ID: 1124157857

View in Genome Browser
Species Human (GRCh38)
Location 15:27243698-27243720
Sequence ATGAATATGCAAATAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 17, 3: 77, 4: 584}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124157857_1124157861 26 Left 1124157857 15:27243698-27243720 CCATTGTCTATTTGCATATTCAT 0: 1
1: 0
2: 17
3: 77
4: 584
Right 1124157861 15:27243747-27243769 TAATACTAATAAGGTTTAAAGGG 0: 1
1: 0
2: 1
3: 34
4: 402
1124157857_1124157859 17 Left 1124157857 15:27243698-27243720 CCATTGTCTATTTGCATATTCAT 0: 1
1: 0
2: 17
3: 77
4: 584
Right 1124157859 15:27243738-27243760 AACATCAGTTAATACTAATAAGG 0: 1
1: 0
2: 1
3: 26
4: 231
1124157857_1124157860 25 Left 1124157857 15:27243698-27243720 CCATTGTCTATTTGCATATTCAT 0: 1
1: 0
2: 17
3: 77
4: 584
Right 1124157860 15:27243746-27243768 TTAATACTAATAAGGTTTAAAGG 0: 1
1: 0
2: 1
3: 20
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124157857 Original CRISPR ATGAATATGCAAATAGACAA TGG (reversed) Intronic
900857004 1:5194324-5194346 ATGAACAAACAAATAGATAAAGG + Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902459485 1:16562577-16562599 ATGAATATAATAATAGACACAGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903152680 1:21423256-21423278 ATGAATATAATAATAGACACAGG + Intergenic
903160449 1:21484729-21484751 ATGAATATAATAATAGACACAGG - Exonic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906793559 1:48679028-48679050 ATGGATATGCAAGTTGACAGTGG + Intronic
907826564 1:58022689-58022711 ATAAATATGAAAACATACAAAGG - Intronic
908151659 1:61309017-61309039 ATGAGTGTGCAAATGGAAAACGG - Intronic
910323246 1:85974098-85974120 ATGAATATGTAAATAGAGTTGGG + Intronic
910366757 1:86474174-86474196 ATGGATATGTAAGGAGACAACGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910484803 1:87701422-87701444 ATTTATATGCAAATATAAAAGGG + Intergenic
910546812 1:88427337-88427359 ATCAATATTCAAGTAGACAAAGG + Intergenic
910618043 1:89221596-89221618 ATGAATATGTAATGAGATAAAGG - Intergenic
910817557 1:91308160-91308182 ATTAACATTCAAAGAGACAATGG - Intronic
911698847 1:100926822-100926844 ACGAACATGCAAATAGATAATGG + Intronic
912579594 1:110708152-110708174 GTGTATCTGCAAATATACAAAGG + Intergenic
913159799 1:116134491-116134513 ATGAAAATGCAAATAGCTGAAGG + Exonic
913473767 1:119217034-119217056 ATGAACATGAACATAGATAAAGG - Intergenic
913606102 1:120467562-120467584 ATGAATATAATAATAGACACAGG - Intergenic
913644289 1:120841934-120841956 ATGAATATAATAATAGACACAGG - Intergenic
914082454 1:144421650-144421672 ATGAATATAATAATAGACACAGG + Exonic
914177353 1:145290160-145290182 ATGAATATAATAATAGACACAGG + Exonic
914210327 1:145572604-145572626 ATGAATATAATAATAGACACAGG + Intergenic
914269251 1:146064955-146064977 ATGAATATAATAATAGACACAGG + Exonic
914314202 1:146494329-146494351 ATGAATATAATAATAGACACAGG + Intergenic
914485133 1:148102306-148102328 ATGAATATAATAATAGACACAGG + Exonic
914500145 1:148239052-148239074 ATGAATATAATAATAGACACAGG - Intergenic
914532084 1:148531642-148531664 ATGAATATAATAATAGACACAGG + Exonic
914585097 1:149054293-149054315 ATGAATATAATAATAGACACAGG + Exonic
914636314 1:149556079-149556101 ATGAATATAATAATAGACACAGG - Intergenic
916402725 1:164466567-164466589 CTGAATAGGCAAATAAACAGTGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918554851 1:185786436-185786458 ATGAAAATACATATAGGCAAAGG + Intronic
918571261 1:185996121-185996143 ATGACTATGTAATTAGACATTGG + Intronic
918610317 1:186482556-186482578 CTTAATATGCTAATAGAGAATGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918888468 1:190229858-190229880 ATGAACATATAAAAAGACAAGGG + Intronic
918974809 1:191469823-191469845 ATAAATATGGAAATCAACAATGG + Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919703494 1:200654805-200654827 ATGAAGATGCAAATAGTCAGAGG - Intronic
920160774 1:203996309-203996331 TTGAATGTGCAAATAAACAGAGG + Intergenic
920273080 1:204781689-204781711 AAGATTATACAAATAGTCAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920612173 1:207452397-207452419 ATGAATAAATAAATAGAGAAGGG + Intergenic
921692583 1:218166634-218166656 GTGATTATGAAAATAAACAAGGG + Intergenic
922050541 1:221985993-221986015 ATAAATATGCAAAGTGACCACGG + Intergenic
922285760 1:224169242-224169264 ATGAAAAAGGAAATTGACAAAGG - Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922912864 1:229232174-229232196 ATGCCTAGGCAAATAGAGAAGGG - Intergenic
924047659 1:240048739-240048761 AAGAATCTGCAAAGAGAAAAAGG + Intronic
924177155 1:241402910-241402932 ATGAAAATGCAAACAGAGAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924379113 1:243445446-243445468 ATGAAAAGGAAAATATACAATGG + Intronic
1063005669 10:1968315-1968337 ATAAATATGTAAATAAACACTGG - Intergenic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063779678 10:9307048-9307070 ATTTATATGCAGATAGACCAAGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065354770 10:24829189-24829211 ATCAATATGTGAATAGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067571433 10:47374378-47374400 ATGAATATTCAAATACAAACAGG + Intronic
1067958163 10:50816507-50816529 ATGAATATGTCAATGGACACTGG - Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069193289 10:65518018-65518040 ATGAATATTCAAATATAAGAAGG - Intergenic
1070058322 10:72956186-72956208 ATGCATATGCACATACACAGAGG + Intergenic
1070429377 10:76321498-76321520 ATCAATAGAAAAATAGACAAAGG - Intronic
1070466585 10:76730170-76730192 ATTAATATGCAAATGTATAATGG - Intergenic
1070938150 10:80317523-80317545 AGGAATATGCAATTCAACAATGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071359456 10:84831411-84831433 AAGAATAAGTAAATAGAAAAAGG - Intergenic
1071759133 10:88580652-88580674 ATGAAAATCCTAATAGAAAATGG + Intronic
1072186429 10:93043578-93043600 ATGATTATGCAAAGTGTCAATGG + Intronic
1073811783 10:107160327-107160349 ATGAATTGCCAAATAGACACAGG - Intronic
1073959940 10:108913874-108913896 AAGAATAAGCCATTAGACAAGGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077813490 11:5662314-5662336 ATAAAAATGCCAATAGACATAGG + Intergenic
1079267289 11:18945545-18945567 ATGAAGATCAAAAAAGACAAAGG + Intergenic
1079813858 11:25030100-25030122 ACAAATATGCAAACACACAAAGG - Intronic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1081025560 11:38009247-38009269 ATGGCTATGCAAATAGACTTAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081410341 11:42750234-42750256 ATTATAATGGAAATAGACAATGG + Intergenic
1081555915 11:44160938-44160960 ATGAATAAGAAAACAGAAAAAGG - Intronic
1082109166 11:48254857-48254879 ATGAAAATGAAAATATACCAGGG + Intergenic
1082663623 11:55946740-55946762 ATAAAGATGGAAATAGACACCGG - Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083556045 11:63629067-63629089 AGTAATATGAAAATAGACACAGG + Exonic
1083623637 11:64060893-64060915 ATGAATATGCAAAGAGCCTCGGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086582853 11:88419510-88419532 AAAAATATGAAAAAAGACAAAGG - Intergenic
1086909608 11:92457301-92457323 ATGAATAGGCAGAGATACAATGG + Intronic
1086941003 11:92798541-92798563 ATGAAAATGGAAATGGGCAATGG - Exonic
1087417038 11:97870649-97870671 ATGCATATGCAAAAACAAAAAGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087964515 11:104396114-104396136 ATGAGTATGCTGATAGACACAGG - Intergenic
1088101761 11:106163733-106163755 ATGAAGATGCAAAGATACAAGGG - Intergenic
1088236769 11:107733172-107733194 ATGAATTTGCAAAAAGATGAAGG + Intergenic
1089167851 11:116490952-116490974 ATGATTATGCTAATAGATATGGG - Intergenic
1090557601 11:127893392-127893414 ATGAATCTCCAAAGAGACTACGG - Intergenic
1090730618 11:129570500-129570522 ATGAAGATGCAAAGGTACAAGGG - Intergenic
1091462163 12:651893-651915 ATGGAAAAGCAAAGAGACAAAGG + Intronic
1091492213 12:942914-942936 ATGAATAGGCAACCAGACAGAGG + Intronic
1092686986 12:11059555-11059577 ATACATATTCAAATAGACCAAGG + Intronic
1092697311 12:11187315-11187337 ATTAATATGCAAATATAGACTGG + Intergenic
1093250865 12:16803491-16803513 ATGAAAAGCCAAATAGAAAATGG + Intergenic
1093259342 12:16916388-16916410 ATGAATATTCAAATATATGAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1094864345 12:34512057-34512079 ATGAAAAAGCAAATACATAAAGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097361411 12:58662504-58662526 ATGAATATGCTAAAAAGCAAGGG + Intronic
1097808197 12:63988549-63988571 AAGAAAATGAAAGTAGACAATGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098058709 12:66537010-66537032 ATGAATATGCATATGGACTTTGG + Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1099564710 12:84228899-84228921 ATAAATATCCAAATACACAAAGG - Intergenic
1099572540 12:84342240-84342262 TTGAATAGGTAAATAGATAAGGG - Intergenic
1101693900 12:107106692-107106714 ATCAATATGCACATGGACATGGG + Intergenic
1103177850 12:118879988-118880010 ATGAATATCCATTTAGAAAATGG - Intergenic
1103627310 12:122229778-122229800 ATTTGTATGCAAATAGAAAATGG - Exonic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1106091538 13:26599659-26599681 AAGAATCTGCCAATAGATAAGGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106664643 13:31838872-31838894 AGGAATCTGGAAATATACAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107211636 13:37863747-37863769 ATGAATCTCCAAAAACACAATGG - Intronic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108061377 13:46536847-46536869 ATGAAGATCCAAAGAGACAGCGG + Intergenic
1108138172 13:47387624-47387646 ATCAATATGCAAGTACAGAAAGG + Intergenic
1108802269 13:54114102-54114124 ATAAAGATGCAAAGAGAGAAAGG - Intergenic
1108875807 13:55049250-55049272 AAGAAAATGGAAATAGAAAAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109748535 13:66659017-66659039 AAGTATATGCAAATAAGCAAGGG - Intronic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1110099516 13:71579581-71579603 AGGAAGCTGAAAATAGACAATGG + Intronic
1110249558 13:73366495-73366517 ATAAATAAGCAATTAGCCAATGG + Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1111460692 13:88537739-88537761 ATAAACATGCACATAGATAAGGG - Intergenic
1111865148 13:93758981-93759003 AAGAAAATGCAAAAAGAGAACGG - Intronic
1112136352 13:96582777-96582799 ATGCATATGTAAATAGAGGATGG - Intronic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112409479 13:99150203-99150225 ATTAATATTCAAAGAGAAAATGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1114468198 14:22939797-22939819 ATAAAGATGGAAATAGACACTGG + Intergenic
1114868180 14:26623388-26623410 ATGAAGATCCAAAAAGATAAAGG - Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115847074 14:37550143-37550165 TTGAATAAGGAAATATACAAAGG - Exonic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116243988 14:42384663-42384685 ATTAATGTGCACATAGACATGGG - Intergenic
1116371192 14:44135115-44135137 ATGAATTAGAAAATAGAAAATGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118121933 14:62855278-62855300 ATGAATATGAAAAGAAAAAACGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118798878 14:69171092-69171114 TTTAATATGCAGATAGACACTGG - Intergenic
1118924221 14:70177218-70177240 ATGAATGTGCAAAAATAGAAGGG + Intronic
1119105696 14:71921486-71921508 ATGAATAAAGAAATATACAATGG + Intergenic
1119590945 14:75887271-75887293 AAGAATATGAAAATAAACACCGG + Intronic
1120005298 14:79349822-79349844 AAGATTATGCAAAGAGACACAGG + Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1120280383 14:82431168-82431190 GTAAAAATGCAATTAGACAAAGG - Intergenic
1120281844 14:82448912-82448934 ATAAAGATGCAAAATGACAATGG + Intergenic
1120326051 14:83027898-83027920 ATTAATATTCATAGAGACAATGG - Intergenic
1120883107 14:89429948-89429970 ACGAATGTGACAATAGACAAGGG - Intronic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1123199436 14:106648346-106648368 ATGAATAAGAAAGAAGACAAGGG - Intergenic
1123221434 14:106860490-106860512 ATGAATAAGCAAAAAGATAAGGG - Intergenic
1123223157 14:106875103-106875125 ATGAATATGCAAATAACTGAGGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125295689 15:38200514-38200536 ATTAATATGGAAATAACCAATGG - Intergenic
1125380714 15:39083815-39083837 ATGAATATGCAGAGAGACATTGG - Intergenic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1126668826 15:51097550-51097572 TTGAATGTGGAATTAGACAATGG + Intronic
1126944420 15:53803181-53803203 ATGAATATGTATATATACATGGG + Intergenic
1127626499 15:60785394-60785416 ATGAATAGGTAAACAGAGAAGGG + Intronic
1128659995 15:69492554-69492576 AAGAATAGGCAAATACACCATGG - Intergenic
1128691852 15:69730656-69730678 AAGAATATCTGAATAGACAAAGG + Intergenic
1129864747 15:78897767-78897789 AGGAATACACAAATATACAATGG - Exonic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130518002 15:84640955-84640977 ATTATTATGAAAATAGATAAGGG + Exonic
1131026647 15:89148243-89148265 ATCAATAGAAAAATAGACAAAGG + Intronic
1131422021 15:92314805-92314827 ACATATATGCAAATAGACAAGGG + Intergenic
1131768885 15:95712861-95712883 ATGCCAATGCAAATAGAGAAGGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133477909 16:6141144-6141166 AGGGAAATGCAAAAAGACAAAGG - Intronic
1134319331 16:13148594-13148616 ATGCATATGAATATAGACATAGG - Intronic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1135618867 16:23935841-23935863 ATAAATATGAAACTAGACACTGG + Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138973863 16:62179750-62179772 ATGAACATCCAGATACACAAAGG + Intergenic
1138986636 16:62337110-62337132 ATGACTATCTAAATAGACATGGG + Intergenic
1140194990 16:72848368-72848390 ATCAATATGCAAATTGCCCATGG + Intronic
1141044184 16:80701247-80701269 ATGCATATGCAAATATATAAAGG + Intronic
1141240019 16:82257257-82257279 AGGAATATGAAAAGAAACAATGG - Intergenic
1141408450 16:83815239-83815261 ATTAATATGGAAATAGGAAAAGG + Exonic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1146402610 17:32511830-32511852 CTGAATAAGCAAATATATAATGG - Intronic
1146417730 17:32652454-32652476 ATAAATATGGCAATAGACAAAGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1148514069 17:48199716-48199738 TTGAAAAAGCAAATAGAAAAAGG + Intronic
1149589128 17:57815316-57815338 AGGAATAGGCAATTAGACCAGGG - Intergenic
1149827812 17:59845747-59845769 TTAAATATGCAAATACACACAGG - Intergenic
1149943060 17:60891826-60891848 ATGAAAATGGAAATAGGCAGTGG - Intronic
1150949147 17:69782829-69782851 ATGAAAACAAAAATAGACAATGG + Intergenic
1151148302 17:72062220-72062242 ATGAAAAAGAAAACAGACAAAGG + Intergenic
1151252900 17:72851271-72851293 ATGAATAAACAAATAGCCCAGGG - Intronic
1153162659 18:2226308-2226330 AAAGATATGCAAATACACAATGG - Intergenic
1153536889 18:6111198-6111220 AGGAAGATGCAAATGGATAAGGG + Intronic
1155432163 18:25771001-25771023 GTGAAGATGCAAAGAGACGATGG - Intergenic
1155567342 18:27149937-27149959 TTAAATATGCAAAGAGATAAAGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155894275 18:31304022-31304044 AAGAATATCCAAACAGACTATGG - Intergenic
1156734353 18:40235251-40235273 ATGAATATGCAATAGGCCAATGG + Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158204286 18:54974356-54974378 ATGTATATGAAAATATAGAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159230276 18:65598332-65598354 ATGAATAAGCAAATAGCCCTTGG + Intergenic
1159291085 18:66421121-66421143 ATCTATATGCACATACACAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159653218 18:71001683-71001705 ATGTTTATCCAAATAGAAAATGG + Intergenic
1160496378 18:79378411-79378433 GTGATTTTGCAAATAGAAAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160613057 18:80104043-80104065 CTGAATGTGCCAACAGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1165911492 19:39231140-39231162 ATGAAAATGAAAATACCCAAAGG - Intergenic
1166398106 19:42457318-42457340 ATAATTATGGGAATAGACAAAGG + Intergenic
1166428107 19:42697681-42697703 ATAAATAAGAAAAAAGACAAGGG + Intronic
1166442972 19:42832282-42832304 ATAATTATGGGAATAGACAAAGG + Intronic
1166468797 19:43059499-43059521 ATAATTATGGGAATAGACAAAGG + Intronic
1166479942 19:43163020-43163042 ATAATTATGGGAATAGACAAAGG + Intronic
1166489768 19:43248551-43248573 ATAATTATGGGAATAGACAAAGG + Intronic
1168011329 19:53535656-53535678 ATGAATATGAAAATAGTCACTGG + Intronic
1202675730 1_KI270711v1_random:4761-4783 ATGAATATAATAATAGACACAGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925481515 2:4279680-4279702 ATGAATATGCAAATAACTCAAGG + Intergenic
925848217 2:8052791-8052813 ATGTATATACAAATATACACAGG - Intergenic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
926356702 2:12047272-12047294 TTGAATAAGCACATAGACCAGGG - Intergenic
927821574 2:26270633-26270655 ATGATTATACAATTAGACAGAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928810612 2:35220147-35220169 ATGAAAATCCACTTAGACAAAGG + Intergenic
928932900 2:36643669-36643691 ATGTATATGGCAATAGATAAGGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929292098 2:40204695-40204717 ATATATATGCAAAAAGATAAAGG + Intronic
929704508 2:44196124-44196146 AAGAAAATGCAAATAAAGAATGG - Intronic
931266314 2:60663426-60663448 CTGAATAGGCAAATAGATAGGGG - Intergenic
931550144 2:63435031-63435053 ATGGCCATGCAAATAGAAAAGGG - Intronic
932011870 2:67986574-67986596 ATGAATGTGCAAGTTGAGAAGGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932989978 2:76775069-76775091 ATGGATATGCAAAAAGTCAGGGG - Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934313018 2:91887118-91887140 ATGAAAATAAAAATAGAAAAAGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
935529078 2:104210897-104210919 AACAACATGCAAATAGAGAATGG - Intergenic
935531343 2:104235742-104235764 ATAAATAAGCAATTAAACAAGGG + Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935895757 2:107735759-107735781 ATGAATAAGTAAATAAATAAAGG + Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936726658 2:115326722-115326744 AAAAATATTAAAATAGACAAAGG + Intronic
936832004 2:116657788-116657810 ATCAATATCCAAATACAAAAAGG + Intergenic
937696593 2:124815216-124815238 ATGAATTAGCACATAGCCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938578444 2:132624920-132624942 AAGTATATGCAAAGAGAAAAGGG - Intronic
938772134 2:134509732-134509754 GTGAATGTGAAAATAGGCAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939334277 2:140805128-140805150 ATGAGTCTGCAAATACACACAGG + Intronic
939506992 2:143057634-143057656 ACCAATATGCTGATAGACAACGG - Intergenic
939922202 2:148129781-148129803 CTGAATAAGTGAATAGACAAAGG + Intronic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940372350 2:152917446-152917468 AGGAATATGTAATTAGATAACGG + Intergenic
940428677 2:153560911-153560933 ATGAATATTCAACTACATAAAGG - Intergenic
940655348 2:156481140-156481162 ATAAATATGTAAATAAATAAAGG - Intronic
940781088 2:157934320-157934342 AGGAATATCCAAGTAGGCAATGG + Intronic
940803475 2:158157992-158158014 AAGAATATGGAAATAAACCAAGG + Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942106705 2:172640866-172640888 ATGAAAATCCAAATATACAGGGG + Intergenic
942496203 2:176542223-176542245 ATGTGTATGCAAATGAACAAAGG - Intergenic
942541725 2:177022111-177022133 ATGAAGATGATAATAGTCAATGG - Intergenic
942756492 2:179347544-179347566 ATGATGATGTAAAGAGACAAAGG - Intergenic
942985889 2:182141601-182141623 ATAAATATGCATATAGAATATGG + Exonic
943242403 2:185402009-185402031 AAAAATAAGCAAAGAGACAAGGG + Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
944014292 2:195015236-195015258 ATGAATAATCAAAAATACAATGG + Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944312603 2:198250862-198250884 ATAAATATTTAAATAAACAATGG - Intronic
945402060 2:209395085-209395107 TTTAATTTGCAAATAGATAATGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945619300 2:212113194-212113216 ATGATTTTCCAAATAGAGAAGGG + Intronic
946182606 2:217957558-217957580 ATTACTATGGAAATAGACAGAGG + Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
947064957 2:226213802-226213824 ATAAAGATGAAAATAGAAAATGG - Intergenic
947252251 2:228121125-228121147 AAGAATTTGCCACTAGACAAAGG + Intronic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1170074686 20:12406589-12406611 ATGCATATGCAAAGTGCCAAAGG + Intergenic
1170359010 20:15524066-15524088 ATGAATGTGCACACAGACAAAGG - Intronic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1171274293 20:23842488-23842510 ATGACCATGCACAAAGACAATGG + Intergenic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1173149520 20:40554121-40554143 ATCAATAGCCAAATAGACCAAGG + Intergenic
1173329630 20:42063625-42063647 AAGAATATGCAACTAGAGGACGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174895862 20:54449478-54449500 ATGAAGATCCAAAGAAACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176306094 21:5123851-5123873 ATGAATGTGCAAAGAGAGAGAGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176932220 21:14827153-14827175 ATGAACAAGCAAATAAATAAAGG + Intergenic
1177375699 21:20268494-20268516 ATGGATATGCATATGCACAAAGG + Intergenic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177829285 21:26118980-26119002 GTGAACATGCAGATAGAAAAAGG + Intronic
1177926545 21:27222797-27222819 AGGAATATTCAAATAAATAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178762244 21:35414227-35414249 AGGAATATGCAAATATGTAATGG + Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179377656 21:40865237-40865259 ATGCATATGAATAAAGACAAAGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179850963 21:44138180-44138202 ATGAATGTGCAAAGAGAGAGAGG - Intronic
1180046375 21:45307890-45307912 ATGCATGTGCAAATACACAGCGG + Intergenic
1180046387 21:45308062-45308084 ATGCATGTGCAAATACACACCGG + Intergenic
1181370828 22:22415478-22415500 GTGAAAAAGGAAATAGACAAAGG + Intergenic
1181373803 22:22440317-22440339 GTGAAGAAGAAAATAGACAAAGG + Intergenic
1182156854 22:28082219-28082241 ATAAATATCCAAATTGAAAAGGG - Intronic
1185122955 22:48983938-48983960 ATGAATATGCATATAGCCTGTGG + Intergenic
949354440 3:3163324-3163346 CTGAATATGAAAATAACCAAGGG + Intronic
950010184 3:9717549-9717571 ATCCATATGAGAATAGACAAGGG + Intronic
950398220 3:12750353-12750375 ATGACTAAGCAAAAAGGCAAGGG + Intronic
950562629 3:13743730-13743752 ATGACTAGGCATATACACAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951604198 3:24414020-24414042 CTGAAAATGCAAATATACTATGG - Intronic
952230209 3:31421519-31421541 TTGAATATGCAAATATGCAAAGG - Intergenic
952495854 3:33915125-33915147 ATGAGTATGAGAATAGACAGGGG - Intergenic
952869306 3:37884357-37884379 ATGAATATGTACATAGAGAATGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954528277 3:51293592-51293614 ATGAAAATAAAAATAGAAAATGG + Intronic
954664315 3:52243734-52243756 ATGGCTCTGAAAATAGACAATGG + Intergenic
954723762 3:52589472-52589494 ATGAATATATAACTACACAAAGG + Intronic
955875289 3:63482805-63482827 ATGAATATGTACATGGATAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956748364 3:72327366-72327388 ATGAATAGGCGAATAGATGAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957860141 3:85937384-85937406 ATCATTTTGCAAATAGATAAAGG + Intronic
957903033 3:86521701-86521723 CAGAATATGCAAAAAGACTAGGG - Intergenic
957919253 3:86727644-86727666 ATGAATCAGCAAATAGGTAATGG - Intergenic
958184481 3:90102874-90102896 AAGAAAATGCAAATGGACAGAGG + Intergenic
958572291 3:95902252-95902274 ATATATCTGGAAATAGACAATGG - Intergenic
958660080 3:97055512-97055534 ATTCATATGGAAATACACAAGGG + Intronic
959473756 3:106784868-106784890 ATGAAAACCCAAATAGACAGGGG + Intergenic
959750951 3:109834362-109834384 TTGAGTATGCAACTTGACAATGG - Intergenic
960410112 3:117312548-117312570 ATAAATATTCAAAAAGACAGTGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960898895 3:122534327-122534349 ATGAACCTGGAAATAGCCAAGGG + Intronic
961070860 3:123924892-123924914 ATGGATATGTACATAGACATGGG - Intronic
961096958 3:124165736-124165758 ATGAATATAAATATATACAATGG - Intronic
963727502 3:148938466-148938488 ATAAATATACAAATATACACTGG + Intergenic
964509938 3:157438714-157438736 ATGAATCTCCAAACAGACATGGG + Intronic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
965666751 3:171102351-171102373 ATGAATGTGCAAATACCAAAAGG + Intronic
966047199 3:175566278-175566300 AGTAATAAGCAAATTGACAATGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290761 3:178355300-178355322 ATGAATATGTGCAAAGACAAAGG + Intergenic
966703934 3:182889652-182889674 ATTAAAATGCAAATATAAAAAGG + Intronic
968774240 4:2530166-2530188 ATGAATATGCAAAACAACATTGG + Intronic
969133259 4:5008249-5008271 AGGAATACACAAATACACAAAGG + Intergenic
969627662 4:8315945-8315967 GTGAATGTGAAAATACACAAAGG - Intergenic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970326927 4:14935781-14935803 ATGTACATGCAAAAAGACATAGG + Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971740976 4:30520751-30520773 ATAAATATGGAAATATACAAAGG - Intergenic
971754474 4:30689584-30689606 TAGAATAAGCAAATAGACAGAGG - Intergenic
972796758 4:42428938-42428960 ATGAATGAGCAACTAGAAAATGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974531063 4:63108612-63108634 ATGAGTATTCAAATACAAAAAGG + Intergenic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974870767 4:67638231-67638253 AAGAATATGCAAACAGTTAAGGG + Intronic
974944246 4:68507318-68507340 ATAAAAATGCATATAGACATTGG - Intergenic
974954792 4:68624630-68624652 ATAAAAATGCACATAGACATTGG - Intronic
975026262 4:69552145-69552167 ATGAATATGGAAAGAGAAGATGG + Intergenic
975213322 4:71726171-71726193 AGGAATTTACAAATAAACAAGGG - Intergenic
975482801 4:74900533-74900555 GTTTATGTGCAAATAGACAAAGG + Intergenic
976863046 4:89689531-89689553 ATGGAAATGCATATAGATAATGG + Intergenic
976934975 4:90619892-90619914 GTGAATATGAAAGTAGAAAATGG + Intronic
976992813 4:91389423-91389445 ATGAATAAGCAAATAGGTAATGG - Intronic
976994006 4:91406898-91406920 GAGAATATTCAAATAAACAAAGG - Intronic
977002438 4:91520158-91520180 ATGTATATTAAAATAAACAAAGG - Intronic
977714813 4:100170355-100170377 ATGAATCTGTAAATAAACAAAGG - Intergenic
977909133 4:102511960-102511982 ATATATATCCACATAGACAATGG + Intronic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978488262 4:109281017-109281039 ATAAATATGTAGATAGACAAAGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979306509 4:119150766-119150788 ATGATTATGCAATTAGAAAGTGG + Intronic
980334432 4:131452324-131452346 ATACATATGCAGATAGAGAAAGG - Intergenic
980371908 4:131885212-131885234 ATAAATATGCAGAAATACAAAGG + Intergenic
981159501 4:141480894-141480916 ATAAATATCCAAATACAGAAAGG - Intergenic
981341630 4:143628297-143628319 ATGAAGAGGACAATAGACAAGGG + Intronic
981389269 4:144169625-144169647 ATCAATGAGCAAATAGCCAAGGG + Intergenic
981843800 4:149143737-149143759 ATGAAGAAGCAAATAAAAAAGGG + Intergenic
982352148 4:154427688-154427710 ATGAAAATGCCAACAGACAGAGG + Intronic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
982806699 4:159774038-159774060 ATTCATATGTAAATAGACTATGG - Intergenic
982867739 4:160539087-160539109 ATTAATATGCAAAAATACAATGG - Intergenic
983045406 4:162980898-162980920 ATGAATATGTAAATCACCAATGG - Intergenic
984369547 4:178844972-178844994 AAGAGTATTCAAATAAACAATGG + Intergenic
984435047 4:179699146-179699168 ATGAACATGCAAATTGACTAGGG - Intergenic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
985035054 4:185830428-185830450 TTGAGTCTGCAAATAGAAAATGG + Intronic
985649062 5:1098948-1098970 ATGAATGTGCAGAATGACAAGGG - Intronic
986083358 5:4417167-4417189 ATGAGTATGAGTATAGACAAAGG + Intergenic
986200119 5:5572060-5572082 ATGAAAATGGAGATAGACAGGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986847417 5:11771641-11771663 ATGATTATGTAAATAGACGGGGG - Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987437782 5:17917962-17917984 GTCAATATTCAAATAGAAAATGG + Intergenic
987857082 5:23434472-23434494 ATATATTTGCAAATAGATAATGG - Intergenic
988168477 5:27624965-27624987 GTGAATATGAAAAGAGTCAAGGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
990335696 5:54770114-54770136 ATAAATACACAAATAGACATGGG + Intergenic
991171904 5:63637238-63637260 ATGAATATGGAAATGCACACTGG - Intergenic
991367839 5:65887407-65887429 ATGGTGATGGAAATAGACAAAGG - Intergenic
992306564 5:75446076-75446098 AAGAATATTCAAAGAGATAATGG - Intronic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
994027079 5:95096952-95096974 ATGAAAATGCAAAGACATAATGG - Intronic
994320613 5:98390640-98390662 ATGCTTATGCAAACAGAAAAAGG - Intergenic
995092837 5:108199823-108199845 ATAAATATGAAATTACACAAAGG + Intronic
995319022 5:110810183-110810205 ATGATTATGAAAATAGAGAAAGG + Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
996066994 5:119090368-119090390 ATAAATATCCAGGTAGACAAAGG - Intronic
996160948 5:120164027-120164049 AGAAAAAAGCAAATAGACAAGGG - Intergenic
996430041 5:123364436-123364458 ACGAATTTGCAAAGAAACAAGGG + Intronic
996479295 5:123955567-123955589 TTCAATATGCAAATAGAAGAGGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
996863546 5:128091626-128091648 GTGAAAATGGAAAAAGACAAAGG - Intronic
997086027 5:130800395-130800417 ATAAATATGCAAATCAACATTGG + Intergenic
997649580 5:135505756-135505778 AACAATATGAAAATAGGCAAAGG + Intergenic
997970889 5:138400783-138400805 ATGAAAATGGAATTAGATAATGG - Intronic
998314800 5:141173356-141173378 ATTAATATGGAAATAGGCATTGG - Exonic
998700270 5:144690371-144690393 GTTAAAATGAAAATAGACAATGG - Intergenic
998864578 5:146484615-146484637 ATGAAGATGCAAATACATTAAGG - Intronic
998928221 5:147151454-147151476 AAAGATATGCAAATAGCCAACGG + Intergenic
999056386 5:148582484-148582506 ATGAAGATGGCAATAGACACTGG - Intronic
1000824017 5:166021742-166021764 ATGAAAATGGAAATAGGGAAAGG - Intergenic
1000934850 5:167295063-167295085 ATGAATAGGGAAATAAACAAAGG + Intronic
1001223095 5:169919788-169919810 ATTAATATGCAAATACTCCAGGG - Intronic
1001735967 5:174001752-174001774 GTGAATATGTAAAGAGAGAATGG - Intronic
1001996146 5:176160624-176160646 ATGAATACCCCAATAGAAAAAGG + Intergenic
1002533083 5:179860304-179860326 GACAATATGCCAATAGACAATGG + Exonic
1003613233 6:7631719-7631741 ATGGAAATGCAAACAGGCAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003800476 6:9659731-9659753 AGGAAAATGCAAAAAGCCAAGGG + Intronic
1004091420 6:12506296-12506318 GTGAATATGCATAGCGACAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004362176 6:14980985-14981007 ATCAATAGGAAAATAGACACTGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005665969 6:28055913-28055935 ATGAATTCGCATATAGACATAGG + Intergenic
1006246846 6:32744851-32744873 ATGAATATTGCAATAAACAAAGG - Intronic
1006287820 6:33111295-33111317 AAAAATAGGCACATAGACAAAGG - Intergenic
1008474003 6:51916802-51916824 ATGAATATGCTAAATGAAAAAGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009366247 6:62860213-62860235 ATAAAAATGCAAATATAAAAGGG + Intergenic
1009593549 6:65706769-65706791 ATGTATATGCTAGCAGACAATGG + Intronic
1009656977 6:66559800-66559822 ATCACTATGGAAATAGAAAATGG + Intergenic
1009931087 6:70178524-70178546 AAGAATCTAGAAATAGACAATGG + Intronic
1010809252 6:80280001-80280023 ATGAATAAGGAATTAGGCAAAGG + Intronic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011321337 6:86096606-86096628 ATGAAGATCAAAAAAGACAAGGG + Intergenic
1011435530 6:87332769-87332791 CTGAAAAAGCAAATATACAAAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1012050098 6:94330182-94330204 ATCAATATGCAAGTACAAAAAGG + Intergenic
1012175826 6:96082481-96082503 TGGAATAGGCAAATAGCCAATGG - Intronic
1012852065 6:104458132-104458154 AGGAATATGTATACAGACAAAGG - Intergenic
1013034447 6:106366948-106366970 ATGAACATCCAAATACTCAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014194501 6:118537819-118537841 ATGAATAAGCTCAGAGACAAAGG - Intronic
1014349459 6:120321789-120321811 AAGAATATGCAAAGAAATAATGG + Intergenic
1014664338 6:124218328-124218350 ATGAAATTGAAAATACACAAAGG - Intronic
1014721888 6:124926950-124926972 AGGATTTTGCAAATAGATAAGGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015030485 6:128588263-128588285 ATAAATATCCAAGTACACAAAGG + Intergenic
1015208283 6:130666846-130666868 AAGCCTATACAAATAGACAATGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015613624 6:135052248-135052270 ATTTATTTGCAAATAAACAAGGG + Intronic
1016117572 6:140306244-140306266 ATGAATATGCAATTATTCCAGGG - Intergenic
1016144998 6:140659735-140659757 ATAAATATACAAATACACTAAGG + Intergenic
1016225978 6:141738337-141738359 ATGAAAATGCAAAAATAAAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017375616 6:153764306-153764328 AAGAAAATGCATATACACAATGG + Intergenic
1017853077 6:158322831-158322853 ATGGAAATGCAAATAGAGGAAGG - Intronic
1017943097 6:159070312-159070334 ATGAGGATCCAAAAAGACAATGG - Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019829735 7:3315508-3315530 ATGCACATGCAAGTAGAAAAGGG + Intronic
1020484776 7:8708030-8708052 ATGAATATGCAAATTTTAAATGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021207357 7:17799492-17799514 ATGCATCAGAAAATAGACAAAGG - Intronic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021363079 7:19741186-19741208 ATGAATCTCCATATAAACAATGG + Intronic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022170984 7:27830836-27830858 ATGAATAAGTAAATAGAAATTGG + Exonic
1022376071 7:29812515-29812537 AGGAAGGTGCAAATAGATAAAGG + Intronic
1023471029 7:40520060-40520082 AAGACTATGGAAATAGACAATGG + Intronic
1023492210 7:40755525-40755547 AAGAAGATGCAAATAGTGAATGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024081164 7:45856457-45856479 ATGTATATGCATATATACACAGG - Intergenic
1024355099 7:48406467-48406489 ATTATTATTAAAATAGACAAGGG + Intronic
1024356461 7:48418060-48418082 ATGAATAGATAAATAGACTATGG - Intronic
1024646640 7:51376472-51376494 ATGAATGTGCAAATGGAAACTGG + Intergenic
1026226264 7:68444322-68444344 ATAAATATGTAAATAGAGATAGG + Intergenic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1027349469 7:77295918-77295940 ATACATATGCACATACACAACGG - Intronic
1028188098 7:87813145-87813167 ATGAATATGGAAATAGAATTTGG - Intronic
1028263346 7:88691229-88691251 ATAAGTATGCACAAAGACAATGG + Intergenic
1028598321 7:92571559-92571581 ATGAAAATGCAACTAGAGAAAGG - Intronic
1028620583 7:92823042-92823064 ATCATTAGGCAAATAGAAAATGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029701704 7:102250735-102250757 ACGCATATACACATAGACAAGGG - Exonic
1029894097 7:103963382-103963404 ATGTATAAGCAGATAAACAAAGG + Intronic
1030105755 7:105985725-105985747 ATGAATATGCAAACATTTAATGG + Intronic
1030836199 7:114289808-114289830 ATGAATATGCATAATGCCAAAGG + Intronic
1031109136 7:117584519-117584541 ACAAATAGGCAAGTAGACAATGG - Intronic
1031140263 7:117935025-117935047 ATGTATATGTATATAGATAAGGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1032009450 7:128333734-128333756 ATAAAAATAAAAATAGACAAAGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032546087 7:132744168-132744190 CAGAATATGCAAATAGGAAAAGG + Intergenic
1032749191 7:134819967-134819989 ATGTATATGCTAAAAGAGAATGG + Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033463961 7:141574019-141574041 TTGTATATGCAAATACATAATGG + Intronic
1033610682 7:142961131-142961153 AAGAAGAGGCAAAAAGACAAGGG + Intronic
1033862811 7:145649516-145649538 ATTAATATGCAAAATAACAATGG - Intergenic
1034242195 7:149619117-149619139 ATGAATAAATAAATAGACACTGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034755758 7:153617727-153617749 ATGGAAATGAAAATAGGCAAGGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1035936873 8:3851231-3851253 ATGAATTTGCATCTAGACAAGGG + Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036446733 8:8828150-8828172 ATGCTGATGCAAATATACAAGGG + Intronic
1036978672 8:13443788-13443810 ATGAATATCCAAAAACACAGAGG + Intronic
1037180472 8:15999224-15999246 GTGAATATGGAAATACAAAAAGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039041687 8:33414552-33414574 ATTAACATGTATATAGACAAGGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040634633 8:49258061-49258083 TTGAATATGCTAACAGATAATGG + Intergenic
1040930735 8:52732543-52732565 ATAAACATGGAAATAGACACTGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1042600438 8:70494304-70494326 ATAAATCTGCAAAGAGAAAAGGG + Intergenic
1042684884 8:71427184-71427206 ATCAATATCCAAAAAGAGAAGGG - Intronic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043533921 8:81179527-81179549 ATGAATATGTAGAGAGACTAAGG + Intergenic
1043705958 8:83351067-83351089 GAAAATATGCAAATAGCCAAAGG - Intergenic
1044069698 8:87742253-87742275 ATGAATAAGTAATTAGAAAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1048266526 8:132992099-132992121 ATGAATAAGCAACTGAACAAAGG - Intronic
1048388257 8:133934162-133934184 AACAATATGTAAATAGACAGTGG - Intergenic
1048513562 8:135083824-135083846 ATGAATATGCCAAAAGTAAATGG - Intergenic
1048906600 8:139095108-139095130 ATGAACAGGGAAATAGACAATGG - Intergenic
1049348388 8:142151207-142151229 ATGAATGTGTGAATAAACAATGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050520834 9:6498282-6498304 AAGATCATGCAAATAGACAGAGG + Intronic
1050595702 9:7202662-7202684 AAGAAAAGGCAAAAAGACAATGG + Intergenic
1050910473 9:11063247-11063269 ATTAATCTGCACATAGATAAAGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051187960 9:14480530-14480552 ATGAAAATACAAATAGACCCAGG - Intergenic
1051729134 9:20120973-20120995 AAGAATAGGCAAATAAATAAAGG - Intergenic
1051794008 9:20843617-20843639 ATCAATATTCAAGTACACAAAGG - Intronic
1052103067 9:24474804-24474826 ATGAAGATCCAAATAATCAATGG - Intergenic
1052168289 9:25360596-25360618 ATTAATATTAAAATAGAAAAAGG - Intergenic
1052366978 9:27623149-27623171 ATGAATAAGCACATAAAAAAAGG - Intergenic
1052784382 9:32815033-32815055 ATTAATATGCACATGGACACAGG - Intergenic
1053458066 9:38246452-38246474 ATGAATTTGAAAAAAGAAAATGG - Intergenic
1053636613 9:40012765-40012787 ATAAATATGCAGAAAGACAAAGG + Intergenic
1053769379 9:41451851-41451873 ATAAATATGCAGAAATACAAAGG - Intergenic
1054317475 9:63609839-63609861 ATAAATATGCAGAAATACAAAGG + Intergenic
1054548047 9:66363354-66363376 ATAAATATGCAGAAATACAAAGG - Intergenic
1054985538 9:71258092-71258114 ATGAAAATGAAAATATTCAAAGG + Intronic
1055676566 9:78668541-78668563 ATAAAAATGCATAAAGACAAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056289741 9:85130854-85130876 ATAAGAATGCAAATAGATAAAGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058991470 9:110257859-110257881 ATGAATATGGATATAGGCAAGGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060097172 9:120801803-120801825 GTTAATATCCAAATAGATAAGGG - Intergenic
1060331601 9:122676325-122676347 ATAAATATGCAAAGAGTAAAGGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1203413481 Un_KI270589v1:21405-21427 TTGAATCTGCAAATTGACATTGG - Intergenic
1203684831 Un_KI270757v1:37807-37829 TTGAATCTGCAAATTGACATTGG + Intergenic
1186576955 X:10777021-10777043 ATACATATGGAAATAGCCAAAGG + Intronic
1186651885 X:11569925-11569947 GTGAAAATGCAAAAAGAGAAAGG + Intronic
1187027231 X:15448198-15448220 AGGAATGTGCAAATAAACAGTGG - Intronic
1187383078 X:18823037-18823059 AAGAATACCCATATAGACAATGG + Intronic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188256759 X:27971190-27971212 ATGAATATAGATATAGATAACGG - Intergenic
1188327624 X:28824914-28824936 ATGAATACACAAATACAGAAAGG - Intronic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189849205 X:45162266-45162288 ATGAATATGCAACTTGAGCAGGG - Intronic
1189941543 X:46128369-46128391 ATGAATAGGCAAAAATAAAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190397325 X:49998305-49998327 AGGAATATGCAAACAGGAAATGG - Intronic
1192284485 X:69720430-69720452 ATGAATATTCAAAAAAATAATGG - Intronic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192356884 X:70412457-70412479 ATGAATTTGTAAATGGCCAAAGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194093858 X:89611369-89611391 ATGAAGATCCAAAGATACAAGGG - Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194376972 X:93148693-93148715 ATTAATATGCAAATAGATAAAGG + Intergenic
1194498395 X:94647904-94647926 ATAAATATGCAATTAGAAATTGG - Intergenic
1194702589 X:97132680-97132702 ATGAATATACAAATATAATAGGG + Intronic
1194768854 X:97876004-97876026 AGGAATATGCAGAAACACAAGGG + Intergenic
1194826461 X:98570405-98570427 ATGAATCAGCAAATGGACCAAGG - Intergenic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1195530212 X:105945413-105945435 GTTATTATGCAAATAGACATTGG - Intronic
1195765696 X:108294573-108294595 ATGAAAATGAAAATAGACCATGG + Intronic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1195946778 X:110222650-110222672 AGGAATATGTAAAAAGAGAAAGG + Intronic
1196567769 X:117229228-117229250 ATGACTATTCAAAGATACAAAGG - Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1197055898 X:122118331-122118353 ATGAATATCCTAATAAATAATGG - Intergenic
1197539505 X:127739724-127739746 ATGAATATATAAATAAACAGTGG + Intergenic
1197599330 X:128508746-128508768 ATGAATATGCAAGAAGAAAGGGG - Intergenic
1198705324 X:139442776-139442798 ATATATAAGCAAATAGAGAATGG + Intergenic
1198944336 X:141993544-141993566 ATAAATATCCAAAAAAACAATGG + Intergenic
1199183242 X:144883348-144883370 AAAAATAGGCACATAGACAAAGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1200425389 Y:3014742-3014764 ATGAATAAGCAAATGAACAGAGG - Intergenic
1200446481 Y:3267502-3267524 ATGAAGATCCAAAGATACAAGGG - Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201666279 Y:16459743-16459765 ATCAATATGCAAATAAAATAGGG - Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic
1202059394 Y:20869956-20869978 ATGAATCTGCCAATATGCAAGGG - Intergenic