ID: 1124160346

View in Genome Browser
Species Human (GRCh38)
Location 15:27262571-27262593
Sequence CATTCTTACTCATTTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 15, 3: 12, 4: 226}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124160341_1124160346 25 Left 1124160341 15:27262523-27262545 CCCCATCTGAGTATTGAGGAAGC 0: 1
1: 0
2: 1
3: 19
4: 660
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226
1124160339_1124160346 29 Left 1124160339 15:27262519-27262541 CCTACCCCATCTGAGTATTGAGG 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226
1124160342_1124160346 24 Left 1124160342 15:27262524-27262546 CCCATCTGAGTATTGAGGAAGCT 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226
1124160344_1124160346 -8 Left 1124160344 15:27262556-27262578 CCGTCACATGTTTGTCATTCTTA 0: 1
1: 0
2: 1
3: 24
4: 310
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226
1124160343_1124160346 23 Left 1124160343 15:27262525-27262547 CCATCTGAGTATTGAGGAAGCTC 0: 1
1: 0
2: 1
3: 19
4: 553
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226
1124160338_1124160346 30 Left 1124160338 15:27262518-27262540 CCCTACCCCATCTGAGTATTGAG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG 0: 1
1: 0
2: 15
3: 12
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124160346 Original CRISPR CATTCTTACTCATTTGAAGT GGG Intronic
905619108 1:39426066-39426088 CTTTCTTACTCATTTGATTTTGG - Intronic
906770847 1:48481098-48481120 TATTCTTATTCATTTATAGTGGG - Intergenic
906891919 1:49725826-49725848 TATTCTTACTCCTTTGATTTTGG - Intronic
907248787 1:53124076-53124098 CATTCTAACTTATTGGAAATGGG - Intronic
907699334 1:56768079-56768101 AATTCTTATGCATTTGGAGTAGG - Intronic
909758253 1:79255239-79255261 CACTTTTACTCATTTGGATTTGG - Intergenic
910419255 1:87039467-87039489 CATTCCTATTCTTTTGCAGTGGG - Intronic
910538949 1:88332756-88332778 CATGCTGAATCATTTGAAATTGG - Intergenic
911646138 1:100338811-100338833 AATTCCTACACATTTGATGTTGG + Intergenic
911946820 1:104121436-104121458 CATTATTACTCATTTATAATGGG + Intergenic
912600679 1:110930157-110930179 CTTTCTTAGTCATTTCCAGTCGG + Intergenic
912941932 1:114052829-114052851 CATTCTTACTCCTTTGCATCAGG + Intergenic
913238576 1:116807041-116807063 CATTCATACTCTTTGGAAGTTGG - Intergenic
914371919 1:147033125-147033147 CATTGTTTCTCATTTGAACATGG + Intergenic
916336994 1:163684130-163684152 CATTCCTACTCAATGGAAGCTGG + Intergenic
916507891 1:165444442-165444464 CATTTTTTCTCATTACAAGTTGG + Intronic
917177336 1:172250903-172250925 TTTTCTTACTGTTTTGAAGTTGG - Intronic
919354798 1:196507736-196507758 AATTCTTACTAATTTGAGGAAGG - Intronic
919372289 1:196742925-196742947 CATTCTTCCTCCTTTTAACTTGG + Intronic
921194551 1:212742241-212742263 CAAGCTTACTCATTATAAGTAGG - Intronic
922223321 1:223625400-223625422 GACTCTTACTCACTTGAAGATGG - Intronic
922523076 1:226274333-226274355 CATTTTTTCTGATATGAAGTTGG + Intronic
922865601 1:228859041-228859063 CGTTCTTAGGCATTTGAACTTGG - Intergenic
923915124 1:238493069-238493091 CATTCTAAATCATATGAAATAGG + Intergenic
1063145558 10:3291986-3292008 CATTCTTCCTCTTTTGCAGCTGG - Intergenic
1063876130 10:10480672-10480694 CACTCTTAAGCATTTGAAGATGG + Intergenic
1067178348 10:43966319-43966341 CATGCTAACTCAATTGAAATAGG + Intergenic
1068590220 10:58845641-58845663 TATTCTTACTCATTTGGACGTGG - Intergenic
1071095251 10:81966347-81966369 CATTTTTACTCATTAGAAAAAGG - Intronic
1071931808 10:90480694-90480716 CCTTCTTACTCACTTCTAGTAGG + Intergenic
1071997969 10:91164697-91164719 CAGTCTTACTAATGTGAGGTGGG - Intronic
1072008330 10:91279191-91279213 CATTATTTCTCTTTTTAAGTTGG + Exonic
1074272455 10:111968089-111968111 CTTTCTTCCTCATTTGTATTTGG - Intergenic
1074287530 10:112112012-112112034 TATTCTGACTTATTTGAAATGGG - Intergenic
1074682997 10:115929101-115929123 CATTTTTACTCATTTCAACAAGG + Intronic
1078036364 11:7809660-7809682 CATTCTAACTGATTTGAGATGGG - Intergenic
1078645849 11:13140953-13140975 CACTCTTAGTCATTTGTGGTTGG - Intergenic
1080446608 11:32343860-32343882 CATCCTTACTCACTTGGACTTGG + Intergenic
1082899709 11:58234090-58234112 CATTGTTAATATTTTGAAGTAGG - Intergenic
1086354455 11:85980124-85980146 CATTCATGCTCATTTGCAGAGGG + Intronic
1087346994 11:96983925-96983947 AATTTTTACTAATATGAAGTGGG - Intergenic
1087383297 11:97436686-97436708 CATTTGTTCTCATTAGAAGTAGG - Intergenic
1089133430 11:116230532-116230554 GTTTCTTAATCAGTTGAAGTAGG - Intergenic
1091517842 12:1203060-1203082 CATTCTTACTCTTTTTGAGACGG + Intronic
1093867085 12:24240601-24240623 CTTTCTTACTGATTTGAGGAGGG - Intergenic
1094677805 12:32638026-32638048 TATTCTTTCTTAATTGAAGTAGG + Intronic
1096821325 12:54237500-54237522 AAGTCTTATTCATTTGATGTAGG - Exonic
1099361610 12:81708663-81708685 TATTCCTAATCATTTGAAGAAGG - Intronic
1102785437 12:115600461-115600483 CATGCTGTCTCATTTGAACTAGG - Intergenic
1103123518 12:118400600-118400622 AATTCTTACTGACTTCAAGTGGG + Intronic
1104549770 12:129745809-129745831 CATTTTTACTCTTTGCAAGTTGG - Intronic
1106297469 13:28429562-28429584 AAGACTTACTCATTTGAAGAGGG - Intronic
1107171799 13:37351429-37351451 CATAGTAACTCATTAGAAGTTGG - Intergenic
1109258214 13:60110042-60110064 CATTCATACTCATTTCACTTGGG - Intronic
1109864687 13:68247259-68247281 CATTCTGACTGGTGTGAAGTGGG + Intergenic
1110577732 13:77079307-77079329 CTTCCTTACAGATTTGAAGTAGG + Intronic
1110858491 13:80322457-80322479 CATATTAACTCACTTGAAGTGGG + Intergenic
1111382470 13:87477252-87477274 TATTGTTACTCATTTAAACTGGG - Intergenic
1111489762 13:88956563-88956585 CATTTTTACTCATTTATAATTGG + Intergenic
1111500204 13:89108908-89108930 TATTCTTAGCCAGTTGAAGTGGG - Intergenic
1111780998 13:92723650-92723672 CATCCTGACTGAGTTGAAGTTGG - Intronic
1112642074 13:101286567-101286589 CATTCTCTCTCATATAAAGTTGG - Intronic
1112834317 13:103495167-103495189 CATATTTAGTCATTTCAAGTGGG + Intergenic
1114057153 14:18980825-18980847 CATTCCTCCTCATTTGAAGTTGG + Intronic
1114105392 14:19420921-19420943 CATTCCTCCTCATTTGAAGTTGG - Intronic
1114954309 14:27797868-27797890 GATTCTTATTCAATTGAAATGGG - Intergenic
1115341839 14:32300794-32300816 CGATCTTACTAATTTGAAGGTGG + Intergenic
1115786076 14:36827402-36827424 CACTCTTACTCATGTGCATTAGG + Intronic
1115941672 14:38617480-38617502 CATTCATATTCATCTGAATTGGG + Intergenic
1120362158 14:83518512-83518534 CATTCTTAGGCCTTTGAACTTGG - Intergenic
1121206436 14:92172581-92172603 CAATCTTAATAATTTGTAGTGGG + Intergenic
1123498288 15:20853354-20853376 CATTCCTCCTCATTTGAAGTTGG - Intronic
1123555519 15:21426982-21427004 CATTCCTCCTCATTTGAAGTTGG - Intronic
1123591763 15:21864313-21864335 CATTCCTCCTCATTTGAAGTTGG - Intergenic
1124160346 15:27262571-27262593 CATTCTTACTCATTTGAAGTGGG + Intronic
1124862778 15:33459113-33459135 GATTCTCACTCATTTGGATTGGG + Intronic
1125036838 15:35135095-35135117 CATTTTTATTCATTTTATGTAGG - Intergenic
1127430955 15:58907779-58907801 AATTCTTACTCAGTTGATATAGG - Intronic
1127900602 15:63338359-63338381 CATTCTTGCTCATTTGGTGGTGG + Intronic
1202963863 15_KI270727v1_random:154192-154214 GATTCCTCCTCATTTGAAGTTGG - Intergenic
1138855158 16:60681809-60681831 CTTTCTTACTCACCTGAACTTGG + Intergenic
1138975835 16:62206742-62206764 CATTACTACTCATTTAAAGTTGG - Intergenic
1142270508 16:89086676-89086698 CATTCATACTCAGTTGGAGCTGG - Intergenic
1148886669 17:50778419-50778441 CATTCTTTATTATTTGCAGTGGG - Intergenic
1149062984 17:52446037-52446059 CATTCATCCTCATGTTAAGTTGG + Intergenic
1151003535 17:70406201-70406223 CATTCTCTGTCCTTTGAAGTGGG + Intergenic
1153569052 18:6450128-6450150 TAATCTTACTCATTTAAATTTGG - Intergenic
1153601672 18:6786914-6786936 CATTCATTCACAATTGAAGTTGG + Intronic
1154456295 18:14529780-14529802 CATTCCTCCTCATTTGAAGTTGG - Intronic
1155542416 18:26882247-26882269 CATTCTTACCACTTTGTAGTAGG + Intergenic
1156222533 18:35066946-35066968 CATTGTTATTAATTTGAAGTAGG + Intronic
1156549696 18:38002854-38002876 CATTCTGAGTCCTTTGAACTTGG + Intergenic
1159074779 18:63668031-63668053 GATTCTTACTCTTTTTAGGTGGG + Intronic
1159860866 18:73647764-73647786 AATTCTTACTGAATTGAACTGGG - Intergenic
1162187371 19:8916471-8916493 CATTTTTACTCAGATGAAGATGG - Intronic
1164896882 19:31884573-31884595 CATTCTTAAACATTTAAAGTGGG - Intergenic
926542698 2:14201013-14201035 CATTCTTACATATTTTTAGTTGG - Intergenic
928442950 2:31308245-31308267 AATTCTTACTGATTTAAGGTAGG + Intergenic
929352465 2:40974559-40974581 CATTCTGAATAAATTGAAGTGGG + Intergenic
929842871 2:45488644-45488666 CATTCTGAATATTTTGAAGTTGG - Intronic
930105695 2:47637685-47637707 CACTTTTACACATATGAAGTTGG - Intergenic
930412597 2:51045093-51045115 CACTCTTACTCAATTGATGATGG - Intergenic
931257664 2:60587546-60587568 CATTCTCACTTATTTGCTGTTGG - Intergenic
931276468 2:60747903-60747925 CATTCTGACACATTTTAAGAGGG - Intergenic
931860961 2:66353993-66354015 CATTCTTAAACATTTCAAGAAGG - Intergenic
933039133 2:77439248-77439270 CATTATAAATCATTTGAAATAGG - Intronic
933784980 2:85831852-85831874 CAGACTGGCTCATTTGAAGTGGG - Intergenic
933916350 2:86997848-86997870 CAATTTTGCTCATTTGAATTGGG + Intronic
934483000 2:94671421-94671443 GATTCTTATTCAATTGAAATGGG + Intergenic
935770293 2:106412972-106412994 CAATTTTGCTCATTTGAATTGGG - Intronic
935909796 2:107882963-107882985 CAATTTTGCTCATTTGAATTGGG + Intronic
935967920 2:108499844-108499866 CAATTTTGCTCATTTGAATTGGG + Intronic
936131580 2:109848101-109848123 CAATTTTGCTCATTTGAATTGGG + Intronic
936213117 2:110523384-110523406 CAATTTTGCTCATTTGAATTGGG - Intronic
936422256 2:112377941-112377963 CAATTTTGCTCATTTGAATTGGG - Intronic
936786195 2:116096321-116096343 CAATCTTACTAATATTAAGTGGG + Intergenic
938285156 2:130107307-130107329 CATTCCTCCTCATTTGAAGTTGG - Intronic
938335805 2:130495851-130495873 CATTCCTCCTCATTTGAAGTTGG - Intronic
938354019 2:130624813-130624835 CATTCCTCCTCATTTGAAGTTGG + Intronic
938430445 2:131231586-131231608 CATTCCTCCTCATTTGAAGTTGG + Intronic
938475269 2:131604770-131604792 CATTCCTCCTCATTTGAAGTTGG + Intergenic
939403768 2:141729987-141730009 CATTTTTATTTATTTGAGGTTGG + Intronic
940186686 2:150992986-150993008 TATTTTTACTCATTTCAATTTGG - Intergenic
942496972 2:176550002-176550024 CAGTCAGACTCCTTTGAAGTAGG - Intergenic
943139140 2:183957043-183957065 CTTTCTTACTACTTTGAATTTGG - Intergenic
943998937 2:194807511-194807533 CATTCCAACTCATTTACAGTTGG - Intergenic
944124239 2:196275406-196275428 TATTTTTATTCATTTGTAGTAGG + Intronic
944958856 2:204845234-204845256 TATTCTTGCTGACTTGAAGTAGG + Intronic
946813896 2:223555833-223555855 TATTCTCACTCCTTTGCAGTAGG - Intergenic
946857920 2:223971445-223971467 CGTTCTTCCTCAATTGAAGAAGG - Intergenic
946965839 2:225036996-225037018 CATTCTATCTTATTTGAAGGAGG - Intronic
1169794367 20:9445794-9445816 CATTCTTACTCTTTTTCTGTTGG - Intronic
1170745140 20:19092282-19092304 CCCTCTTACTCAATTGAAATTGG + Intergenic
1173058152 20:39636148-39636170 CATTCATAATCATTTGGAGAAGG - Intergenic
1174706065 20:52657363-52657385 CATTCTTTATCCTTTGAAGAGGG - Intergenic
1176817872 21:13623556-13623578 CATTCCTCCTCATTTGAAGTTGG + Intronic
1176968382 21:15237523-15237545 CATTCTTATTATTTTGAAATAGG - Intergenic
1178419483 21:32432136-32432158 CATTCTTATGCATTTGGGGTGGG + Intronic
1179362876 21:40728718-40728740 CATTCAGAATCATTTGTAGTGGG - Intronic
1180475642 22:15703437-15703459 CATTCCTCCTCATTTGAAGTTGG + Intronic
1183376131 22:37466525-37466547 CATTCCCACCTATTTGAAGTAGG - Intergenic
1184865634 22:47200496-47200518 CATTCTTCCTGCTTTGAAGCAGG - Intergenic
951131530 3:19051677-19051699 CAGTCTTTGTCATTAGAAGTGGG - Intergenic
953723609 3:45378251-45378273 AATTCTTCCTGATTTAAAGTAGG + Intergenic
955899795 3:63740324-63740346 GATTATTACTCAATTGAAGATGG + Intergenic
955912960 3:63876902-63876924 TATTCTTTTTCATTTGTAGTCGG + Intronic
956296913 3:67724955-67724977 AATTCTTGCTCATTTTAACTAGG + Intergenic
956399602 3:68862901-68862923 TATTCTTACTCATTTTAGCTGGG - Intronic
958682462 3:97349335-97349357 CATACTCACATATTTGAAGTTGG - Intronic
960166341 3:114406274-114406296 AATTCTTTATCATTTGAAATAGG + Intronic
963392066 3:144677538-144677560 CATTCTTATTCATTTTTAATAGG + Intergenic
963982387 3:151553369-151553391 CATTTTTATTTATTTTAAGTTGG + Intergenic
964186338 3:153949001-153949023 CCTTCTTTCTCATATGAATTAGG - Intergenic
965188285 3:165494446-165494468 CATTCTAACCCATTTGAATGAGG + Intergenic
967021684 3:185528293-185528315 CTTTCTTCCTCATCTAAAGTGGG - Intronic
969820302 4:9715039-9715061 TATTCTTATGCATTTGAGGTGGG + Intergenic
969835818 4:9840357-9840379 CATTCTTTCTCATTTTACCTTGG - Intronic
972010845 4:34179549-34179571 CAGTCTGAGTCATTTAAAGTGGG - Intergenic
972018167 4:34272678-34272700 CATTCTTCCCAATTTGAAGATGG + Intergenic
974659946 4:64874058-64874080 CATTCTAAGTCATTTGCACTTGG + Intergenic
974832957 4:67211614-67211636 CATTTTTTCCCATTTGGAGTAGG + Intergenic
975800296 4:78054576-78054598 CATGCTTCCTCATAGGAAGTTGG - Intergenic
976308772 4:83588991-83589013 CTTTCTTTCTCATTTGTAGAAGG + Intronic
977128826 4:93207271-93207293 CTTTGTTACTCAATTGAAGATGG - Intronic
977914903 4:102580550-102580572 CATTCTTACAATTTTCAAGTTGG - Exonic
977968382 4:103183463-103183485 CTTTCTGATTCACTTGAAGTGGG - Intronic
978943260 4:114463244-114463266 CTTTTTTCCTCATTTGAAATTGG - Intergenic
983125022 4:163940118-163940140 CACTCTTCCTCATTTGCAGATGG - Intronic
983587718 4:169374062-169374084 AAGTCTAATTCATTTGAAGTTGG - Intergenic
983893162 4:173052433-173052455 CTTTCTTTCACATTTGAAATTGG + Intergenic
984467428 4:180118727-180118749 GGCTCTTACACATTTGAAGTGGG + Intergenic
984549183 4:181140486-181140508 CATTTTTTCTCTTTTTAAGTAGG + Intergenic
984641539 4:182170399-182170421 CTTTCTTTCTCCTTAGAAGTTGG + Intronic
986418516 5:7552867-7552889 TATTATTACTCTTTTTAAGTGGG + Intronic
989990468 5:50758027-50758049 GAGTCTCACTGATTTGAAGTCGG - Intronic
990222107 5:53604036-53604058 CATTATTACTCATTTGTTGCTGG - Intronic
990369466 5:55102523-55102545 CATTCTCACTTATTTGGATTTGG + Intergenic
990667368 5:58088644-58088666 CATTCTTCCTCTTTTTATGTGGG + Intergenic
990772699 5:59267844-59267866 TATTCTTCCTCATGTGTAGTAGG + Intronic
991068622 5:62452339-62452361 AATTCTTTCTCATTTTAAGCTGG + Intronic
991341677 5:65617807-65617829 CATTCTTATTTATTTGAATCAGG + Intronic
991405464 5:66296925-66296947 CATTCTTATTCATTGCTAGTGGG - Intergenic
992573692 5:78088315-78088337 CATTCTTACTCATTTCTGGGTGG + Intronic
993800391 5:92326725-92326747 AATTCTTATTCATTAGAATTTGG + Intergenic
994912002 5:105922100-105922122 CTTTATTATTCACTTGAAGTAGG + Intergenic
998174670 5:139894438-139894460 TTTTCTTTCTCATTTGAACTTGG - Intronic
999199426 5:149805395-149805417 CTTTCTTACACATTAGAAGTAGG - Intronic
999583290 5:153063142-153063164 CATACTTCCTAATTTGAGGTGGG - Intergenic
1000559756 5:162771071-162771093 AATTCTTACTTATTTTAGGTTGG + Intergenic
1000605623 5:163324486-163324508 CATTGGTATTCATTTGAAGTAGG + Intergenic
1000767028 5:165304831-165304853 GATTCTCACTACTTTGAAGTAGG + Intergenic
1000983074 5:167837829-167837851 CGCTCTTACGCATTTGCAGTAGG + Intronic
1001326096 5:170726046-170726068 CATTCTTACAACTTTGGAGTAGG + Intronic
1004050726 6:12076293-12076315 CATGTTTATTGATTTGAAGTAGG + Intronic
1004958523 6:20757904-20757926 CATGCTTACTCATTCTCAGTGGG + Intronic
1007114375 6:39333086-39333108 CATTTTTAGTCATTTAAAGCAGG + Exonic
1007218528 6:40260385-40260407 GCTTCTTACTCATTTGAGGTAGG + Intergenic
1010421059 6:75675990-75676012 CCTCCTTATTCATTTGCAGTTGG - Exonic
1011549159 6:88513672-88513694 CATTCTTTCCCTTTTGGAGTAGG - Intergenic
1011733361 6:90289205-90289227 TTTTCTTCTTCATTTGAAGTTGG - Intronic
1012735303 6:102932114-102932136 CATTTTCACTCTTTTGAATTAGG - Intergenic
1013149879 6:107434518-107434540 TATTCTTACTCATTTGTGGGAGG + Intronic
1013374668 6:109502810-109502832 CATGCTCACTCATGTGATGTCGG - Intronic
1015601590 6:134916019-134916041 CATACTCACTCACTTGAAGCGGG + Intergenic
1016773416 6:147877406-147877428 CTTGCCTACTAATTTGAAGTCGG - Intergenic
1018658702 6:166065163-166065185 CATTCTTCCACCTTTGATGTTGG + Intergenic
1019041104 6:169106979-169107001 CCTTATCACTTATTTGAAGTAGG + Intergenic
1021607879 7:22427370-22427392 CATCCTGACTGATTGGAAGTGGG + Intronic
1021635498 7:22688542-22688564 CATTATTAATGATTTGCAGTAGG - Intergenic
1024819231 7:53307518-53307540 CATTGTTACTGTTTTGAGGTAGG + Intergenic
1025822866 7:64986298-64986320 CATTCTTTCTCCTTTAAATTTGG - Intronic
1026420277 7:70229407-70229429 CATTATTTCTGATTGGAAGTTGG + Intronic
1027854977 7:83499856-83499878 CAATGTTACTCATCAGAAGTGGG + Intronic
1027875143 7:83759482-83759504 CATTCTTACTCATTATTTGTGGG + Intergenic
1028532513 7:91852907-91852929 GATTCTTTCTCATCTGAAGGAGG - Intronic
1030285381 7:107821319-107821341 CATTCTTACACACTTCAATTGGG - Intergenic
1031140402 7:117936351-117936373 CTTTCTTACTAATTTGAAGTTGG + Intergenic
1031184559 7:118460159-118460181 CATTCTCTGTCATATGAAGTAGG + Intergenic
1033768227 7:144518744-144518766 CATACTAACTCATTTCACGTAGG + Intronic
1035733246 8:1867593-1867615 CATTCTTTCTCCCTTTAAGTTGG + Intronic
1036180857 8:6583916-6583938 CATTTTTACTACTTTCAAGTGGG + Intronic
1043198728 8:77335408-77335430 CATTCTGACTCAGCTGAACTAGG + Intergenic
1043273498 8:78363568-78363590 AATTTTTACTCTTTTTAAGTTGG - Intergenic
1043723794 8:83582748-83582770 CAAACTTATTCATTTCAAGTAGG + Intergenic
1044768484 8:95603575-95603597 AAATCTTACTCATGGGAAGTTGG + Intergenic
1050664530 9:7920535-7920557 TTTTGTTTCTCATTTGAAGTTGG - Intergenic
1050980114 9:11999808-11999830 TATTCTTACTTTTTTGATGTAGG - Intergenic
1051276322 9:15402422-15402444 CTTTCTTACTCATTTACATTTGG + Intergenic
1051566902 9:18509862-18509884 CTTTCTTACTCATTTGTAATGGG + Intronic
1052399535 9:27983330-27983352 AGTTCTCAATCATTTGAAGTAGG + Intronic
1052679877 9:31676626-31676648 CATTTTTACTTATTTCAGGTGGG - Intergenic
1053674833 9:40413302-40413324 GATTCTTATTCAGTTGAAATGGG - Intergenic
1053924625 9:43039663-43039685 GATTCTTATTCAGTTGAAATGGG - Intergenic
1054385937 9:64553369-64553391 GATTCTTATTCAGTTGAAATGGG - Intergenic
1054509787 9:65962991-65963013 GATTCTTATTCAGTTGAAATGGG + Intergenic
1055483742 9:76735945-76735967 CATTTGTTCTCATTTGAGGTTGG + Intronic
1056296106 9:85194507-85194529 AATTCTTCCTCTTTCGAAGTGGG - Intergenic
1056874211 9:90312354-90312376 CATTATTAATCATTTGGAGAAGG + Intergenic
1058544487 9:106046028-106046050 CATTCTAAGTCTTTTCAAGTGGG + Intergenic
1059044586 9:110852218-110852240 CATTCTTATTTGTTTGAAATTGG - Intergenic
1061331141 9:129894203-129894225 CATTCTGACCCATTTGTAGTGGG + Intronic
1061526978 9:131173922-131173944 AATTATTACTTATTTTAAGTGGG - Intronic
1062130502 9:134890092-134890114 CATTCTTAGTCATAGGAGGTTGG + Intergenic
1203529487 Un_GL000213v1:125945-125967 CATTCCTCCTCATTTGAAGTTGG - Intergenic
1186534642 X:10333812-10333834 CATTCTTCCTCATGTCAAGCAGG + Intergenic
1188128745 X:26403826-26403848 CAATCTTACTCACATGAAATGGG + Intergenic
1190979325 X:55442090-55442112 CATTCTTTCTCTTTAGGAGTGGG - Intergenic
1192753809 X:74024092-74024114 TATTCTCACTCATTTGTGGTAGG + Intergenic
1194475669 X:94357291-94357313 CATTTTTAATAATTTGTAGTAGG + Intergenic
1196174465 X:112625859-112625881 GATTCTGACTCAGTTGAACTGGG + Intergenic
1196569077 X:117244598-117244620 TATTCTTTCTCAGTAGAAGTTGG - Intergenic
1197383682 X:125777586-125777608 CATTCTTAGTCATATGAATTTGG + Intergenic
1199862611 X:151815432-151815454 GATTCTTAATAATTTGAAGAAGG + Intergenic
1201720193 Y:17088805-17088827 CATTCATACTGAATTAAAGTGGG - Intergenic