ID: 1124160338

View in Genome Browser
Species Human (GRCh38)
Location 15:27262518-27262540
Sequence CTCAATACTCAGATGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124160338_1124160345 29 Left 1124160338 15:27262518-27262540 CCCTACCCCATCTGAGTATTGAG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160338_1124160346 30 Left 1124160338 15:27262518-27262540 CCCTACCCCATCTGAGTATTGAG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124160338 Original CRISPR CTCAATACTCAGATGGGGTA GGG (reversed) Intronic
900311430 1:2035330-2035352 CTCACTCCTCGGATGGGGTCTGG - Intergenic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
904550149 1:31309600-31309622 CTCAAAACTCAGGCTGGGTATGG - Intronic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG + Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
917241693 1:172955705-172955727 CTGAATAGTCTGATGGGGTGGGG + Intergenic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
921331607 1:214044111-214044133 CTCAATACTCTCATTGGGTAGGG + Intergenic
923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG + Intronic
1064517178 10:16164024-16164046 CTCAATATTCATAAGGGGTATGG + Intergenic
1064960491 10:20958565-20958587 ATTAATATTCAGATGGGGTTTGG - Intronic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071779032 10:88822381-88822403 CTCAATACTCAAAGGGGGCTGGG + Exonic
1075053961 10:119204551-119204573 CACAATATCCAGATGAGGTAGGG - Intergenic
1076445020 10:130508579-130508601 CTCAATTCTCACGTGGGGGAAGG - Intergenic
1083313874 11:61802301-61802323 TTTAATACTCAGAGGGGGTTGGG - Exonic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG + Intergenic
1100867102 12:98868720-98868742 AGCAATAATCAGATGGGGTCAGG - Intronic
1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG + Intronic
1102344075 12:112147317-112147339 CTCAATACTCTGATTTGGTTTGG + Intronic
1102595671 12:113990864-113990886 CTAAATACACATATGGGGGAGGG + Intergenic
1103360807 12:120352553-120352575 CTCAATAATCTCATGGGGGAAGG - Intronic
1106419844 13:29577151-29577173 CTCAATGGTCGGATGGGGCAGGG + Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108792104 13:53982841-53982863 TTAAATACTGAGATGTGGTAAGG + Intergenic
1108893916 13:55298544-55298566 CTCAAAAGTCAGATAGGGAAGGG - Intergenic
1110270004 13:73578980-73579002 CTCCATATTCTGATGGGGAATGG - Intergenic
1112061698 13:95746863-95746885 CTGATTACTCAGCTGGGGTGAGG + Intronic
1114446866 14:22795357-22795379 AGCAATACTCAGATTGGGCACGG - Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG + Intergenic
1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG + Intergenic
1124743612 15:32319391-32319413 GTCAATACTCATATTAGGTAGGG - Intergenic
1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG + Intergenic
1130245618 15:82245643-82245665 GTCAAAACTGAGATGGGGTCAGG + Intronic
1130455078 15:84097738-84097760 GTCAAAACTGAGATGGGGTCAGG - Intergenic
1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG + Intronic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1144040119 17:11403238-11403260 CTCAAGACTCAGATTTGATAGGG + Intronic
1144140308 17:12341442-12341464 CTCAAGGCTCAGATGGGCTCTGG + Intergenic
1145763750 17:27443768-27443790 CTCCATGCTGAGATGGGATAAGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160947623 19:1651112-1651134 CTCCATTCTAAGATGGGGGATGG + Intronic
930517690 2:52429242-52429264 GTTAATACTGAGATGGGGTAGGG + Intergenic
931252655 2:60547760-60547782 CTCAATATTCAGCCTGGGTAGGG - Intronic
931575709 2:63716367-63716389 CGCAAAACTTAGCTGGGGTAGGG - Intronic
932340346 2:70959427-70959449 CTCAGTAAACAGATGGGATAGGG - Intronic
932614455 2:73223177-73223199 TTCAAGACTGGGATGGGGTAGGG + Intronic
932701495 2:73995361-73995383 CTCAGACCTCAGTTGGGGTAAGG + Intronic
936034353 2:109098873-109098895 CTCAAATCTCAGATGGGTTCAGG + Intergenic
940471492 2:154105781-154105803 CTCAATATTCACATGGGGCTAGG - Intronic
943726368 2:191255777-191255799 CTCAAAATGCAGAGGGGGTAGGG - Intronic
1170561567 20:17563085-17563107 CTCATCCCACAGATGGGGTAAGG - Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171355964 20:24545588-24545610 CTCAAGACTCAGCCGGGGGAGGG - Intronic
1175704875 20:61169178-61169200 CCCCATACTGAGGTGGGGTAGGG + Intergenic
1183751743 22:39724917-39724939 CTCAAGCCTCAGGTGGGGTGGGG - Intergenic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG + Exonic
953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG + Intergenic
961187635 3:124929750-124929772 ACCAATACTCAGAAGGGTTAAGG + Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
971529679 4:27670842-27670864 CCCAATACACAGATGAGGCATGG - Intergenic
978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG + Intergenic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
985855054 5:2417988-2418010 CCCCATACTCCCATGGGGTAAGG - Intergenic
986493490 5:8317905-8317927 CGTAATACTCTGATGGGGGAGGG - Intergenic
989575709 5:42986349-42986371 CTCAATCTACAGATGGGGTCTGG + Intergenic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
992367340 5:76106147-76106169 CTATCAACTCAGATGGGGTAGGG - Intronic
997700992 5:135899334-135899356 CTAAATAACCAGATGGGGAAAGG - Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1013099085 6:106973393-106973415 CTCAATTCTTTGATGGGGGAGGG - Intronic
1014286363 6:119503442-119503464 CTCAATTCCCACATGGGGAAAGG - Intergenic
1020246595 7:6434162-6434184 TTCCATACTGAGATGAGGTAAGG - Intronic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1021767157 7:23961543-23961565 ATCATTACTCAAATGGGGTCTGG - Intergenic
1022163292 7:27733147-27733169 CTCTGTACTAAGATAGGGTACGG + Intergenic
1028745531 7:94322026-94322048 CTCAATTCTGAGATAGGGAATGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1038933522 8:32221486-32221508 ATAAATAGTAAGATGGGGTAAGG + Intronic
1046502229 8:115093506-115093528 CTCACCACTTAGATGGGGCAGGG + Intergenic
1046569333 8:115943128-115943150 CTCAATAGTCAAGTGTGGTATGG - Intergenic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1052772500 9:32702748-32702770 CTCAAAACTCAGATTTGGAAAGG + Intergenic
1055768611 9:79692076-79692098 CTCAAAACTAACATGGGGGAGGG - Intronic
1060788862 9:126472068-126472090 CTCAATACACAGCAGGGGTGAGG - Intronic
1187505636 X:19876056-19876078 TTCAAAACCCAGATGGGTTAAGG + Intronic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1192786792 X:74344080-74344102 GTCATTACTCAGAAGGGGAAAGG - Intergenic
1194829805 X:98608505-98608527 CTAATTAATCATATGGGGTAGGG - Intergenic