ID: 1124159419

View in Genome Browser
Species Human (GRCh38)
Location 15:27255102-27255124
Sequence CAGCCGCTGTCAGGCAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124159419_1124159425 11 Left 1124159419 15:27255102-27255124 CCAGGGCTGCCTGACAGCGGCTG 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1124159425 15:27255136-27255158 CTTCACTGTTGATGCCAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124159419 Original CRISPR CAGCCGCTGTCAGGCAGCCC TGG (reversed) Intronic
900900607 1:5513345-5513367 CAGCCGGCGCCAGACAGCCCAGG - Intergenic
901805667 1:11736873-11736895 CAGCCGCTGGCACCCAGACCCGG - Intronic
901924451 1:12557028-12557050 CATCCCCTGTCAGGAACCCCTGG - Intergenic
902677350 1:18018062-18018084 GATCCGCTGACAGGCAGCCCGGG - Intergenic
902690536 1:18107956-18107978 CCGCCGCGGCCAGGCAGCCCGGG - Exonic
903448145 1:23435683-23435705 CAGCTTCAGTCAGGCAGACCTGG - Intronic
903829496 1:26165983-26166005 AAGCCTCTGCCAGGCTGCCCAGG + Intergenic
904334223 1:29786546-29786568 CATTCCCTATCAGGCAGCCCAGG - Intergenic
904893609 1:33797798-33797820 CAGCCCCTTCCAGCCAGCCCTGG + Intronic
905651799 1:39661677-39661699 CAGGGGCTGTGAGGCACCCCTGG - Intronic
905912063 1:41662080-41662102 CCGCCGCGGCCTGGCAGCCCAGG - Intronic
906027052 1:42682679-42682701 CCGCCGATGTGAGGCCGCCCGGG - Exonic
909207060 1:72771658-72771680 CACAGGCTCTCAGGCAGCCCTGG - Intergenic
909567272 1:77067090-77067112 GAGCCACTGTCATGGAGCCCAGG - Intergenic
913122332 1:115753602-115753624 CAGCGGCAGTCACGCAGCACAGG - Intronic
913174633 1:116262722-116262744 CTGCCTCTGTCTTGCAGCCCAGG + Intergenic
913439795 1:118885279-118885301 TAGCCACTGTCACTCAGCCCTGG + Exonic
913958893 1:143324266-143324288 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
914053210 1:144149646-144149668 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
914125987 1:144816895-144816917 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
914200481 1:145480380-145480402 CAGTGGCTTTCAGGCAGCCCAGG - Intergenic
914479597 1:148053507-148053529 CAGTGGCTTTCAGTCAGCCCAGG - Intergenic
915555402 1:156658145-156658167 AAGTAGCTGTCAGGCTGCCCAGG - Exonic
919061048 1:192633346-192633368 CTGGCTCTGTCAGGCAGCCCAGG - Intergenic
919755015 1:201061241-201061263 CCACCTCTGGCAGGCAGCCCAGG + Intronic
920401432 1:205679161-205679183 CAGCTGCTGTCTTGCTGCCCTGG - Intronic
920821693 1:209387532-209387554 CAAACGCTGTGAGGCAGCCATGG + Intergenic
921010153 1:211133584-211133606 CAGCAGCTGTCACGCATCCTTGG + Intronic
922370649 1:224907377-224907399 CAGCTCCTGCCAGGCAGCCCTGG + Intronic
923137940 1:231134652-231134674 CAGCCTCAGCCAAGCAGCCCAGG - Intergenic
923713249 1:236403789-236403811 CAGCCTCTGTGAGCCAGGCCAGG + Intronic
924172365 1:241356401-241356423 CAGCCGGTGGCTGGCAGCGCAGG - Intronic
1065637552 10:27746026-27746048 GAGCCGCTGCCGGGGAGCCCCGG + Exonic
1066314987 10:34236353-34236375 TAGTCCCGGTCAGGCAGCCCTGG - Intronic
1066758797 10:38736353-38736375 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1066962843 10:42236415-42236437 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1069830104 10:71277713-71277735 AAGCAGGTGTCAGGGAGCCCTGG + Intronic
1071436401 10:85651736-85651758 CAGACTCTGGCAGGCAGCCTGGG - Intronic
1072555809 10:96513196-96513218 CACTCGCTGTCAGGCGGCCCTGG + Intronic
1073486162 10:103820407-103820429 CAGCCCCTGGCAGGCTGCCCTGG - Intronic
1074543741 10:114386659-114386681 CAGCAGCTGCCAGGAGGCCCAGG + Intronic
1075226727 10:120636128-120636150 CAGCAGTTGTCAGGGAGCCCAGG + Intergenic
1075693767 10:124418804-124418826 CCGCCGCTGTCAGGGAACCCCGG + Intronic
1075735849 10:124664204-124664226 CTGCTGGTGTCAGGCAGCCCTGG - Intronic
1076677013 10:132152331-132152353 GAGCTGGAGTCAGGCAGCCCTGG + Intronic
1076729636 10:132431957-132431979 CAGCCCCTGCCAGGCCCCCCAGG - Intergenic
1077031600 11:470541-470563 CAGCAGCTGTGTGGCAGCACTGG + Intronic
1077202425 11:1317721-1317743 CAGCAGCTGTCAGACTGGCCAGG - Intergenic
1079129301 11:17738191-17738213 CAGGAGCTGGTAGGCAGCCCAGG - Intronic
1080897050 11:36455729-36455751 CGGTCGCTGTCTGCCAGCCCCGG + Intronic
1081537889 11:44008454-44008476 CAGCCCCTGTGGGGCAGACCAGG - Intergenic
1081866548 11:46363508-46363530 CACACACTGCCAGGCAGCCCAGG - Intronic
1083855091 11:65389344-65389366 CAGCCGCTGTGATGGAGACCAGG - Exonic
1085446131 11:76602464-76602486 CAGCAGATGTCGGGCAGCCAGGG + Intergenic
1085765414 11:79277678-79277700 CTGCTGCTGTCAGGCAGACTTGG + Intronic
1085880665 11:80463420-80463442 CAGCAGGTGGCAGGAAGCCCAGG - Intergenic
1086103925 11:83129166-83129188 CAGGGGCTGACAGGAAGCCCGGG - Intergenic
1089627919 11:119763125-119763147 CAGACCCTGTGAGGCAGCTCTGG - Intergenic
1089691034 11:120186803-120186825 CTGTCTCTGTCAGGCAGGCCAGG - Intergenic
1090744574 11:129695924-129695946 CAGCAGCTCTCTGGCAACCCTGG + Intergenic
1091223717 11:133945744-133945766 CAGACTGAGTCAGGCAGCCCTGG - Intronic
1092489328 12:8930794-8930816 CTGCCTCTGTCTGGCTGCCCTGG - Exonic
1096464308 12:51839795-51839817 CAGCCCCTGTCTGTGAGCCCTGG + Intergenic
1096946464 12:55413743-55413765 CTGCCTCTGTCTGGCTGCCCTGG + Intergenic
1097487606 12:60225407-60225429 CAGCCTGTGGCAGGCAGCCTTGG + Intergenic
1099439767 12:82686573-82686595 CAGGCGCTGCCAGGCAGCAGCGG + Intergenic
1101421637 12:104555846-104555868 CAGCCGCACAAAGGCAGCCCTGG + Intronic
1101751254 12:107584392-107584414 CAGCTGCTGTGAGGCAGAGCAGG + Intronic
1102203623 12:111075184-111075206 CAGCTGCTGCCAGGCACCCCTGG + Intronic
1102262489 12:111452801-111452823 CAGCAGTTGTAAGGCTGCCCTGG - Exonic
1104612484 12:130241043-130241065 CAGGAGCTGTCAGGGAGCCATGG + Intergenic
1104819380 12:131665989-131666011 CAGACACAGTCAGGCAGACCTGG - Intergenic
1106264893 13:28100794-28100816 CCGCCGCAGTCGGGGAGCCCCGG - Intergenic
1106996321 13:35486606-35486628 CAGCCACAGTCAGACAGACCTGG - Intronic
1108495642 13:51022207-51022229 CAGCCTCTGTCTGGCCTCCCAGG + Intergenic
1109554547 13:63955161-63955183 CAGCAGCAGTCAGGCAACACTGG - Intergenic
1109667097 13:65553525-65553547 CATCTGCTTTCAGGCAGCCTTGG - Intergenic
1114455283 14:22849765-22849787 CAGCGCCTGGCCGGCAGCCCTGG - Intergenic
1114548925 14:23522359-23522381 GAGCTGCTGACAGGCAGCACTGG - Exonic
1115911960 14:38267116-38267138 CAGCTGTTGTAAGGCAGGCCTGG + Intergenic
1117814920 14:59587574-59587596 CAGCTCCTGTCAGGAGGCCCTGG + Intergenic
1117822059 14:59659708-59659730 GAGCTGTTGTCAGGCAGGCCTGG - Intronic
1118458355 14:65965447-65965469 CAGCTGCTCCAAGGCAGCCCTGG + Intronic
1118463881 14:66013666-66013688 CCGCCGATGTGAGGCCGCCCGGG + Intergenic
1121089460 14:91171062-91171084 CAGCCACTGGCAGGCACCCATGG + Intronic
1121405073 14:93714882-93714904 CAGCTGCAGTCAGGGACCCCTGG - Intergenic
1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG + Intergenic
1122534717 14:102454286-102454308 CAACCACTGCCAGGCAGCCTAGG - Intronic
1122651035 14:103227234-103227256 CAGCAGCTGAGAGGCTGCCCAGG - Intergenic
1202929518 14_KI270725v1_random:25924-25946 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1123422780 15:20145299-20145321 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1123442224 15:20301050-20301072 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1123532005 15:21151839-21151861 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1124135216 15:27029233-27029255 AAGCAGCTGGCACGCAGCCCTGG + Intronic
1124159419 15:27255102-27255124 CAGCCGCTGTCAGGCAGCCCTGG - Intronic
1125351461 15:38771610-38771632 CAGCCACTGTTAGGCAGAGCTGG - Intergenic
1125608897 15:40957819-40957841 CAGCAGGTGGCAGGGAGCCCTGG + Intergenic
1125721807 15:41848757-41848779 CAGCGCCTGTCAGTCAGCTCTGG - Intronic
1127390902 15:58504275-58504297 AGGCTGTTGTCAGGCAGCCCAGG + Intronic
1127900817 15:63339588-63339610 GAGCAGCTGTGAGGCTGCCCTGG + Intronic
1128731422 15:70024008-70024030 GAGCCGCTGAGGGGCAGCCCCGG - Intergenic
1129462260 15:75705247-75705269 CAGCGGCTGCCTGCCAGCCCAGG - Intronic
1129722600 15:77886601-77886623 CAGCGGCTGCCTGCCAGCCCAGG + Intergenic
1131270184 15:90942510-90942532 CAGCAGGTGGCAGGCAGCCAGGG - Exonic
1132314805 15:100881773-100881795 CAGCCGGTGTCAGGCAGTTGGGG - Intronic
1132590638 16:724926-724948 CAGTCGCTGCCCGGCTGCCCTGG + Exonic
1132687355 16:1167953-1167975 CGGCCGCCTCCAGGCAGCCCCGG - Intronic
1132701844 16:1225332-1225354 CACCTGCTGTCAGGCAGGGCGGG + Intergenic
1134178789 16:12030835-12030857 CTGCCGCTGCCTGTCAGCCCTGG - Intronic
1135305531 16:21364577-21364599 CTGCCGCTGCCTGTCAGCCCTGG - Intergenic
1136302272 16:29343730-29343752 CTGCCGCTGCCTGTCAGCCCTGG - Intergenic
1136686380 16:31997118-31997140 CCGACGCTGTAGGGCAGCCCTGG - Intergenic
1136718988 16:32304500-32304522 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1136724012 16:32342856-32342878 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1136772931 16:32857458-32857480 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1136786993 16:32940647-32940669 CAGACGCTGCAGGGCAGCCCTGG - Intergenic
1136837361 16:33510764-33510786 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1136842345 16:33548900-33548922 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1136861971 16:33710042-33710064 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1136897683 16:34004061-34004083 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1137403080 16:48169274-48169296 AATCCGCTATCAGGCAGCCTAGG + Intronic
1137495107 16:48963454-48963476 GAGCCCCTGACAGGCAGCCAAGG - Intergenic
1139270612 16:65679367-65679389 CAGCCTTTCTGAGGCAGCCCTGG + Intergenic
1140113193 16:72020989-72021011 CAGCCGGTGTCGGGCAGGTCAGG + Intronic
1141596657 16:85101083-85101105 CAGCTGCTGTGAGGAAGCCCAGG + Intronic
1142303787 16:89274433-89274455 CTGCTGCTCTCAGGCACCCCAGG - Intronic
1203002419 16_KI270728v1_random:174909-174931 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1203007443 16_KI270728v1_random:213271-213293 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1203075356 16_KI270728v1_random:1119568-1119590 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1203123459 16_KI270728v1_random:1558225-1558247 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1203134024 16_KI270728v1_random:1711315-1711337 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1203147541 16_KI270728v1_random:1811043-1811065 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1203152510 16_KI270728v1_random:1849197-1849219 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1143642140 17:8205181-8205203 CAGCAGCTGGCACGAAGCCCAGG + Intronic
1144631962 17:16878251-16878273 CAGTGCCTGCCAGGCAGCCCAGG - Intergenic
1145988360 17:29062577-29062599 CAGCAGTTGTAAGGGAGCCCGGG - Intergenic
1146009265 17:29180485-29180507 CTGGCGCTGCCAGGCAGGCCGGG - Intergenic
1146901875 17:36593930-36593952 GAGCCACTGAGAGGCAGCCCAGG - Intronic
1146952260 17:36915010-36915032 CAGCTGCTGAGAGGCAGCACTGG - Intergenic
1147048669 17:37774066-37774088 CAACTGGTGTCAGGCAGACCTGG + Intergenic
1147772627 17:42878372-42878394 CAGCCCATGACGGGCAGCCCTGG - Intergenic
1147958386 17:44150711-44150733 CTGCCCCCTTCAGGCAGCCCTGG + Intronic
1148644346 17:49210696-49210718 CAGCCTCTGTCTGGCTCCCCAGG - Exonic
1150327069 17:64265763-64265785 CAGCCTCTGTCATGTTGCCCAGG + Intergenic
1150338345 17:64345933-64345955 CAGCTGCTGACACTCAGCCCAGG + Intronic
1150648247 17:66993143-66993165 GAGCCACCGTCAGGCAGCCTTGG - Intronic
1151524977 17:74658915-74658937 GAGCCTCTGTAAGGCCGCCCAGG - Intergenic
1151658151 17:75505143-75505165 CAGCTGCGGTCCGGCAACCCTGG + Intronic
1151678610 17:75612744-75612766 CACCAGCTATCAGACAGCCCAGG - Intergenic
1152240748 17:79159669-79159691 CAGCTGCGGGCATGCAGCCCAGG - Intronic
1153829851 18:8912546-8912568 CAGCACCTGTCTGGCAGCCTGGG + Intergenic
1154123614 18:11671178-11671200 CAGGAGCTGTGGGGCAGCCCAGG - Intergenic
1159880599 18:73855178-73855200 CAGTAGCTGCCAGGCAGCCAGGG + Intergenic
1160226413 18:77014756-77014778 GAGCAGCTGTGAGGCATCCCGGG - Exonic
1160682207 19:417018-417040 CAGCCGCTGCCTCGGAGCCCTGG - Exonic
1160764457 19:801224-801246 CAGCAGCTGCCAGGTACCCCAGG - Intronic
1160843664 19:1157319-1157341 CAGCCTCTGCCACGCAGCCCCGG + Intronic
1165283003 19:34814150-34814172 CACCCTCTGTCATGTAGCCCAGG + Intergenic
1165827101 19:38711720-38711742 CAGGGGCAGGCAGGCAGCCCTGG - Intronic
1166702741 19:44891527-44891549 CCGCCGCTGGGAGGCAGCCTGGG + Exonic
1167002675 19:46755459-46755481 CACCCGCTGCCAGGCTGCCCTGG + Exonic
1167162812 19:47778871-47778893 GAGCCGGGGTCAGGGAGCCCCGG + Intronic
1202692608 1_KI270712v1_random:102069-102091 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
925254425 2:2470847-2470869 CAGGCGATCCCAGGCAGCCCTGG - Intergenic
926328242 2:11803757-11803779 CACCTGCAGTCAGGCAGCCTGGG + Intronic
927474732 2:23404015-23404037 CAGCCTCTGGCAGGCTGCCAAGG - Intronic
927868034 2:26605403-26605425 CAGCCACTTGCAGGTAGCCCAGG - Intronic
928103599 2:28453497-28453519 CAGGCCCTGTCAGGGAGCCCTGG - Intergenic
931078233 2:58740528-58740550 CAGCCTCTGACAGGAAACCCAGG - Intergenic
933770795 2:85742676-85742698 CAATCGCTGGCAGCCAGCCCGGG + Intergenic
933953796 2:87351902-87351924 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
934237999 2:90248149-90248171 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
934322127 2:91980698-91980720 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
934460411 2:94211484-94211506 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
935660257 2:105460685-105460707 CAGCTGCAGACGGGCAGCCCTGG - Intergenic
937293779 2:120797761-120797783 TGGTCGCTGCCAGGCAGCCCTGG + Intronic
938641834 2:133289368-133289390 CACCCTCTGTTTGGCAGCCCGGG + Intronic
938895177 2:135742267-135742289 CAGCCACGGGCCGGCAGCCCGGG - Intronic
941216057 2:162710717-162710739 CAGCTGCTAGCAGGCAGCTCTGG - Intronic
942498705 2:176565678-176565700 CAACAGCTGTCAGGGAGTCCAGG - Intergenic
946713645 2:222531508-222531530 CAGCAGCTGTCAGGGAGACAGGG + Intronic
947613140 2:231536202-231536224 CAGCCCCTGGCAGACAGCCCAGG + Intergenic
948657941 2:239488236-239488258 CTGCCTCTGTCTTGCAGCCCTGG + Intergenic
948804684 2:240448409-240448431 CAGTCCCTGCCAGGCAGTCCGGG + Intronic
949059660 2:241949538-241949560 CAGCCGCGGTCAGGGGGCCGTGG + Intergenic
1169196500 20:3685717-3685739 CAGGTGCTGTCAGGCGCCCCCGG - Intergenic
1170150422 20:13221474-13221496 CCGCCGCCGCCAGGCAGCGCCGG + Intergenic
1172095893 20:32460370-32460392 CAGCTCCGCTCAGGCAGCCCCGG + Intronic
1172206578 20:33166944-33166966 AACCCGGTGTCAGGCAGCCAGGG + Intronic
1172802948 20:37591123-37591145 GAGCGGCTGTCAGGCCTCCCTGG + Intergenic
1172947102 20:38697953-38697975 CAGCCGCAGTCAGACAGAGCAGG - Intergenic
1172995963 20:39070621-39070643 CATCCGCTTTCAGGAAGCGCTGG + Intergenic
1176591544 21:8654523-8654545 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1178633622 21:34283454-34283476 ATGCTGTTGTCAGGCAGCCCCGG + Intergenic
1179714218 21:43279588-43279610 CAGCCGCTGTCAGGAAGTACTGG - Intergenic
1179730040 21:43362550-43362572 CAGCCGCGCTCCGGGAGCCCTGG + Intergenic
1180274391 22:10631635-10631657 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1181355835 22:22295271-22295293 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1181888715 22:26042159-26042181 CACCAGGTGTCAGGCAGGCCTGG + Intergenic
1182487265 22:30646976-30646998 CAGCCCCCGACGGGCAGCCCAGG - Exonic
1183187961 22:36303255-36303277 CAGCCGCTGTCCTGCAGCAGGGG + Intronic
1184150060 22:42632567-42632589 CAACCTCTCCCAGGCAGCCCAGG + Intronic
1184890549 22:47376375-47376397 CAGCCCCTGCCCTGCAGCCCAGG + Intergenic
1185149459 22:49155688-49155710 CAGACGTTCTCAGGCAGTCCAGG + Intergenic
950232390 3:11287431-11287453 CAGCCGCTCTCAGGCCCCCATGG - Intronic
950772125 3:15320550-15320572 CATCCTTTGGCAGGCAGCCCAGG - Intronic
950851282 3:16064325-16064347 CAGCCGCTGTCTTCCAGCCTGGG + Intergenic
952901649 3:38115292-38115314 CAGCAGCTCTCAGGCAGGTCAGG - Intronic
954385494 3:50241817-50241839 CAACCGCTGACAAGCTGCCCAGG - Intronic
954802581 3:53195760-53195782 AAGCCGATGCCAGGCTGCCCTGG + Intergenic
958762822 3:98329001-98329023 CAGAGGCAGACAGGCAGCCCTGG - Intergenic
960379376 3:116940322-116940344 CCCCAGCAGTCAGGCAGCCCTGG + Intronic
961210348 3:125120606-125120628 CAACAGCTGCCAGGGAGCCCAGG + Exonic
961742170 3:129039757-129039779 CAACAGCTGGCAGGCAGCCAAGG - Exonic
967972050 3:195006277-195006299 CTACCGCTGACTGGCAGCCCCGG + Intergenic
968525681 4:1055523-1055545 CACCCTCTGTCCAGCAGCCCAGG + Intergenic
968549211 4:1213787-1213809 CCGCCGCTGTCAGGAGCCCCTGG - Intronic
969032781 4:4227346-4227368 CAGCCCCTGTCCGGGCGCCCCGG + Intergenic
969222427 4:5769970-5769992 CAGCAGCTGTCAGGGAGTGCTGG - Intronic
969289434 4:6229307-6229329 CATCCGCTGGCAGGCAGCGAAGG - Intergenic
969600300 4:8172102-8172124 CAGCTGCTGTGAGGGAGCCGTGG + Intergenic
969638638 4:8383677-8383699 CTGCTGCTGGCAGGCTGCCCAGG + Intronic
969648870 4:8451174-8451196 CAGCCTCAGTCAGCCAACCCCGG - Intronic
970295198 4:14622231-14622253 CTGCCTCTGCCATGCAGCCCTGG + Intergenic
970924958 4:21441050-21441072 CAGAAGATGACAGGCAGCCCTGG - Intronic
975565104 4:75745955-75745977 CAGCCGCTGTAACACAGGCCAGG + Intronic
981485460 4:145281373-145281395 CAGCCACTGGCAGGCAACACTGG + Intergenic
981547566 4:145909974-145909996 CAACCGCTGTCAGCGTGCCCAGG + Intronic
986329105 5:6704438-6704460 CAGGCCCTGCCAGGCAGCCCGGG - Intergenic
987572469 5:19682385-19682407 CAGCCCCTGTAAGGTAGCACTGG + Intronic
993087242 5:83378358-83378380 CAGCTCCTGCCAGGCAGTCCTGG - Intergenic
995524578 5:113040249-113040271 CAGCCCTTGTCACTCAGCCCTGG - Intronic
995716292 5:115084578-115084600 CAGCCTCTGACAGCCTGCCCAGG - Intergenic
997670655 5:135669243-135669265 CAGCCTCTGTCATGCATCCTGGG + Intergenic
997804828 5:136906599-136906621 CAGAGGCCCTCAGGCAGCCCTGG - Intergenic
998214755 5:140228761-140228783 CAGCGGGTGTCAGGCAGTCCTGG + Intronic
1000287999 5:159844481-159844503 CTCCTGCTGTCAGGCTGCCCTGG + Intergenic
1000598041 5:163238116-163238138 GAGCTCCTGTCAGGCAGGCCTGG - Intergenic
1002648452 5:180673985-180674007 GAGCCGCGGTCAGGCGGCCCAGG - Intergenic
1002853467 6:1017142-1017164 CAGCCGATGTGAGGTGGCCCAGG + Intergenic
1004143623 6:13044797-13044819 CAGCGGGTGTCAGTCAGGCCTGG - Intronic
1006116829 6:31780096-31780118 CAGCCTCTGTCAGGCGGCTGCGG + Exonic
1006169143 6:32083070-32083092 CAGCAGCTCTCATGCAGGCCAGG + Intronic
1006901978 6:37508499-37508521 CAGCCCCTGTCCCCCAGCCCAGG - Intergenic
1007108853 6:39301450-39301472 CAGCTCCTGCCAGGCAGCACAGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1008772124 6:54991943-54991965 CAGCAGCTGTCAGGCATGACAGG - Intergenic
1010943411 6:81946990-81947012 CAGCCTCTGTCAGGGAGCACAGG - Intergenic
1011669956 6:89673985-89674007 CAGCAGCTTTTAGACAGCCCTGG - Intronic
1015569234 6:134604549-134604571 CTGCGGCTGTGAGCCAGCCCCGG + Intergenic
1015626180 6:135182389-135182411 CCGCCGCTCGCAGGGAGCCCCGG - Intronic
1016111673 6:140232064-140232086 GAGCCTCTGTAAGGCAGGCCTGG - Intergenic
1018417683 6:163615317-163615339 CAGCCTATGTCAGCCAGCCTGGG - Intergenic
1018824499 6:167398940-167398962 CAGCCCCTCTGAGGCAGCCAGGG - Intergenic
1019409610 7:900796-900818 CAGCCCCTGTGTAGCAGCCCCGG - Intronic
1019477568 7:1251421-1251443 AAGACGCTGTCCGCCAGCCCAGG + Intergenic
1021202363 7:17741244-17741266 CAGCTGCTGCCAGGCTGCCCAGG - Intergenic
1021482028 7:21128763-21128785 CTGCTGCTGCCAGTCAGCCCAGG + Intergenic
1021769593 7:23985090-23985112 CTGCAGCAGTCAGGTAGCCCTGG + Intergenic
1024821394 7:53334778-53334800 CACCAGCTTCCAGGCAGCCCAGG + Intergenic
1025200904 7:56961067-56961089 CAGCCGTGTTCAGACAGCCCAGG - Intergenic
1025671039 7:63615865-63615887 CAGCCGTGTTCAGACAGCCCAGG + Intergenic
1026942235 7:74293804-74293826 AAGCCAGTGGCAGGCAGCCCTGG - Intronic
1029414838 7:100436193-100436215 CAGCCGCGGCACGGCAGCCCCGG - Exonic
1029930276 7:104363549-104363571 CAGCCACTGTCTGGCAGTGCTGG + Intronic
1034711814 7:153199168-153199190 CAGCGGGGGACAGGCAGCCCTGG + Intergenic
1034873619 7:154705668-154705690 CAGGGGCTGTCTGGGAGCCCTGG - Intronic
1034897000 7:154882544-154882566 CAGCCTTTGTCAGGCATCGCAGG + Intronic
1035179691 7:157080282-157080304 GAGCCGCTGATGGGCAGCCCTGG + Intergenic
1037765795 8:21771491-21771513 CAGGGCCTGTCAGGCAGCACTGG + Intronic
1040470473 8:47732038-47732060 CAGCAGCTGCCTGGCATCCCTGG + Intronic
1041321636 8:56619738-56619760 CAGCTGCTCTCAGGAAGCTCAGG + Intergenic
1042660537 8:71149731-71149753 TAGCCGCTGACAGGCTGCCATGG + Intergenic
1043401832 8:79891869-79891891 CAGCCGCCGGCAGGCCGCGCAGG - Intergenic
1044569370 8:93700450-93700472 CAGCCGCGCTCAGGCTGCCTCGG + Intronic
1045028996 8:98117364-98117386 CAGACGCTGTGAGGAATCCCCGG - Exonic
1049006304 8:139857746-139857768 CAGCTGTTGGCAGGCAGCCCAGG - Intronic
1049441969 8:142613717-142613739 CAGCCGCTGGCGAGCTGCCCGGG - Exonic
1049600508 8:143505306-143505328 CAGCCACATGCAGGCAGCCCTGG + Intronic
1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG + Intergenic
1053690909 9:40587181-40587203 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1054273895 9:63050310-63050332 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1054302169 9:63388152-63388174 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1054400945 9:64714658-64714680 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1054434553 9:65198972-65198994 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1054495837 9:65822709-65822731 CAGAGGCTGCCAGGCACCCCTGG - Intergenic
1054744798 9:68843618-68843640 ATCCCTCTGTCAGGCAGCCCCGG + Intronic
1056841231 9:89999549-89999571 GAGCCGCTGTCAGGCAGGGCAGG - Intergenic
1057213214 9:93212568-93212590 CAGCCACAGTCAGGCTGCCGAGG + Intronic
1057877321 9:98767926-98767948 CAGCCCTTCTCATGCAGCCCAGG + Intronic
1058876664 9:109250472-109250494 CAGCCGCTGGTAGGTAGGCCAGG - Intronic
1058991423 9:110257575-110257597 CAGCCGCTGACAGGCCCTCCTGG - Intergenic
1059496907 9:114717592-114717614 GAGCCTGTCTCAGGCAGCCCAGG - Intergenic
1061289950 9:129645026-129645048 CAGCCGCTCTCAGGCGACCCAGG + Intergenic
1061586915 9:131575460-131575482 CAGCTGCTGCCCCGCAGCCCTGG + Intergenic
1061934293 9:133848801-133848823 CAGCCGGTGCCAGGCTGCCATGG - Intronic
1062004938 9:134234331-134234353 CAGACGCTGGCAGGTGGCCCTGG + Intergenic
1062032482 9:134367920-134367942 CAGCTGCTGTCAGGCAGCTCTGG - Intronic
1062035131 9:134379593-134379615 CTGCGGCTGTCAGGGAGCACAGG - Intronic
1203621568 Un_KI270749v1:133287-133309 CAGAGGCTGCCAGGCACCCCTGG + Intergenic
1185473272 X:397830-397852 CAGCAGCTTTCAGGAAGCCTCGG + Intergenic
1185642731 X:1597502-1597524 CAGCCACTGTCAGGCCGAGCAGG + Intronic
1187221504 X:17331027-17331049 CATCAGCCATCAGGCAGCCCTGG + Intergenic
1187535871 X:20141499-20141521 CAGCCGCGGGCAGGCAGGGCGGG + Intronic
1192326125 X:70133777-70133799 GAGCCGCTGTTAGCCGGCCCTGG - Exonic
1192634478 X:72804694-72804716 CTGCCTCTGTAAGGCTGCCCAGG + Intronic
1192647234 X:72916107-72916129 CTGCCTCTGTAAGGCTGCCCAGG - Intronic
1195758657 X:108223758-108223780 CAGCCTCAGGCAGGCAGCCCTGG - Intronic
1196759280 X:119186872-119186894 CAGGGGCGGTCAGGCAGTCCAGG - Intergenic
1197935289 X:131734346-131734368 CAGCAGCTGCCAGGCGGTCCTGG + Intergenic
1197938322 X:131763149-131763171 CAGCAGCTGCCAGGCAGTCCTGG + Intergenic
1197939943 X:131778962-131778984 CAGCGGCTGCCAGGCGGCCCCGG + Intergenic
1199578861 X:149341539-149341561 CAGCAGCTTTCAGAGAGCCCTGG - Intergenic
1199862732 X:151816407-151816429 TAGCTGCTGCTAGGCAGCCCTGG + Intergenic