ID: 1124162262

View in Genome Browser
Species Human (GRCh38)
Location 15:27283191-27283213
Sequence TGCCAGCACCATGAAGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124162257_1124162262 -10 Left 1124162257 15:27283178-27283200 CCCACTTGGTCTCTGCCAGCACC 0: 1
1: 0
2: 0
3: 17
4: 269
Right 1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1124162254_1124162262 4 Left 1124162254 15:27283164-27283186 CCAAGTCCAAGATTCCCACTTGG 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1124162253_1124162262 23 Left 1124162253 15:27283145-27283167 CCTACTGCTGGATGGAGCTCCAA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 203
1124162256_1124162262 -2 Left 1124162256 15:27283170-27283192 CCAAGATTCCCACTTGGTCTCTG 0: 1
1: 0
2: 3
3: 29
4: 223
Right 1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG 0: 1
1: 0
2: 1
3: 13
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124162262 Original CRISPR TGCCAGCACCATGAAGGGGT TGG Intronic
900876575 1:5347124-5347146 TACCTGGACCATGAAGGGGTTGG + Intergenic
901822979 1:11842131-11842153 TGCCAGCTCCAGGAAGGGGCGGG - Exonic
902513285 1:16977403-16977425 GGCCAGCAACAGGAAGGGGCAGG - Intronic
902531939 1:17096222-17096244 AGCCAGAACAATGAAGTGGTAGG - Intronic
902624910 1:17670975-17670997 TGCTGAGACCATGAAGGGGTAGG - Intronic
902706106 1:18206025-18206047 TGTCAGCCCCATGAGGGGATGGG - Intronic
903221074 1:21870015-21870037 TTCCAGAACCATGAATGGCTTGG - Intronic
903370013 1:22829396-22829418 TGCCTGCAGCCTGATGGGGTCGG + Intronic
903419805 1:23210515-23210537 TGTCAGCATCATGAGGGAGTCGG - Intergenic
905356969 1:37391518-37391540 TGCCAACTCCCTGTAGGGGTGGG + Intergenic
907319032 1:53591264-53591286 TGCCAGCATCATGGAGGAGAGGG + Intronic
908252265 1:62274512-62274534 TGCCTTCACCCTGAAGGGGAGGG + Exonic
909606429 1:77513212-77513234 TGCCAGCACAAGGAAAGTGTGGG - Intronic
912324756 1:108746955-108746977 TGCCAGCACCAGGGATGGGCGGG + Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912707105 1:111923099-111923121 AACCAGCAAAATGAAGGGGTTGG + Intronic
914954689 1:152150855-152150877 TGCCAGTCCCAAGAATGGGTAGG + Intergenic
915165225 1:153944585-153944607 TGCCAGGACCATTAAGTGGGAGG - Intronic
916075434 1:161197710-161197732 TGCCATGGCCAGGAAGGGGTGGG + Intronic
916126180 1:161573497-161573519 GGCTTGCACCATGAAGGGTTAGG - Intergenic
916136098 1:161655337-161655359 GGCTTGCACCATGAAGGGTTAGG - Intronic
916378123 1:164178347-164178369 TGGCTGCACCCTGAAGGAGTTGG + Intergenic
917439387 1:175053653-175053675 TGCCAAAACCTTGAAGGGCTTGG + Intergenic
919983759 1:202658773-202658795 TGCCAGCACCCTGAATTGGGAGG - Intronic
920347659 1:205317127-205317149 TGCCAACACCCTGGAGAGGTAGG + Intronic
922894986 1:229092987-229093009 TGCCATCACCAAGTAAGGGTGGG + Intergenic
923777091 1:236989212-236989234 TGCAAGTTCCATGAATGGGTTGG + Intergenic
923920244 1:238555939-238555961 TGCCAGAAGAATGAAGAGGTGGG - Intergenic
924586852 1:245367689-245367711 TGGCAGAGCCATGAAGAGGTAGG + Intronic
1062923281 10:1296082-1296104 TGCCAGCACCATGACAGGAAGGG - Intronic
1063919399 10:10917127-10917149 TGCCAGTACCATAAACAGGTTGG + Intergenic
1065498535 10:26355049-26355071 TGCCATCATCATGAAGGCTTGGG - Intergenic
1067040973 10:42953077-42953099 TGCCATCACCATGTGGGGGAGGG + Intergenic
1067071024 10:43132130-43132152 TCCCAGCTCCCTGAAGAGGTGGG - Intergenic
1069321796 10:67180966-67180988 TGACAGCACCATGAGGAAGTAGG + Intronic
1069792212 10:71030012-71030034 TGCCATCCCCATGGGGGGGTGGG + Intergenic
1075631667 10:124004207-124004229 TGCCAGCAGCATGAGGAGGCCGG - Intergenic
1077049257 11:559405-559427 TACCAGCACCCAGAAGGGGTGGG + Intronic
1077116676 11:888324-888346 GGCCAGCACCAGGTGGGGGTTGG - Intronic
1077472790 11:2772088-2772110 TGGGAGCAGCATGGAGGGGTGGG + Intronic
1077609523 11:3635883-3635905 TGAGAGGACCAGGAAGGGGTGGG - Intergenic
1077975020 11:7238970-7238992 TGCCTGCACCCAGAAGTGGTGGG + Intronic
1080383135 11:31794761-31794783 TGCCAGCAACAGGAAGGAGGGGG - Exonic
1083935066 11:65865740-65865762 GGCCAGCACCATGAGGGGCCAGG - Intronic
1087828426 11:102792805-102792827 TGCCAGCAACAAGAAGGAGCTGG - Intronic
1089323460 11:117641859-117641881 TCTCAGCACCATGAAGGGCCTGG - Intronic
1091405217 12:204524-204546 TGGCGGCCCCATGAAGGGGAAGG + Intronic
1093201331 12:16190287-16190309 TACCAGCCCCATGCAAGGGTGGG + Intronic
1097817283 12:64089154-64089176 TGTCAGAACCATGAAGGAGGTGG - Intronic
1101931137 12:109015227-109015249 AGGCAGCAGCATGAATGGGTAGG + Intronic
1103906017 12:124327574-124327596 TGCCAGCACCAACATGGGGCTGG - Exonic
1104099678 12:125595187-125595209 TGGCAGCTCCATGAAGGGGGAGG + Intronic
1108455132 13:50605462-50605484 TGCCAGCAGCTTGAAGGGGAGGG + Intronic
1114213900 14:20641011-20641033 TGCCAGCACAATGAGGCCGTAGG + Exonic
1118329534 14:64804710-64804732 TGGGAGAAGCATGAAGGGGTGGG + Intronic
1119096145 14:71833526-71833548 TGTCATGACCATGTAGGGGTGGG - Intergenic
1119783575 14:77295946-77295968 ACCCAGCACCATGGAGAGGTGGG + Intronic
1120118991 14:80655276-80655298 TGGCAGCAACATGAAGAGATTGG - Intronic
1121183781 14:91948979-91949001 TACCAGCACCCAGAAGGGGCTGG - Intergenic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1122491137 14:102116867-102116889 TGCAAGCTCCATGCAGTGGTGGG + Intronic
1122930050 14:104928950-104928972 TTCCAGCACCAGGATGCGGTGGG - Intronic
1124025857 15:25964854-25964876 AGCCAGCCCCTTGAGGGGGTTGG - Intergenic
1124162262 15:27283191-27283213 TGCCAGCACCATGAAGGGGTTGG + Intronic
1124269518 15:28267940-28267962 TGCCAGCCCCATGGAGTGATGGG - Intronic
1125882787 15:43208539-43208561 TGCCAGGGCCATGCAGGGGGTGG + Intronic
1128316572 15:66662999-66663021 TGCCAGCACTCTGGTGGGGTCGG - Intronic
1128645376 15:69374881-69374903 TGACAGCACGATGCTGGGGTGGG + Intronic
1129905020 15:79180511-79180533 TGCCAGGGCCCTGAAGGGCTAGG - Intergenic
1130104850 15:80921600-80921622 GGCCAGCAGCATGGACGGGTGGG - Intronic
1131273354 15:90960183-90960205 TGCCTGCAGAATGTAGGGGTTGG + Intronic
1132736173 16:1387233-1387255 TGGCAGCACCATGCATGGCTGGG - Intronic
1132989116 16:2784098-2784120 TGGCAGCACCCTGAAGGAGCTGG - Exonic
1133102271 16:3486586-3486608 TGCCAGCACCGTCAAGGAGGGGG - Exonic
1133237212 16:4392866-4392888 AGCCAGCAGCTGGAAGGGGTGGG + Intronic
1133401480 16:5490557-5490579 GGCCAGCACCATGGAGGGCGGGG - Intergenic
1135077568 16:19407361-19407383 TCCCAGCCCCATGAGGGAGTGGG + Intergenic
1135539453 16:23318828-23318850 TGCCAGCATCATGGAGGATTTGG + Intronic
1135652597 16:24219061-24219083 TGCAAGGACCCTGAAGAGGTCGG + Exonic
1136142205 16:28294735-28294757 TGCCAGCAGCAGGTGGGGGTGGG - Intronic
1136265286 16:29113442-29113464 TGGCAGCAACATGAAGAGGAAGG - Intergenic
1136778233 16:32882716-32882738 GGCCAGCACCATGATGTAGTAGG + Intergenic
1136892387 16:33978798-33978820 GGCCAGCACCATGATGTAGTAGG - Intergenic
1138629123 16:58279565-58279587 TGCCTGCACCATCACGGGGCTGG + Intronic
1139140587 16:64257433-64257455 TGCTAGCACCAAGGTGGGGTGGG + Intergenic
1139650380 16:68359307-68359329 GGCCAGCCCCTTGGAGGGGTGGG + Exonic
1140034450 16:71361619-71361641 AGCCAGCATCCAGAAGGGGTGGG - Intronic
1140288134 16:73623780-73623802 TGCCACCACCAGGAAAGGTTTGG - Intergenic
1140546481 16:75814994-75815016 TGCAAGATCCTTGAAGGGGTGGG + Intergenic
1203080655 16_KI270728v1_random:1144825-1144847 GGCCAGCACCATGATGTAGTAGG + Intergenic
1143137373 17:4719409-4719431 TTCCAGCACCATGTGAGGGTGGG + Exonic
1143226132 17:5305400-5305422 GGTCAGAGCCATGAAGGGGTTGG + Intronic
1146551898 17:33787622-33787644 TCCCAGCAGCATGTAGGGGAGGG + Intronic
1146722570 17:35133389-35133411 TGACAGCACACTGAAGGTGTGGG - Exonic
1146937802 17:36823538-36823560 TGCCAGGCCCATGAGAGGGTTGG + Intergenic
1147773645 17:42885061-42885083 TCCCATCACCATGATGTGGTGGG - Intergenic
1149205096 17:54234751-54234773 TACCATCACCTTGAGGGGGTAGG - Intergenic
1152124451 17:78437980-78438002 TGCCAGCACCAGGCAAGTGTGGG - Intronic
1152338173 17:79709713-79709735 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338200 17:79709800-79709822 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338241 17:79709931-79709953 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338256 17:79709975-79709997 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338285 17:79710063-79710085 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1152338328 17:79710194-79710216 TGCCAGCATCAGGGAGGGGAGGG - Intergenic
1153467713 18:5407738-5407760 TGCCAGCATCAAGAAAGAGTGGG + Intronic
1153497812 18:5717899-5717921 ATCCAGCACCAGGAAGGTGTTGG + Intergenic
1154326089 18:13391355-13391377 TGAAAGTACCATGAAGGGGGTGG + Intronic
1154990959 18:21598377-21598399 TGCCAGCACCTTGTATGGGACGG + Intronic
1161474344 19:4475772-4475794 TGTCATCACCATGAATGGGGTGG - Intronic
1161769507 19:6223639-6223661 TGCCAGCACCATGGCTGAGTTGG + Intronic
1162611541 19:11758689-11758711 TTCCAGCACTTTGAAAGGGTGGG - Intergenic
1165976573 19:39681611-39681633 TGGCAGCACCATGCAGGTGCAGG + Intergenic
1166013185 19:39959220-39959242 AACCACCTCCATGAAGGGGTAGG + Intergenic
1166101912 19:40576297-40576319 AGCCAGAAGCATGCAGGGGTGGG - Exonic
927930894 2:27043418-27043440 TGCCACCACCATAAAGAGGGCGG + Intronic
931458013 2:62427097-62427119 TGCCAGCACCATGTAGAGCCAGG - Intergenic
933811160 2:86033554-86033576 GGCCAGCACCAGGATGGGGCTGG + Intronic
936462622 2:112723868-112723890 TGCAAGCAACAGGGAGGGGTGGG + Intronic
940995250 2:160142622-160142644 TGCTAGCACCGTGCTGGGGTTGG + Intronic
944860526 2:203811721-203811743 TGCCCGCACCAGGAAGTGGGTGG + Intergenic
946537897 2:220651211-220651233 TGTCAGCACCAGGTAGGGGGAGG + Intergenic
948542760 2:238702107-238702129 CGCCAGGGCCATGAATGGGTTGG - Intergenic
1168937168 20:1675209-1675231 CCTCAGCACCAAGAAGGGGTGGG + Intergenic
1169117088 20:3072674-3072696 TGCCACCACCCTGGAGGGGCTGG + Intergenic
1171426648 20:25052709-25052731 TGGCACCAACATGAAGTGGTTGG - Intronic
1172979495 20:38930158-38930180 AGCGAGGACCATGAAGGTGTAGG + Intronic
1173530640 20:43766827-43766849 AGGCAGCACGATGCAGGGGTGGG - Intergenic
1173592846 20:44238821-44238843 AGGCAGCAACATGATGGGGTGGG + Intergenic
1178403237 21:32305086-32305108 CCCCAGCCTCATGAAGGGGTAGG + Intronic
1180839419 22:18952214-18952236 TGCCAGCAACCTGCAGGGGTGGG + Intergenic
1181001799 22:19991218-19991240 TGCCAGGGCCAAGAAAGGGTGGG + Intronic
1181062481 22:20288270-20288292 TGCCAGCAACCTGCAGGGGTGGG - Intergenic
1181299761 22:21871264-21871286 TGACAACACTTTGAAGGGGTAGG + Intergenic
1182321515 22:29480956-29480978 CGCCACCACCAGGAAGAGGTGGG + Exonic
1183388029 22:37526230-37526252 TGCCAGCAACTTAAAGTGGTTGG - Intergenic
1184905909 22:47486621-47486643 AGCAAGCACCATGGTGGGGTGGG - Intronic
949439220 3:4062473-4062495 TCCCAGCATCAGGAAGTGGTTGG + Intronic
950181239 3:10914931-10914953 TGTCAGCACCATGAGGACGTGGG + Intronic
950304391 3:11907053-11907075 TTCCAGGGCCATGCAGGGGTAGG - Intergenic
951358518 3:21698292-21698314 TTACAGCACCATGATGGGGCTGG + Intronic
951707351 3:25556734-25556756 AGCCAGCACCCCGAAGGGCTGGG + Intronic
956772909 3:72541665-72541687 TGCCAGCAGCCTGAGGGGGCTGG - Intergenic
960439623 3:117670859-117670881 TCCCAGCAACATGATGAGGTAGG - Intergenic
961683806 3:128616441-128616463 TGGGGGCACCATGAAGGGGTTGG + Intergenic
962655711 3:137542374-137542396 TGCCAGCACAGTGCAGGGGATGG + Intergenic
964791924 3:160460615-160460637 TGCCTGCTCCATGGAGGGGGAGG + Intronic
964870973 3:161313521-161313543 TGCCTGCATCATGAAGGTGGTGG - Intergenic
966988645 3:185205902-185205924 TGCAAGCACCAAGAAGGGATAGG + Intronic
968308030 3:197662364-197662386 TGCCAGCAGCTTGGAGGGGCAGG - Intergenic
968706425 4:2080456-2080478 TGGCAGCAACAGGTAGGGGTGGG + Intronic
968706442 4:2080516-2080538 TGGCAGCAACAGGTAGGGGTGGG + Intronic
968706459 4:2080576-2080598 TGGCAGCAACAGGCAGGGGTGGG + Intronic
969344400 4:6562271-6562293 TGTCAGCAACATGGAGGGGACGG - Intronic
970667369 4:18353490-18353512 TGCCACCACTATGAATGTGTTGG + Intergenic
974193638 4:58540570-58540592 TGCCAGGACCATGACGGGGAGGG + Intergenic
974543930 4:63275665-63275687 TGGCAGCAGCATGACGGGGGTGG - Intergenic
979036690 4:115728865-115728887 AGCCAGCACCATAAGGGGTTTGG + Intergenic
983894481 4:173067728-173067750 TGCCAGCACCAGGCAGGGCCTGG - Intergenic
985745009 5:1641507-1641529 TGCCAGCAGCTTGGAGGGGCAGG - Intergenic
985924834 5:3007592-3007614 TGCCAGCACCATGAAGAACCTGG + Intergenic
985972003 5:3385601-3385623 TGCTGCCACCATGAAGGGCTCGG + Intergenic
988295039 5:29347046-29347068 TGGCATCACCATGGATGGGTGGG - Intergenic
988622187 5:32834366-32834388 TACAAACACCATGAAGGTGTTGG - Intergenic
990297422 5:54416652-54416674 CACCAGCAACATGATGGGGTAGG - Intergenic
995491935 5:112702851-112702873 TAAAAGTACCATGAAGGGGTAGG - Intergenic
999780963 5:154850024-154850046 TGCCATCACCAGGAAGGTATGGG - Intronic
1000736190 5:164903455-164903477 TGCCAACAACCTGAAGGGCTTGG - Intergenic
1001742858 5:174068158-174068180 TCCCAGATCCATGAAGGGATTGG - Intronic
1003989935 6:11476249-11476271 TGCAAGCACCCTGAAGTGGAAGG + Intergenic
1004405510 6:15329350-15329372 TGCTAGCAGCAAGCAGGGGTAGG + Intronic
1006630008 6:35424240-35424262 TGCCTGCACCATGAAGTTGAGGG - Intronic
1007412872 6:41674922-41674944 TGCCAGCAAGATAAAAGGGTGGG + Intergenic
1010285658 6:74074627-74074649 AGACAGCACCAATAAGGGGTGGG - Intergenic
1011606205 6:89108514-89108536 TGATAGCACCATGAAGCAGTAGG - Intronic
1015340142 6:132089798-132089820 TGCCATCACACTGAGGGGGTGGG - Intergenic
1017501112 6:155023873-155023895 TGCCTGCAAGATGAAGGGATTGG + Intronic
1019525036 7:1477043-1477065 CTCCAGCACCATGACGGGGCCGG - Intronic
1019615269 7:1956588-1956610 TGCCAGGGCCTTGGAGGGGTGGG - Intronic
1020807550 7:12808873-12808895 TCCCATCACCATCAATGGGTTGG - Intergenic
1020956943 7:14751593-14751615 TGCTAGCACCATGCAGTTGTAGG + Intronic
1022886675 7:34653852-34653874 TGCCTGCATCATGAAGGTATTGG - Intergenic
1023478383 7:40605711-40605733 TAACAACACTATGAAGGGGTAGG + Intronic
1025022073 7:55488096-55488118 TGCCAGCATCCTGATGGGGAAGG + Intronic
1027035576 7:74922789-74922811 AGCCAGCCCCATGGAGGGGAAGG + Intergenic
1027438019 7:78186882-78186904 TGACAGAACCATGAAGGAATAGG - Intronic
1028517819 7:91697817-91697839 TGGAAGCACCATGAAGGAGTAGG - Intronic
1029394482 7:100298348-100298370 AGCCAGCCCCATGGAGGGGAAGG - Intergenic
1030020641 7:105272145-105272167 TGGAAGAACCATGAAGTGGTGGG - Intronic
1031163383 7:118196580-118196602 TGCCAAAACCAAGAAGAGGTCGG - Intergenic
1033598781 7:142874629-142874651 CACCAGCACCATGAAGGCATAGG + Exonic
1035274394 7:157738792-157738814 TTCTAGTTCCATGAAGGGGTAGG + Intronic
1037676566 8:21056170-21056192 TAGCAGCTCCATGAAGGGGCAGG - Intergenic
1038615050 8:29085991-29086013 TACCAGCACCAAGGAGGGGAAGG - Intronic
1039770311 8:40679800-40679822 TGCTGGCACCATGAAGAGTTAGG - Intronic
1043968624 8:86506620-86506642 TGTAAGCACCAAGAAGGGGAAGG - Intronic
1046818888 8:118615308-118615330 TGCAAGCACCATGACGTGGGAGG - Intronic
1047193681 8:122701536-122701558 GGGAAGCACCATGAAGGAGTTGG + Intergenic
1048202806 8:132390747-132390769 TGCCAACACCATGAAGGGTTTGG + Intronic
1048374697 8:133812911-133812933 TGCCACCTTCATGGAGGGGTGGG + Intergenic
1049394810 8:142395058-142395080 TGCCAGGAGCAGGAAGTGGTGGG - Intronic
1049663881 8:143834402-143834424 TGCCAGCAGCCTGAAGGAGCAGG + Exonic
1049719503 8:144109106-144109128 GGACAGCACCGTGAAGGTGTGGG + Exonic
1049777847 8:144414695-144414717 TGCCAGCACAATGTCGGCGTGGG + Intronic
1050800135 9:9600617-9600639 TGCCAGCTCCATGTAGGGGAGGG - Intronic
1057162007 9:92895487-92895509 TGACAGGGCCATGATGGGGTGGG + Intergenic
1058585586 9:106503187-106503209 TGTCAGCCCCATGAAGGCGAGGG + Intergenic
1061022209 9:128023204-128023226 AGTCAGCAGCAGGAAGGGGTAGG - Intergenic
1061368815 9:130186595-130186617 CCCCAGCCCCAGGAAGGGGTGGG + Intronic
1061369102 9:130187907-130187929 CCCCAGCCCCAGGAAGGGGTGGG - Intronic
1187290279 X:17946617-17946639 TGCCAGCACCTTGCAAGGGGAGG + Intergenic
1190359549 X:49636100-49636122 GGCCAGCACAATGAAGGACTTGG + Intergenic
1190832537 X:54072244-54072266 TGCCCACACCATGAAAGGGTGGG - Exonic
1192231394 X:69267552-69267574 TACCTGTACCATGAAGAGGTTGG - Intergenic
1192231623 X:69269345-69269367 TACCTGTACCATGAAGAGGTTGG + Intergenic
1199608841 X:149596947-149596969 TGCCAGCAACAAGAAGGCTTTGG - Exonic
1199630281 X:149772413-149772435 TGCCAGCAACAAGAAGGCTTTGG + Intergenic
1200101602 X:153691346-153691368 GGCCAGCACCATGATGTAGTAGG - Exonic
1200838549 Y:7756406-7756428 TGCCAGAACTATGATGGGGAAGG + Intergenic