ID: 1124160345

View in Genome Browser
Species Human (GRCh38)
Location 15:27262570-27262592
Sequence TCATTCTTACTCATTTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 274}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124160341_1124160345 24 Left 1124160341 15:27262523-27262545 CCCCATCTGAGTATTGAGGAAGC 0: 1
1: 0
2: 1
3: 19
4: 660
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160337_1124160345 30 Left 1124160337 15:27262517-27262539 CCCCTACCCCATCTGAGTATTGA 0: 1
1: 0
2: 0
3: 15
4: 347
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160339_1124160345 28 Left 1124160339 15:27262519-27262541 CCTACCCCATCTGAGTATTGAGG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160342_1124160345 23 Left 1124160342 15:27262524-27262546 CCCATCTGAGTATTGAGGAAGCT 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160344_1124160345 -9 Left 1124160344 15:27262556-27262578 CCGTCACATGTTTGTCATTCTTA 0: 1
1: 0
2: 1
3: 24
4: 310
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160338_1124160345 29 Left 1124160338 15:27262518-27262540 CCCTACCCCATCTGAGTATTGAG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274
1124160343_1124160345 22 Left 1124160343 15:27262525-27262547 CCATCTGAGTATTGAGGAAGCTC 0: 1
1: 0
2: 1
3: 19
4: 553
Right 1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG 0: 1
1: 0
2: 5
3: 18
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124160345 Original CRISPR TCATTCTTACTCATTTGAAG TGG Intronic
901958439 1:12805913-12805935 ACATTCTTACTCTTTTTATGGGG + Intergenic
904834660 1:33327524-33327546 TCAGTCTTACTCATTGTGAGAGG - Intronic
905953137 1:41969994-41970016 CCATTCTAACTCATGTGAAATGG - Intronic
906166877 1:43693161-43693183 ACATTCTTTCTTATTTGGAGTGG + Intronic
906327284 1:44854929-44854951 TCAGTCTTCCTCACATGAAGGGG - Intronic
906718179 1:47985871-47985893 TAACTCTTACTCCTTTGAATTGG - Intronic
906770848 1:48481099-48481121 TTATTCTTATTCATTTATAGTGG - Intergenic
906902592 1:49852314-49852336 GCTTTCTTACTCATTTGTATGGG - Intronic
906987546 1:50700974-50700996 TGATTTATATTCATTTGAAGTGG + Intronic
907205943 1:52771474-52771496 TCATTTTTAAACATTTCAAGTGG - Exonic
910419256 1:87039468-87039490 TCATTCCTATTCTTTTGCAGTGG - Intronic
910462537 1:87464029-87464051 TCATGCTTACTCAATTCAAAAGG + Intergenic
910973530 1:92881378-92881400 GCATTCTTAATCTTTTTAAGAGG + Intronic
911088240 1:93997594-93997616 TCATTCTTGCTCGTTTGTGGTGG - Intronic
911968639 1:104400589-104400611 ACATTCTTATTGATTTCAAGGGG - Intergenic
913170235 1:116225397-116225419 TCATTGTTAAAAATTTGAAGTGG - Intergenic
913183047 1:116341330-116341352 TGCTTCTTACTCATTTTCAGGGG - Intergenic
916503360 1:165406064-165406086 TCATACTTTCTCATTTTAACTGG + Intronic
917225398 1:172776141-172776163 ACATTCTTATTTATTTGACGTGG + Intergenic
917697375 1:177539859-177539881 CCATTCTGATTCATTTGAAATGG - Intergenic
918088707 1:181268380-181268402 TCCTCCTTACTCATTTTATGAGG - Intergenic
919394363 1:197025675-197025697 GCATTCTTACTCATGTGAGATGG + Intergenic
921566354 1:216725877-216725899 TCTTTATTACTCCTTTGAAATGG + Intronic
921714846 1:218407421-218407443 TAATTCTTACTTATTTAAATAGG + Intronic
922978811 1:229807176-229807198 TCATTCTTCCTCTTTTTATGAGG + Intergenic
924306854 1:242698407-242698429 TCATTCTTTCTCATCTGAAGAGG - Intergenic
1068369349 10:56093417-56093439 TCATTCTTTCGCATTTGCTGAGG + Intergenic
1068477055 10:57540612-57540634 GCATTCTTATTCATCTGAAAAGG + Intergenic
1071997970 10:91164698-91164720 TCAGTCTTACTAATGTGAGGTGG - Intronic
1073766362 10:106686981-106687003 CCCTTCTTACTCAAATGAAGTGG + Intronic
1075490243 10:122860714-122860736 TCATTCTAACACATCTGAAGTGG + Intronic
1078118721 11:8483127-8483149 TCATTATTACTCACTTGCTGAGG + Intronic
1078237120 11:9495800-9495822 TCATTGTTACTCATTTGTCATGG + Intronic
1080780137 11:35421565-35421587 TCATTCATGCTCATGTTAAGGGG - Intergenic
1082017096 11:47498141-47498163 CCTGTCTTACTCTTTTGAAGTGG - Intronic
1083074812 11:60025416-60025438 TCAGTCTTACTCATGTCAATAGG - Intergenic
1083110580 11:60402174-60402196 TCATTCTTATTTTTTTGGAGGGG - Intronic
1086354454 11:85980123-85980145 CCATTCATGCTCATTTGCAGAGG + Intronic
1087346995 11:96983926-96983948 TAATTTTTACTAATATGAAGTGG - Intergenic
1087732283 11:101792534-101792556 TCTTCCTTACTCATTTGAACTGG - Intronic
1087772280 11:102223441-102223463 TAATTTTTAGTCATTTGAAATGG + Intronic
1088747907 11:112819904-112819926 CCAATCATATTCATTTGAAGGGG + Intergenic
1092633655 12:10415217-10415239 TGATTTTTAATCATTTTAAGTGG - Intronic
1093476547 12:19561560-19561582 TCATTCTTGCTCCTTTAGAGTGG + Intronic
1093867086 12:24240602-24240624 TCTTTCTTACTGATTTGAGGAGG - Intergenic
1094790760 12:33912096-33912118 CCATTCTGACTCATGTGAAATGG + Intergenic
1095157137 12:38871274-38871296 TCATTATTAGTCATTTGCACTGG + Intronic
1098489256 12:71055897-71055919 TTATTTTTTCTAATTTGAAGAGG + Intronic
1099440335 12:82690892-82690914 GCATTCTTACGCATTTGTTGAGG + Intronic
1101010754 12:100446776-100446798 GCTTTGTAACTCATTTGAAGAGG + Intergenic
1101309786 12:103565655-103565677 TGATTCTTTCTCATCTGAATGGG - Intergenic
1102407615 12:112687376-112687398 TCCTCCTTCCTCCTTTGAAGTGG - Intronic
1104518602 12:129451919-129451941 TCATCCTTACTCACTGTAAGAGG - Intronic
1106297470 13:28429563-28429585 CAAGACTTACTCATTTGAAGAGG - Intronic
1108289777 13:48947651-48947673 TCATTCTCACTCATTTGATAGGG + Intergenic
1108949305 13:56068825-56068847 TAATTTTTACGCATTTTAAGGGG + Intergenic
1109563684 13:64082184-64082206 CGATTCTTACTGATGTGAAGTGG + Intergenic
1109864686 13:68247258-68247280 TCATTCTGACTGGTGTGAAGTGG + Intergenic
1109907361 13:68862449-68862471 TCTTTCTAACTCATTGTAAGAGG - Intergenic
1110045888 13:70829946-70829968 TTATTCTTACTGATGTTAAGTGG + Intergenic
1110148160 13:72219648-72219670 TCTTCCTTACTCATTTTATGAGG - Intergenic
1110178629 13:72588388-72588410 TCATACTTACTCATCTGAGAGGG + Intergenic
1110508062 13:76312890-76312912 TCATTCATACATATTTGAAAAGG - Intergenic
1110708400 13:78622466-78622488 TCATTCTTTCTCAGATTAAGTGG - Intronic
1111382471 13:87477253-87477275 TTATTGTTACTCATTTAAACTGG - Intergenic
1111500205 13:89108909-89108931 TTATTCTTAGCCAGTTGAAGTGG - Intergenic
1112834316 13:103495166-103495188 TCATATTTAGTCATTTCAAGTGG + Intergenic
1113521248 13:110942848-110942870 TCAGTCTTCCTCATATAAAGTGG + Intergenic
1114980958 14:28163531-28163553 GCATTCTTGCTAATTGGAAGTGG - Intergenic
1115467949 14:33736752-33736774 TCATTTTTACTGGTTTGGAGGGG + Intronic
1115878211 14:37885252-37885274 ACCTTCTAACTCATTTGATGGGG - Intronic
1116153597 14:41174256-41174278 TCAGACTTTCTGATTTGAAGGGG + Intergenic
1116505553 14:45674692-45674714 TTTTTCTTACTCATTCTAAGAGG - Intergenic
1116588158 14:46736366-46736388 CCATTCTGACTCATGTGAAATGG + Intergenic
1117234828 14:53761678-53761700 TCCTTCTTTCTCACTTGGAGAGG + Intergenic
1117395803 14:55308776-55308798 TCATTCTCAAGCATTTAAAGAGG - Intronic
1117629828 14:57679134-57679156 TCATTCTTTTGCATTTGCAGAGG - Intronic
1117855039 14:60021181-60021203 CCATTCTAATACATTTGAAGTGG + Intronic
1120351293 14:83362380-83362402 TAATTCATACTTATTTGAATGGG + Intergenic
1121206435 14:92172580-92172602 TCAATCTTAATAATTTGTAGTGG + Intergenic
1122699387 14:103577407-103577429 TCATGCTTACTCAGTTCATGGGG + Intronic
1124160345 15:27262570-27262592 TCATTCTTACTCATTTGAAGTGG + Intronic
1126980217 15:54233431-54233453 TCTTTCTTACACATTTGCAATGG + Intronic
1127077649 15:55343683-55343705 TGATTCTTACCTATTAGAAGGGG - Intronic
1128174942 15:65547003-65547025 TCATTCTTCCTCCTGTGAGGGGG + Intronic
1133528120 16:6626395-6626417 TCATTCTTCCTCCTTTGCTGTGG + Intronic
1135103298 16:19625403-19625425 ACATTCTTCCCCATTTTAAGAGG - Intronic
1137323739 16:47412154-47412176 TGATTCTTACTCATCTGAGAGGG - Intronic
1137327266 16:47453798-47453820 TCATTCTTACTAGCTTAAAGAGG - Intronic
1139055493 16:63178706-63178728 TAAATCTTACTCATTTTAAAGGG + Intergenic
1141519759 16:84570977-84570999 TCTTTCTTGGTCATTGGAAGAGG - Intronic
1143902469 17:10184446-10184468 TCATTCTTTCTCTTTAAAAGTGG - Intronic
1144164627 17:12597532-12597554 GGATTCTTACTGATTTTAAGTGG - Intergenic
1144546436 17:16200559-16200581 TCATTCTTGCTCATCTGAAGTGG - Intronic
1145051060 17:19661176-19661198 TCAATCTTCGTCATTTTAAGAGG + Exonic
1145299937 17:21626756-21626778 TCATTCTTGCTCATCTGAAGTGG + Intergenic
1145350345 17:22076509-22076531 TCATTCTTGCTCATCTGAAGTGG - Intergenic
1149135395 17:53358253-53358275 TTCTTCTTACTCTTTTGAAGTGG + Intergenic
1152509416 17:80775275-80775297 TCTTTCTTTCTCTTTTGAACAGG + Intronic
1153390307 18:4550227-4550249 TCATTTTTAATCATTGGAATGGG + Intergenic
1155063973 18:22253226-22253248 CCATCCTTACTAATTGGAAGGGG + Intergenic
1155878638 18:31117197-31117219 TCATTTTTATTAATTTGTAGTGG + Intergenic
1156393636 18:36676856-36676878 TTTTGCTTACTGATTTGAAGGGG + Intronic
1159013269 18:63079752-63079774 TCTTTCTTAATCTTTTAAAGTGG + Intergenic
1159787176 18:72727742-72727764 TCATTCCTTCTCATTTGAGTAGG - Intergenic
1163071926 19:14850481-14850503 ACATTCTTACTTTTTTGATGGGG + Intergenic
1163914218 19:20225451-20225473 CCATTCTGACTGATGTGAAGTGG - Intergenic
1164111798 19:22169926-22169948 TCATTCTTACTGGTGTGAAATGG + Intergenic
1164196325 19:22966093-22966115 TCATTCTTACTGGTGTGAAATGG + Intergenic
1164805930 19:31116791-31116813 CCATTCTTACTGATGTGAGGTGG - Intergenic
1164896883 19:31884574-31884596 GCATTCTTAAACATTTAAAGTGG - Intergenic
1165248021 19:34508878-34508900 TCATACTTACTTTTTTGAAAAGG - Exonic
1167988718 19:53339885-53339907 TCATTTTTATTTATTTGAGGTGG + Intronic
925121630 2:1422765-1422787 TTATTCGGAATCATTTGAAGTGG + Intronic
929352464 2:40974558-40974580 TCATTCTGAATAAATTGAAGTGG + Intergenic
931276469 2:60747904-60747926 ACATTCTGACACATTTTAAGAGG - Intergenic
932663396 2:73677185-73677207 TCATTCCAACTCATTTTATGAGG - Intergenic
933100879 2:78255331-78255353 TCATTCTGACTGCTGTGAAGTGG - Intergenic
933146956 2:78865395-78865417 TCATTCTGAGTCCTTGGAAGAGG - Intergenic
933192491 2:79350825-79350847 TCATTCTGACTAATGTGAAATGG + Intronic
933784981 2:85831853-85831875 TCAGACTGGCTCATTTGAAGTGG - Intergenic
933916349 2:86997847-86997869 TCAATTTTGCTCATTTGAATTGG + Intronic
934865522 2:97806734-97806756 AGATTCCTACTCATTTGAAGAGG + Intronic
935343849 2:102085086-102085108 TTTTTCTTACTGATTTGCAGTGG + Intronic
935770294 2:106412973-106412995 TCAATTTTGCTCATTTGAATTGG - Intronic
935909795 2:107882962-107882984 TCAATTTTGCTCATTTGAATTGG + Intronic
935967919 2:108499843-108499865 TCAATTTTGCTCATTTGAATTGG + Intronic
936131579 2:109848100-109848122 TCAATTTTGCTCATTTGAATTGG + Intronic
936213118 2:110523385-110523407 TCAATTTTGCTCATTTGAATTGG - Intronic
936422257 2:112377942-112377964 TCAATTTTGCTCATTTGAATTGG - Intronic
936787455 2:116111103-116111125 TCATACTTTTTCATTTTAAGTGG - Intergenic
939410735 2:141821319-141821341 TGTTTCTTACTCATTAGATGAGG - Intronic
939508119 2:143074322-143074344 TCAGTTTTACTCCTTTGGAGTGG - Intergenic
944319901 2:198327793-198327815 TGTTTCTTAGTCCTTTGAAGGGG + Intronic
944322501 2:198364495-198364517 TCTTTCTTGCTCCTTTGATGTGG - Intronic
945671801 2:212811010-212811032 TCATTCTTGGTCATTAGAAAAGG + Intergenic
1170726993 20:18938363-18938385 TCTCTCTTACTCATTTTATGAGG - Intergenic
1171507166 20:25646926-25646948 TCTTCCTTTCTCAGTTGAAGGGG + Intergenic
1171560602 20:26121516-26121538 CTATTCTTGCTCATCTGAAGTGG - Intergenic
1173740636 20:45398733-45398755 TCATTTTTACTCACTTTAAAAGG - Intronic
1174706066 20:52657364-52657386 TCATTCTTTATCCTTTGAAGAGG - Intergenic
1174906468 20:54557314-54557336 TAATGCCTAATCATTTGAAGTGG - Intronic
1176876322 21:14133141-14133163 TCTTTCTAACTCATTCTAAGAGG + Intronic
1177062244 21:16390393-16390415 TCATTCTTTCTGAATTGAATAGG - Intergenic
1177226075 21:18257982-18258004 TCATTTTAACTCTTCTGAAGAGG + Intronic
1177657368 21:24035753-24035775 TTATTCCTTCTCATTTGAATAGG - Intergenic
1180418441 22:12791541-12791563 TATTTATTACTGATTTGAAGAGG + Intergenic
1182840425 22:33385021-33385043 TCAGTCTTCCTGATTTCAAGAGG + Intronic
949541133 3:5032896-5032918 TCATTATTACCCATTTTAAAAGG - Intergenic
949661570 3:6284677-6284699 TGATTCTTTCTCATCTGAAAGGG - Intergenic
951030005 3:17870856-17870878 GCATGCTTACTAATTTTAAGAGG - Intronic
951382579 3:22002560-22002582 TCTTTCTAACTCATTTTATGAGG + Intronic
951438006 3:22687650-22687672 TCCTTCCTACTCATTTTATGAGG + Intergenic
951922160 3:27867941-27867963 ACCTTCTTTCTCATTTGTAGAGG + Intergenic
952170501 3:30801511-30801533 TCCTTCATATTCATTTGAAAAGG + Intronic
952245430 3:31584905-31584927 TCATTATTACTAATTGAAAGTGG + Intronic
952303829 3:32127821-32127843 TGATTCTTACTAGTTTCAAGGGG + Intronic
954161007 3:48722364-48722386 TCATTTTTATTCATTTCTAGGGG - Intronic
954514378 3:51159320-51159342 CCATTCTTAGTCATGTGAATGGG - Intronic
955740941 3:62091351-62091373 TCTTTCTTACTACTTTAAAGAGG + Intronic
957094974 3:75769794-75769816 TTTTCCTTACTCATTTTAAGCGG + Intronic
957912602 3:86640516-86640538 TCATTCTTTGTCATATGAAAGGG - Intergenic
959427716 3:106213277-106213299 TAATTTTTACTCATTTTTAGTGG + Intergenic
959648502 3:108728985-108729007 TCAAGCTCACTCATCTGAAGGGG + Intergenic
960023472 3:112982032-112982054 CCACTCTTTCTCATTTCAAGAGG + Intergenic
963826760 3:149964085-149964107 TCAGTCTGATTCATTTTAAGTGG - Intronic
964392145 3:156208845-156208867 TCATTCATACCTATTGGAAGTGG + Intronic
965093668 3:164194042-164194064 TGATTCTTTCTCATCTGAAAGGG - Intergenic
965277254 3:166701436-166701458 TCATTTTTAGTTATTTGAAAAGG - Intergenic
965566759 3:170127517-170127539 TCATTCTTACTGATCTTAATAGG - Intronic
966155452 3:176911276-176911298 TCATTCTTACTCATTTTTCATGG + Intergenic
966501171 3:180641880-180641902 TCGTTTTTACTCATTCGAAATGG - Intronic
967021685 3:185528294-185528316 TCTTTCTTCCTCATCTAAAGTGG - Intronic
969388984 4:6876642-6876664 ACATTCTTAATCATTTGGAATGG - Exonic
970219287 4:13793946-13793968 TCATTCTTAAGGATTTAAAGTGG - Intergenic
972945589 4:44250762-44250784 TTGTTCTTATTCATTTGCAGAGG + Intronic
973295040 4:48509246-48509268 TTTTTCTTACTGATTTGTAGGGG - Intronic
974571216 4:63651231-63651253 TGATTCTTACTTATTGAAAGGGG + Intergenic
974769959 4:66400172-66400194 TCATTCTTGCAGATTTGCAGAGG + Intergenic
976684176 4:87792633-87792655 TCATTCTTCTTCATTTAAACAGG - Intergenic
977001964 4:91515898-91515920 CCATTCTAACTCATTTGAGAAGG + Intronic
977060430 4:92252537-92252559 TCTTCCTTACTCATTTTATGAGG - Intergenic
978023691 4:103846267-103846289 TCATTCTTTTTCATTTGTTGAGG - Intergenic
978239997 4:106504012-106504034 TCATTCATCCTCATCTGAATAGG - Intergenic
978535216 4:109755067-109755089 TCTTTCTTACTGATTTGCAAGGG - Intronic
979223369 4:118255804-118255826 TTCTTTTTTCTCATTTGAAGAGG - Exonic
980616405 4:135231661-135231683 GCATTCTTACTCATTTCAAGTGG - Intergenic
981280072 4:142946869-142946891 TGATTCTTTCTTATCTGAAGGGG - Intergenic
981482244 4:145250883-145250905 TTATTCTCATTCTTTTGAAGAGG - Intergenic
981582756 4:146267016-146267038 ACATTCTTACTCATTTAATAGGG + Intronic
983131398 4:164023626-164023648 TGATTCTTTCTCATTTGAGAGGG - Intronic
984467427 4:180118726-180118748 TGGCTCTTACACATTTGAAGTGG + Intergenic
985767876 5:1789872-1789894 TCATCCCTTCTCGTTTGAAGTGG + Intergenic
986157862 5:5194591-5194613 ACAGCCTTTCTCATTTGAAGTGG - Intronic
986418515 5:7552866-7552888 TTATTATTACTCTTTTTAAGTGG + Intronic
986902049 5:12447865-12447887 TCATTCTGACTGATGTGAAATGG + Intergenic
987669426 5:20988046-20988068 TCATTCTTTTGCATTTGATGAGG - Intergenic
988209906 5:28190017-28190039 TAATTGTTTCTCATTTGAAGAGG + Intergenic
990120459 5:52444597-52444619 TCATACTTACTCATTTCTAGTGG + Intergenic
990661830 5:58023988-58024010 TCATTTTTAGTCAGGTGAAGTGG - Intergenic
991384991 5:66077210-66077232 TAATTTTTACTAATTTGAGGGGG + Intronic
992079928 5:73226727-73226749 TCATTCTGACTGATATGAGGTGG + Intergenic
992175162 5:74142722-74142744 TCAATCTTAGTAATTTGAATGGG - Intergenic
993359633 5:86958277-86958299 TCAGTATTACTCATATGAAGAGG + Intergenic
993786929 5:92151952-92151974 CCAGTCTTACTTATTTCAAGTGG - Intergenic
993846290 5:92947938-92947960 TCATTATACCTCAGTTGAAGTGG - Intergenic
994905306 5:105833704-105833726 TTATTCTTAGTCATTTGAATTGG - Intergenic
995648049 5:114335396-114335418 TAATACTTACTCCTTTGCAGAGG + Intergenic
995651333 5:114371803-114371825 TCTGACTTTCTCATTTGAAGAGG - Intronic
995832176 5:116365204-116365226 TCATTCTTATGCATTTGCATGGG - Intronic
996143660 5:119946790-119946812 TCATTCTAACTCATTCTATGAGG + Intergenic
996376595 5:122815215-122815237 TCATTTTTATTCATTTTATGTGG + Intronic
998410316 5:141905302-141905324 TCTTTCTTTCTCATTTTTAGGGG - Intergenic
998916585 5:147018921-147018943 TCATTCTAATTCATTTTAACTGG - Intronic
999612774 5:153388214-153388236 TGATTTTTATTGATTTGAAGTGG - Intergenic
999833899 5:155348607-155348629 TTTTTCTTACTGATTTGTAGGGG - Intergenic
1001163410 5:169341606-169341628 TAATGCTTCCTTATTTGAAGAGG - Intergenic
1002791921 6:443289-443311 ACATTCTTCCTCCATTGAAGTGG + Intergenic
1004764219 6:18706930-18706952 TCTTCCAAACTCATTTGAAGAGG - Intergenic
1007931866 6:45698906-45698928 CCATTTTTAATCACTTGAAGTGG - Intergenic
1009213048 6:60886221-60886243 CCATTCTTTCGCATTTGATGAGG - Intergenic
1010622416 6:78092583-78092605 TCTTTCTTCCCCATTTGGAGTGG - Intergenic
1010771285 6:79834481-79834503 TCATCCTTACTCATATGAGATGG - Intergenic
1010825137 6:80464130-80464152 TTATTATTATTCTTTTGAAGTGG + Intergenic
1011050272 6:83140035-83140057 TGATTCTTACTCTTTTGGAAGGG + Exonic
1011405649 6:87012797-87012819 TCATTATTCCTGATTTAAAGAGG + Intronic
1011443996 6:87418078-87418100 TCATTATTACTAATTTGATTGGG + Intronic
1012600318 6:101088695-101088717 TCTTTCCTACTCATTTTATGAGG - Intergenic
1014238227 6:118985329-118985351 TCATGGTTTCACATTTGAAGTGG - Intronic
1014643924 6:123950310-123950332 TCTCTCTAAGTCATTTGAAGAGG - Intronic
1014852640 6:126361019-126361041 TGATTCTTTCTCATCTGGAGGGG + Intergenic
1014903015 6:126990924-126990946 TCATTCTTACTGATTACATGTGG - Intergenic
1015601589 6:134916018-134916040 CCATACTCACTCACTTGAAGCGG + Intergenic
1016160392 6:140872118-140872140 TCATTCTGACTAGTATGAAGTGG + Intergenic
1016214873 6:141587016-141587038 TCACTCTTACTCTCTGGAAGTGG + Intergenic
1016624649 6:146152324-146152346 TCCTTCTTACTTTTCTGAAGAGG + Intronic
1019900684 7:4018495-4018517 TCTTGATTACTCATTTGAAAAGG + Intronic
1019905737 7:4062589-4062611 TCTTTCTAACTCATTTTATGAGG + Intronic
1020818268 7:12933394-12933416 TCAATCTTAAACAGTTGAAGAGG + Intergenic
1023114174 7:36844507-36844529 ACATTCATAATCATGTGAAGTGG - Intergenic
1023140536 7:37097577-37097599 TCTTTCTTTCTCTTTTGAGGTGG - Intronic
1025277239 7:57593870-57593892 TCGTTCTTGCTCATCTGAAGTGG + Intergenic
1025601655 7:63005112-63005134 ACTTTCTTACACATCTGAAGAGG + Intergenic
1027982361 7:85241867-85241889 TCATCTTTCCTCATTTAAAGTGG + Intergenic
1028755008 7:94424500-94424522 TCAATCTGTCACATTTGAAGTGG - Intronic
1030285382 7:107821320-107821342 TCATTCTTACACACTTCAATTGG - Intergenic
1030552056 7:110974067-110974089 TTATTTTTACTCAATTGTAGAGG - Intronic
1031086657 7:117308851-117308873 TTATTATTATTCATTTTAAGTGG + Intronic
1031390897 7:121213319-121213341 TCATTCTTATTCAATAGATGAGG - Intronic
1031949564 7:127878150-127878172 TCATTCTTCCTCATGGGAGGAGG - Intronic
1033433005 7:141306197-141306219 TCATTCTTTCTGATTTGATTGGG - Intronic
1037388762 8:18370273-18370295 CCATTCTAACTCATGTGAAATGG - Intergenic
1037791792 8:21950443-21950465 CAAATCTTACTCATTTGATGGGG - Intronic
1038974253 8:32674992-32675014 TCATGCTTACTTTTTTGCAGTGG - Intronic
1039641136 8:39224461-39224483 TCATTCTAACAGATGTGAAGTGG + Intronic
1040811864 8:51462192-51462214 TGATTCTTACTCATTTGAGAGGG - Intronic
1040831971 8:51687470-51687492 TCATTTTTACAAATTGGAAGTGG - Intronic
1040935701 8:52779601-52779623 TCATTCTGACTCATGTGAAATGG + Intergenic
1041322445 8:56627420-56627442 CCATTCTTAATCATTTGCATAGG + Intergenic
1042844946 8:73160452-73160474 AAATTCTTACTGATTTGAAAAGG - Intergenic
1043103439 8:76077965-76077987 ATATTCTTACTAATTAGAAGGGG - Intergenic
1043754299 8:83983317-83983339 TTTTTCTTACTGATTTGCAGAGG - Intergenic
1043770297 8:84190363-84190385 ACATTCTTGCACATCTGAAGAGG - Intronic
1043991321 8:86758917-86758939 TAATTATTACTCTTTTAAAGAGG + Intergenic
1045590780 8:103593911-103593933 TAATTTTTACTAATATGAAGGGG + Intronic
1046180977 8:110647204-110647226 CCATTCTGACTGATATGAAGTGG - Intergenic
1047743096 8:127822963-127822985 TCATTCTAACTGCTTTGAGGAGG + Intergenic
1050129886 9:2401089-2401111 TCATTCTTTTTCATTTGCTGAGG + Intergenic
1051155236 9:14135805-14135827 CCATACTTTCTCATTTGAAAAGG - Intronic
1051566901 9:18509861-18509883 GCTTTCTTACTCATTTGTAATGG + Intronic
1052101535 9:24452326-24452348 ACATTTTTACTCATTTTAATAGG + Intergenic
1052703255 9:31962924-31962946 TCATTCTTTCACATTTGTGGAGG - Intergenic
1054864780 9:69988916-69988938 ACCTTCTTAATCATTTTAAGGGG - Intergenic
1055215119 9:73850349-73850371 TCATGCTTACTATTTTGAAATGG + Intergenic
1056961594 9:91129611-91129633 ACATCCTTGCTCACTTGAAGTGG - Intergenic
1057563083 9:96144007-96144029 TCATTTTTCCTCATTTTAAAAGG + Intergenic
1058067829 9:100568446-100568468 TCATTGGTCCTCATTTAAAGAGG - Intronic
1058544486 9:106046027-106046049 TCATTCTAAGTCTTTTCAAGTGG + Intergenic
1061331140 9:129894202-129894224 TCATTCTGACCCATTTGTAGTGG + Intronic
1061526979 9:131173923-131173945 TAATTATTACTTATTTTAAGTGG - Intronic
1187360413 X:18621082-18621104 TTATTCTTATTTATTTGAAGAGG + Intronic
1190979326 X:55442091-55442113 TCATTCTTTCTCTTTAGGAGTGG - Intergenic
1191113747 X:56830754-56830776 TCATTCTTTCGCATTTGCTGAGG + Intergenic
1191171748 X:57454356-57454378 TCATTCTTTCTCATGTGTAAGGG - Intronic
1192054048 X:67755520-67755542 TAATGCTTACTCATTTCCAGAGG + Intergenic
1193622063 X:83765728-83765750 TCATTCTGACTGATGTGAAATGG + Intergenic
1195899544 X:109783026-109783048 TCATTTTTACTCATTAGATGAGG + Intergenic
1196080637 X:111627100-111627122 TCATTCTGACTCGTGTGAGGTGG - Intergenic
1196515383 X:116605327-116605349 TCATTCTTTCTCATCTGTATGGG + Intergenic
1197494275 X:127158154-127158176 TTATTCTAATTCATTTGTAGTGG - Intergenic
1198170839 X:134103714-134103736 TCATCCATCCTCATTAGAAGAGG + Intergenic
1198439421 X:136647813-136647835 TCAATCTTACTAATACGAAGCGG - Intergenic
1199271711 X:145891170-145891192 TCATTCTTCCTCATTTTATTTGG + Intergenic
1199835742 X:151588713-151588735 TCACTCTTCCACATCTGAAGAGG - Intronic
1200174318 X:154101886-154101908 CCATTCTAACTGAATTGAAGGGG - Intergenic
1202014592 Y:20387197-20387219 TCATTCTTACTAGTATGAAGTGG - Intergenic
1202061052 Y:20888612-20888634 TCATCCTAACTCATTTTATGAGG + Intergenic
1202064351 Y:20922353-20922375 CCACTCTAACTCATTTTAAGAGG - Intergenic