGCAGAATTGCAGG + Intergenic
1159281392 18:66290704-66290726 ATGGTTAAAATCAGAAAGGTTGG - Intergenic
1159835865 18:73334605-73334627 TTGATGCAAAGCAGAATTCTTGG - Intergenic
1160311722 18:77798413-77798435 ATGAATCAAAACAGAATTCTAGG - Intergenic
1160638362 19:101130-101152 ATGATCAAAAGAAGCATTGGTGG - Intergenic
1161258820 19:3324323-3324345 AGGATTAAATGAACAATTGTGGG + Intergenic
1162865668 19:13544788-13544810 AGGTTTAGAAGCAGAATTGGAGG - Intronic
1163335368 19:16667906-16667928 TTCATTTAAATCAGAATTGTGGG + Intronic
1163930285 19:20383662-20383684 ATAATTAAAAGAAAAATTTTTGG - Intergenic
1164061242 19:21676676-21676698 ATGATTAAAACAAGACTTCTGGG + Intergenic
1164065424 19:21711034-21711056 ATGATTAAAACAAGACTTCTGGG - Intergenic
1164088403 19:21925488-21925510 ATTATTAAAACCACAATTGACGG + Intergenic
1166378309 19:42341129-42341151 CTAATTAAAAACAGAATTTTTGG + Intronic
1168143724 19:54407174-54407196 TTGGGTAAAAGTAGAATTGTTGG + Intergenic
1202631144 1_KI270706v1_random:783-805 ATTTTTAAAAACATAATTGTAGG + Intergenic
926185657 2:10688850-10688872 ATTATTCAAACCAGAATTTTAGG + Intronic
926224744 2:10959543-10959565 ATGATTAAAAAGACAATAGTTGG + Intergenic
927746630 2:25628034-25628056 ATGATTAAAAGGGAAATTATTGG - Intronic
927766615 2:25815361-25815383 ATCATTGCAAGCAGAAGTGTTGG - Intronic
928156825 2:28884394-28884416 ATACTTAGAAGCAGAATTGCTGG + Intergenic
928381561 2:30822690-30822712 AGGAATAAAAGCAGCAATGTGGG + Intergenic
928952649 2:36826870-36826892 ATAATTAATAGCAGAATTCCAGG + Intergenic
929630197 2:43452135-43452157 ATGAATGAAAGAGGAATTGTTGG - Intronic
929700672 2:44160195-44160217 AAGATTAAAAGAATAATTCTTGG - Intergenic
931947712 2:67329540-67329562 AGGATTAAAGGCAGGATTATTGG + Intergenic
932040211 2:68291527-68291549 ATGAGTCAAAGCAGACTTGGAGG - Intronic
932118840 2:69079314-69079336 ATGATTAATAGCAGGACTGGGGG + Intronic
933084054 2:78032426-78032448 ATGCCAAAAAGCACAATTGTTGG - Intergenic
933454633 2:82505123-82505145 AAGATTAAAAGCAGTGTTTTTGG - Intergenic
935460566 2:103328196-103328218 ATGATTCAAAGCATATTTGTTGG - Intergenic
936451583 2:112637644-112637666 ATGATTAAAAGTAGTTATGTCGG + Intergenic
936688915 2:114862704-114862726 AGGAGTAAAAGGAGAAATGTAGG + Intronic
937034264 2:118767854-118767876 AGGATGAAAACCAGAATTGGAGG + Intergenic
937627816 2:124063404-124063426 ATCATTTAAATCAGAGTTGTAGG - Intronic
937810022 2:126188782-126188804 ATGCTTGAAAGCAGAAGTGAAGG + Intergenic
938142876 2:128811228-128811250 TTGATTTCAAGCAAAATTGTAGG - Intergenic
938911784 2:135892227-135892249 ATGTTAAAAAGTAGAATAGTTGG + Intergenic
940755209 2:157674137-157674159 AAGGTTAAAATCAGAATGGTTGG + Intergenic
941152262 2:161929363-161929385 ATGTTTTAAATCAGAATTATAGG + Intronic
941429780 2:165399905-165399927 ATGATTAAAACTAGAACTGGGGG - Intergenic
942135127 2:172917714-172917736 ATGTTAAAAAGCAGAAATGCTGG - Intronic
942258412 2:174130682-174130704 TTTATTAAAATCAGATTTGTTGG - Intronic
942413799 2:175737526-175737548 AGGATTACAAGTAGAAATGTTGG - Intergenic
942993726 2:182235440-182235462 ATTATTAAAAACAGTTTTGTTGG - Intronic
943784647 2:191863769-191863791 ATGTTTCTAAGCAGAATAGTGGG + Intergenic
943841321 2:192585433-192585455 AAGATTAAAAGCACAATTGCAGG - Intergenic
944106142 2:196081783-196081805 ATGATTAAAAGCAGAAGGGAAGG - Intergenic
945119286 2:206442368-206442390 ATGATTAAAAGAAAGAATGTGGG - Intergenic
945284269 2:208066390-208066412 ATGATCTAAAGAAAAATTGTGGG + Intergenic
945781812 2:214184214-214184236 ATGATAAAATGCATAATTCTTGG + Intronic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
946100579 2:217317098-217317120 ATACTTAAAAGTAGAATTATTGG - Intronic
949061444 2:241960632-241960654 AGGAATTAAAGCATAATTGTAGG + Intergenic
1168777307 20:458612-458634 AGGATTAAAAGTAGAATTGGAGG - Intronic
1169580494 20:7017810-7017832 ATGTTTAAAACAAGAGTTGTGGG - Intergenic
1169662903 20:8000089-8000111 GTGACTAAAAGCAGAGTTCTTGG + Intronic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1170180849 20:13528356-13528378 ATGATTAAAAGCAATATTTGTGG - Intronic
1171126772 20:22609303-22609325 AGAACTAGAAGCAGAATTGTGGG - Intergenic
1172560989 20:35888291-35888313 ATTATTAAAAGCAAAATTTGTGG + Intronic
1173040914 20:39461379-39461401 ATGGTTAAAACAAGAATTGCTGG - Intergenic
1174770103 20:53291490-53291512 AAGATCAAGAGCAAAATTGTGGG + Intronic
1176739169 21:10583032-10583054 ATTTTTAAAAGCAGTATTATTGG - Intronic
1177490972 21:21825556-21825578 ATAATTAAAAGGAAAATTATAGG - Intergenic
1177556003 21:22689461-22689483 ATGAAAAAAAACAGAATTGAGGG - Intergenic
1177938395 21:27378731-27378753 GTGAATAAAAACAAAATTGTGGG - Intergenic
1178039733 21:28626867-28626889 ATACTTAGGAGCAGAATTGTTGG - Intergenic
1179346167 21:40559493-40559515 ATGATTTTAAGCAGAATAGGAGG + Intronic
1182692259 22:32172246-32172268 AAGATTAAAAGCCAAACTGTAGG + Intergenic
1182919668 22:34067655-34067677 ATGATTAAGAGCCAGATTGTAGG - Intergenic
1183159652 22:36103750-36103772 ATGATGAAAAGAAAAAGTGTGGG - Intergenic
1183163025 22:36127499-36127521 AAGATTAAAAGCCAAACTGTAGG - Intergenic
1183497064 22:38152909-38152931 ATGATTAAAAGCAGCAGTGATGG + Intronic
1183854565 22:40622178-40622200 ATGATTAAATTAAGAATTTTGGG + Intronic
1183982859 22:41552482-41552504 ATGAATAAGAGCAGGTTTGTTGG - Intergenic
949193695 3:1280800-1280822 ATGATTCCAAGCATATTTGTCGG + Intronic
949305212 3:2632342-2632364 ATGAAGAAAATCAGAAGTGTTGG - Intronic
949558836 3:5184329-5184351 ATGAGAAACAGCAGAATAGTGGG - Intergenic
949872517 3:8601488-8601510 ATGAATGAAAGCAGAAGTGAAGG + Intergenic
951155408 3:19346984-19347006 CTGATTAAATGCAGAATAGCTGG - Intronic
951410294 3:22355788-22355810 ATAATTAAAAACAGATTTTTGGG + Intronic
951499970 3:23374276-23374298 ATGATTAAAAACAGAGATATTGG + Intronic
951670044 3:25170992-25171014 AAGATTAAAATAATAATTGTCGG - Intergenic
951720886 3:25696737-25696759 AGAATTAACAGCAGAAATGTAGG - Intergenic
951813042 3:26722429-26722451 ATAATGAATAGCAGAAGTGTAGG - Intergenic
952470366 3:33643134-33643156 ATGATTAATATCAGAATGATAGG + Intronic
953479523 3:43238413-43238435 TTCACTAAAAGCAGAAATGTTGG + Intergenic
953941099 3:47098211-47098233 ATTAGTAATAGCAGACTTGTTGG - Intronic
954998879 3:54908068-54908090 ATACCTAAAAGTAGAATTGTTGG + Intronic
955281427 3:57597892-57597914 GTGGTTAAAAGCTGACTTGTGGG + Intronic
955556680 3:60145491-60145513 ATGACTAAAAACAGACCTGTGGG + Intronic
956679887 3:71768723-71768745 AAGATTAAAAGCAAAAAAGTAGG - Intergenic
956721547 3:72122331-72122353 ATGATTAAAAGCACAGATATTGG + Intergenic
956987053 3:74712848-74712870 ATACTTAAAAACAGAATTGCTGG + Intergenic
957403965 3:79753241-79753263 ATCATTTAAATCAGAATTGCTGG - Intronic
958146953 3:89637680-89637702 ATGCCTAAAAGCGGAATTGCTGG + Intergenic
958414071 3:93853317-93853339 AAAATTAAAAGGGGAATTGTGGG + Intergenic
958932052 3:100217655-100217677 AGGATTAAATGCAGTAATGTGGG - Intergenic
959065765 3:101655425-101655447 ATGTTTTAAAGCAAAAATGTGGG - Intronic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
960484989 3:118240675-118240697 GTGATCAAAGGCAGAATTATAGG - Intergenic
961042428 3:123686919-123686941 ATGATTTAAAGAATAAATGTGGG + Intronic
963388138 3:144622838-144622860 AAGATTAAAGGAAGAATTGAAGG + Intergenic
963616468 3:147544760-147544782 CTGATTTAAAACAGAGTTGTAGG + Intergenic
964429238 3:156587358-156587380 ATGAAAATAAGCAGAAGTGTGGG - Intergenic
965934576 3:174091589-174091611 ATGTTTAAAAACAGTATTTTTGG - Intronic
966580210 3:181552924-181552946 ACTTTTAGAAGCAGAATTGTTGG - Intergenic
968788005 4:2638349-2638371 ATTATTACAAGCACATTTGTGGG + Intronic
968792270 4:2674444-2674466 ATAATCAACAGCAGGATTGTTGG + Intronic
969371859 4:6736605-6736627 AAGATAAAAAGTAGAATGGTGGG - Intergenic
970266005 4:14287061-14287083 ATGATGAAAAGGAGCACTGTTGG + Intergenic
971084594 4:23257633-23257655 ATGATTAGGTGCAGAATTTTTGG - Intergenic
971262150 4:25066898-25066920 AAGTTTACAACCAGAATTGTGGG - Intergenic
971868946 4:32210618-32210640 TTAATGAAAAGCAGAATTATTGG + Intergenic
972932294 4:44087524-44087546 AAGATTATAAACAGTATTGTTGG + Intergenic
973560976 4:52134890-52134912 CTGATGAAATGCAAAATTGTAGG + Intergenic
974676626 4:65098633-65098655 ATGCCTAAAAGCAGAATGGGTGG + Intergenic
975585325 4:75942552-75942574 ATGAATAGAATCAGAATTGCTGG + Intronic
975875487 4:78831065-78831087 TTGATTAAAACGATAATTGTGGG + Intronic
976333525 4:83859377-83859399 ATTATTAAAAGTAAAATTGCTGG - Intergenic
976702001 4:87979999-87980021 ATTATTAAAAAAAGAAATGTAGG - Intronic
977269110 4:94893049-94893071 ATGATTATAAGAACAATTTTAGG + Intronic
977372630 4:96158994-96159016 TTTATTAAAAATAGAATTGTAGG - Intergenic
977548170 4:98410491-98410513 ATTTCTAAGAGCAGAATTGTTGG - Intronic
978206459 4:106086086-106086108 ATAACTAAAAGAAGAATTGAAGG + Intronic
978745549 4:112190065-112190087 ATGATTAAATAGAGATTTGTTGG - Exonic
978816652 4:112914153-112914175 ATGATTAAAAGCATGAGTTTTGG - Intronic
979014184 4:115411868-115411890 ATGATTAAAAGGAGAAAAGAGGG + Intergenic
979342819 4:119547803-119547825 TTTCTGAAAAGCAGAATTGTTGG - Intronic
979448019 4:120838212-120838234 AAGATTACTAGCAGAGTTGTAGG - Intronic
979996742 4:127440229-127440251 ATGTTTACAAGCAGTATAGTTGG - Intergenic
980181938 4:129412043-129412065 CTGATTAAAGTGAGAATTGTAGG + Intergenic
980534631 4:134101412-134101434 ATGTTGGAAAGCAGAATTTTGGG - Intergenic
980708910 4:136538684-136538706 ATAGTAAAAAGCAGAATTCTAGG + Intergenic
980716556 4:136636901-136636923 GTGAGTGAATGCAGAATTGTTGG + Intergenic
980949948 4:139365336-139365358 ATGATTAAAAAGACAAATGTAGG - Intronic
981179747 4:141726576-141726598 ATGTCTAAGAGCACAATTGTTGG - Intronic
981402909 4:144335211-144335233 GTGAATAATATCAGAATTGTAGG + Intergenic
981450381 4:144890238-144890260 ATGATAAATAAAAGAATTGTGGG + Intergenic
981470233 4:145125762-145125784 ATGATTAAAAGGTGTATTTTAGG + Intronic
982729861 4:158944465-158944487 AGGAATAAGGGCAGAATTGTAGG - Intronic
983798126 4:171892224-171892246 ATGCTTAAAACCAGAAGGGTTGG - Intronic
984161828 4:176261823-176261845 ATGAGTAAAAGCAGAAGGCTTGG - Intronic
985357227 4:189134433-189134455 ATGATTAGCAGCAAAATTTTCGG - Intergenic
986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG + Intergenic
987931778 5:24409889-24409911 TTCTTTAAAAGCATAATTGTTGG - Intergenic
988032402 5:25780322-25780344 ATGAGTAAAAGAAGAATGGATGG + Intergenic
989131225 5:38108668-38108690 ATGATTAGAAGTAGAATTGCTGG + Intergenic
989736971 5:44719222-44719244 ATGTTTAAAAGCAGAACTAGAGG - Intergenic
990053257 5:51534867-51534889 ATCAATAAAAGGAGAAATGTTGG - Intergenic
990967544 5:61465224-61465246 GTGATTAAAAGAAAAATTGGTGG - Intronic
991025966 5:62030063-62030085 ATGAATAATGGCAGAATTTTAGG - Intergenic
991366585 5:65874677-65874699 ATTCTTAAAAGTAGAATTGCTGG - Intergenic
992384438 5:76270206-76270228 ATGCTTTAAAGCTGTATTGTAGG + Intronic
992543794 5:77790137-77790159 ATGATTAAAAGCAGGTATTTGGG + Intronic
992628913 5:78661881-78661903 ATGCCTATAAGTAGAATTGTTGG - Intronic
992851190 5:80810441-80810463 ATGCTTAAAAGAGGAATTGCTGG + Intronic
995345689 5:111114236-111114258 ATGAAGAAAGGAAGAATTGTGGG + Intronic
995521186 5:113007207-113007229 ATAATTTAAAGCAGATTTCTAGG + Intronic
996322643 5:122236254-122236276 GTGTTTAAAAGGAGAATTTTGGG - Intergenic
996623989 5:125547287-125547309 ATTTATAAAAGCAGAAATGTGGG - Intergenic
997160546 5:131604756-131604778 TTGCTTAAAATCAGAATTGTGGG - Intronic
998614703 5:143727207-143727229 ATTTTTAAAAGTAAAATTGTGGG - Intergenic
998755335 5:145371949-145371971 ATAACTAAGAGCAGAATTGAAGG - Intergenic
998947034 5:147350898-147350920 ATCATGAAATGGAGAATTGTTGG + Intronic
999894226 5:156011736-156011758 ATGTTTAAAAATAGAATTCTGGG - Intronic
1000955574 5:167538931-167538953 ATGATTAAAACCATAATGATGGG - Intronic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1004370204 6:15045720-15045742 ATGACTAGAAGTAGAATTGCTGG - Intergenic
1004652824 6:17628124-17628146 AAGGTTAAAAGCATGATTGTTGG - Intronic
1004819396 6:19350627-19350649 GTGATTAAAAGCAGAAAAGAAGG + Intergenic
1004853362 6:19724125-19724147 GTGACAAAAAGCAGAATTATAGG - Intergenic
1006192210 6:32216549-32216571 ATGATCAACAGGAGACTTGTTGG + Intronic
1006565964 6:34957597-34957619 ATGATTTAATGAAGAATTGTTGG + Intronic
1006681149 6:35797601-35797623 AAGATGAAAGGCAGAATAGTTGG - Intergenic
1007484056 6:42168427-42168449 ATGATTAAAGAAAGAATTCTTGG - Intronic
1008578428 6:52883483-52883505 ATGTTTACAAGCAGTATAGTTGG + Intronic
1008585891 6:52948456-52948478 ATGTTTACAAGCAGTATAGTTGG - Intergenic
1008601207 6:53097159-53097181 ATGATCAACAGCATAATTATAGG - Intronic
1008652989 6:53582547-53582569 ATGATTTATAGCAGAATTAGAGG - Intronic
1009196287 6:60689816-60689838 ATACTCAAAAGCAGAATTGCTGG + Intergenic
1009273182 6:61641517-61641539 ATGATGAAATGAAGAATTGGAGG - Intergenic
1009911439 6:69934358-69934380 ATAATTAAAAACAAAATTTTGGG - Intronic
1010039638 6:71366422-71366444 ATGTTTAAATTTAGAATTGTGGG - Intergenic
1010470730 6:76225084-76225106 ATGATTAATAGCAGAACTTCTGG + Intergenic
1010689524 6:78892384-78892406 ATGACTATAAGCTGAATTGAGGG - Intronic
1010764956 6:79768587-79768609 ATACTTAAAAGTGGAATTGTTGG - Intergenic
1010955200 6:82082672-82082694 ATTGTTAAATGCAGAATTATTGG + Intergenic
1011305423 6:85920667-85920689 ATGGTTAAAAGAAGTATGGTTGG + Intergenic
1011515925 6:88153011-88153033 ATTTTTTAAAGCAGAATTCTAGG - Intronic
1012025422 6:93984296-93984318 TTGTTTAACAACAGAATTGTGGG - Intergenic
1012516350 6:100065120-100065142 AACATTAATAGAAGAATTGTTGG - Intergenic
1012523878 6:100153978-100154000 ATGATGAGCAGCAGAATTTTTGG + Intergenic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1013136965 6:107291664-107291686 ATTTTTAAAAACAGAATTCTAGG - Intronic
1014507036 6:122272419-122272441 ATTATTCAAAGCAGCCTTGTAGG + Intergenic
1014808982 6:125864075-125864097 ATTTCTAAAAACAGAATTGTTGG - Intronic
1015116796 6:129658845-129658867 ATCTTAAAAAGCACAATTGTGGG + Intronic
1015180115 6:130352468-130352490 ATCATAAACAGGAGAATTGTTGG - Intronic
1016871885 6:148825903-148825925 ATTATGAGAAGCAGAGTTGTAGG + Intronic
1016890487 6:149001695-149001717 ATTATTAAAAGATGAATTATGGG + Intronic
1017046405 6:150350821-150350843 AGGATTAAAAGCAAACTTCTTGG - Intergenic
1017803156 6:157917218-157917240 ATGATCAAAATCAGAAATGAAGG - Intronic
1017998505 6:159556721-159556743 ATCCTTAAAAGTAGAATGGTTGG + Intergenic
1018550933 6:164997986-164998008 ATGGTTAAAAAGAGAAGTGTTGG + Intergenic
1018755433 6:166844554-166844576 AAGATTAACAGCAGATTTCTCGG + Intronic
1019796437 7:3053011-3053033 ATGATTAACAGCAGAAATAAGGG - Intergenic
1019917850 7:4144878-4144900 CTGATTAAAACCAGAAATGACGG - Intronic
1020476854 7:8606087-8606109 ATGTTTAATAGCATCATTGTAGG - Intronic
1020730652 7:11874885-11874907 ATGATGAAAAGCTAAATGGTTGG - Intergenic
1021034443 7:15780187-15780209 ATGTTTAAAAGTAAAATTATTGG - Intergenic
1021362819 7:19737444-19737466 ATACCTAAAAGCACAATTGTTGG - Intronic
1021473552 7:21034430-21034452 GTGATTAAAAGCACAAATTTGGG + Intergenic
1022604899 7:31803058-31803080 AAGAATAAAAACAGAATTGTAGG - Intronic
1023819719 7:43973840-43973862 ATGTCTAGAAGCAGAATTGCTGG + Intergenic
1024001453 7:45192120-45192142 AGGATTCAGAGCAGGATTGTTGG + Intergenic
1024230263 7:47358435-47358457 GTGATTAAAAGAGGAAATGTTGG - Intronic
1024631300 7:51249677-51249699 CTGATCAACAGAAGAATTGTAGG - Intronic
1026002711 7:66574387-66574409 ATGATGAAATCCAGAATAGTGGG - Intergenic
1026029146 7:66774412-66774434 ATGATGAAATCCAGAATAGTGGG + Intronic
1027452351 7:78346779-78346801 ACCACTAAAAGCAGATTTGTTGG - Intronic
1027606425 7:80305296-80305318 ATAATTAAAAGTAGACTTGCTGG - Intergenic
1028124669 7:87098596-87098618 ATTATTAGAAGTGGAATTGTTGG - Intergenic
1028552869 7:92090801-92090823 ATGACTAAGAGCAGAATTGCTGG + Intronic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1029014927 7:97306008-97306030 GTGATTAAAAGCAGAGTCTTGGG + Intergenic
1029747992 7:102527293-102527315 ATGTCTAGAAGCAGAATTGCTGG + Intergenic
1029765941 7:102626388-102626410 ATGTCTAGAAGCAGAATTGCTGG + Intronic
1030528213 7:110678971-110678993 ATGATTAAAGTTAAAATTGTTGG - Intronic
1030748842 7:113204268-113204290 ATGTTAAAAAGGAGAATAGTAGG + Intergenic
1031241978 7:119257515-119257537 ATGATTAAAAGTGAAGTTGTTGG + Intergenic
1031249791 7:119365116-119365138 AAGATTAAAAGTACAATTCTTGG + Intergenic
1032332209 7:130991124-130991146 ATGAGTAAAAGCAAAATATTGGG - Intergenic
1032336723 7:131031682-131031704 CTGACTAAAAGTAGAATTGAAGG + Intergenic
1032557248 7:132849392-132849414 ATGATTATTAGCAGAAATTTAGG - Intronic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1033408512 7:141094039-141094061 ATAAATAAAAGCATAGTTGTAGG + Intronic
1035547289 8:492713-492735 ACGATTAAAAGAAGAGTTGAAGG - Exonic
1036054125 8:5231380-5231402 ATGATTAAAACAAGAAATGGGGG - Intergenic
1036075301 8:5492591-5492613 GTCATTAAAAGCAAAATTTTTGG + Intergenic
1036160381 8:6382185-6382207 ATGATTGAAAGCAGGATTTTGGG + Intergenic
1036984797 8:13516799-13516821 ATGAATACACGCAAAATTGTTGG - Intergenic
1037402962 8:18511871-18511893 ATATCTAAAAGTAGAATTGTTGG - Intergenic
1038112276 8:24512951-24512973 ATGATTAAAAGCATACTCTTTGG - Intronic
1038150225 8:24936691-24936713 AGGAATAAAAGCAGATTTTTCGG - Intergenic
1038471514 8:27827244-27827266 ATGATTAAAAGAAGTAATTTTGG + Intronic
1040715794 8:50250125-50250147 ACTATAAAAAACAGAATTGTTGG + Intronic
1040722421 8:50341984-50342006 ATGATGAAAAGCACAATATTTGG - Intronic
1041394986 8:57381042-57381064 ATGTTTAAAAGCAAAGATGTAGG - Intergenic
1041564970 8:59266594-59266616 ATGATTAACATCATAATTTTTGG + Intergenic
1041577311 8:59413817-59413839 ATAATTAAAAGCATGATTGCTGG - Intergenic
1042042116 8:64603478-64603500 TTAAATAAATGCAGAATTGTAGG + Intronic
1042590364 8:70392438-70392460 ATTATTAAAAGGAGAAATTTGGG + Intronic
1043354672 8:79398784-79398806 ATGATTAAAAGCATACTTAGCGG + Intergenic
1043530792 8:81147853-81147875 ATGAGTAAAATCAGACTTATTGG - Intergenic
1043573974 8:81635741-81635763 ATGAATAAAACCACAATAGTGGG + Intergenic
1044785799 8:95791247-95791269 ATTATTAGAAGTAGGATTGTGGG - Intergenic
1045257252 8:100536811-100536833 ATTGTTAAAAGCAGAACTTTGGG + Intronic
1045384676 8:101660240-101660262 ATGATAAAAAGCACTATTGACGG - Intronic
1046043952 8:108941696-108941718 ATGATTTAAATCAGTATTTTAGG - Intergenic
1046263186 8:111797807-111797829 ATGATTAAAAGTAGTATTTATGG - Intergenic
1046547577 8:115670136-115670158 ATGATTAAAATTAGAATCTTAGG + Intronic
1048065927 8:130968469-130968491 ATGATAAAAAGCAGAATAACTGG - Intronic
1048874356 8:138825368-138825390 ATGGTTAAAAGCACAGATGTGGG + Intronic
1049943200 9:568822-568844 ATGATTAGAAGCAAAATTACAGG + Intronic
1050419003 9:5443189-5443211 ATATGTAAAAGCAGAATTGCTGG + Intergenic
1051417928 9:16862147-16862169 ATGCTCAAGAGTAGAATTGTTGG - Intronic
1051490010 9:17652287-17652309 ATGATTTAAAGAAGAAATGAGGG - Intronic
1051601194 9:18876610-18876632 CTGATTAACAGCAGATTTCTTGG - Intronic
1051845346 9:21445884-21445906 AATATAAAAAGCAGAATTCTTGG + Intergenic
1052710989 9:32055225-32055247 ATTGTAAAAAGCAGAATTTTAGG - Intergenic
1052914777 9:33916421-33916443 ATAATTAAATTAAGAATTGTTGG + Intronic
1053298965 9:36935405-36935427 ATGATTTGCAGCAGAATTGAAGG + Intronic
1053510455 9:38683410-38683432 GTGATTAAAATCAAAATTGCAGG + Intergenic
1056089678 9:83193053-83193075 ATGTTTGCATGCAGAATTGTTGG + Intergenic
1056097056 9:83265856-83265878 ATGCTTCAAAGTATAATTGTTGG - Intronic
1057894221 9:98894203-98894225 ATGGGAAAAAGCAGCATTGTCGG - Intergenic
1058318700 9:103602092-103602114 AAAATGAAAAGCAGAAGTGTTGG - Intergenic
1059040433 9:110808919-110808941 GTGATTAAAATTAGAAGTGTTGG + Intergenic
1059190860 9:112324975-112324997 ATGACTAGGAGCAGAATTGCTGG - Intronic
1060133363 9:121127330-121127352 ATGCTCAGAAGCAGAACTGTGGG + Intronic
1060259219 9:122059143-122059165 ATGATTAAAAGAAACATTGTGGG + Intronic
1186852626 X:13595662-13595684 ATATTTAAAAGTGGAATTGTTGG + Intronic
1187398072 X:18935170-18935192 ATGGTTAGAAGAAGAATTCTTGG - Intronic
1187534562 X:20128241-20128263 ATGATCAAAATCCAAATTGTAGG + Exonic
1188291471 X:28394140-28394162 ATCATTAAATGCAGAATTAAAGG + Intergenic
1189249881 X:39592558-39592580 ATTATTATATGGAGAATTGTGGG - Intergenic
1192300922 X:69901753-69901775 ATGATAAAAAGAAGAAAAGTGGG + Intronic
1192334653 X:70207487-70207509 ATAACTAAAAGTAGAATTGCTGG - Intergenic
1192801467 X:74468630-74468652 ATACCTAACAGCAGAATTGTTGG + Intronic
1192823383 X:74667872-74667894 ATGCCTAAAAGCAGGATTGATGG - Intergenic
1193292501 X:79791861-79791883 ATTTTTAAAAGCTGATTTGTTGG + Intergenic
1194375326 X:93125555-93125577 ATGATCAAAATAAAAATTGTTGG + Intergenic
1194673627 X:96766794-96766816 TTGATTAGAAGCAGAAATGGAGG + Intronic
1196008680 X:110863249-110863271 CTAATTAAAAGCAGATATGTTGG + Intergenic
1196509192 X:116485901-116485923 ATAATGAAAAGCAGAATTACTGG - Intergenic
1197976500 X:132171493-132171515 ATGATTCAAAGTAGAAATCTTGG - Intergenic
1198102222 X:133432137-133432159 CAGATTAATAGCACAATTGTGGG + Intergenic
1199169053 X:144714853-144714875 GTGACTAAAAGCAGACCTGTAGG + Intergenic
1199262392 X:145790421-145790443 AAGATTATAAGAAGAATTCTTGG - Intergenic
1199465625 X:148133116-148133138 ATGATTTATAGCAGAAGTGCGGG + Intergenic
1199782689 X:151077148-151077170 ATTACTAGAAGCAGAATTGCTGG - Intergenic
1199840503 X:151642520-151642542 ATGAATAAAAACAGAATTTCAGG + Intronic