ID: 1124164977

View in Genome Browser
Species Human (GRCh38)
Location 15:27318398-27318420
Sequence CTTGCACCCTGCCAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124164973_1124164977 -10 Left 1124164973 15:27318385-27318407 CCCTCAGATGGGACTTGCACCCT 0: 1
1: 0
2: 2
3: 7
4: 180
Right 1124164977 15:27318398-27318420 CTTGCACCCTGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 24
4: 264
1124164967_1124164977 26 Left 1124164967 15:27318349-27318371 CCTCATCAGTAATACTCATCATT 0: 1
1: 0
2: 2
3: 22
4: 183
Right 1124164977 15:27318398-27318420 CTTGCACCCTGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 24
4: 264
1124164972_1124164977 -9 Left 1124164972 15:27318384-27318406 CCCCTCAGATGGGACTTGCACCC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1124164977 15:27318398-27318420 CTTGCACCCTGCCAGGGAGATGG 0: 1
1: 0
2: 2
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124164977 Original CRISPR CTTGCACCCTGCCAGGGAGA TGG Intronic
902864184 1:19267454-19267476 TGGGCACCCTGCAAGGGAGACGG + Intergenic
902866406 1:19282885-19282907 TGGGCACCCTGCAAGGGAGACGG + Exonic
902869357 1:19304379-19304401 TGGGCACCCTGCAAGGGAGACGG + Exonic
904564322 1:31418885-31418907 CTTGCACACTGCCAATGACAAGG - Intronic
904923122 1:34024362-34024384 CTGACACCCTGACAGGAAGACGG + Intronic
913277422 1:117152666-117152688 CTTCCACCCTGCCTTTGAGAAGG - Intronic
915041882 1:152974727-152974749 TTTGCAACCTGCCAGGTGGAGGG + Intergenic
915311362 1:155007372-155007394 CCTGCAGCCTGCAAGGGAGTGGG - Intronic
915482900 1:156199389-156199411 CCTGCATCCTGCCAGGTAGTTGG + Intronic
916171314 1:162003444-162003466 CTTTCTCCCAGCCAAGGAGATGG + Intronic
918385578 1:184004237-184004259 CTTGCACCTTGCCATGGTTAGGG - Intronic
921161046 1:212472366-212472388 CTTGAACCCTGTCCAGGAGATGG + Intergenic
922938632 1:229440838-229440860 CTTGCAGCCTGCGGGGGAGACGG + Intergenic
1063101389 10:2952916-2952938 AATGCACCCCGGCAGGGAGAGGG + Intergenic
1063872550 10:10434240-10434262 CTTACACACTGCCAGTGGGAAGG + Intergenic
1063953225 10:11243214-11243236 CTTTCTCCCTCCCGGGGAGAAGG - Intronic
1066552107 10:36570261-36570283 CTTGCACCCTGAGAGTGACATGG - Intergenic
1067146006 10:43694487-43694509 CCTGCACTCTGACAGGGAGGTGG + Intergenic
1067472225 10:46545592-46545614 TTTGCACCCTGCCTGGGACTTGG - Intergenic
1069114964 10:64493941-64493963 ATTGCACTCAGCCTGGGAGACGG - Intergenic
1070085361 10:73231762-73231784 CTTCCACATTGCCAGTGAGATGG - Intronic
1070179424 10:73999202-73999224 CTTGCTTCCTGCCAGGAGGAGGG - Intronic
1070813458 10:79309866-79309888 CTTTCGCTCTGCCAGTGAGAGGG - Intronic
1072231496 10:93417696-93417718 TCTGCACCTTGCCAGGGAGGGGG + Intronic
1073468269 10:103707096-103707118 CTTTAGCCCTGTCAGGGAGAGGG - Intronic
1074884696 10:117684813-117684835 CTGGCAACCTGCCAGGGTCATGG + Intergenic
1077297687 11:1833770-1833792 CTCCCAGCCTGCCAGGGAGTGGG + Intronic
1077442024 11:2573347-2573369 CTTGGGCCCTGCCAGGGTGAGGG - Intronic
1078843532 11:15101331-15101353 CTTGCGATCTGCCTGGGAGAAGG - Intergenic
1079289678 11:19175921-19175943 CTTTCACCCAGCCAGGGAGAAGG + Exonic
1083148031 11:60773138-60773160 CTTGGAAGCTGCTAGGGAGAAGG - Intronic
1083198219 11:61103435-61103457 CTTCCAGGCTGGCAGGGAGAGGG + Intronic
1083264870 11:61542086-61542108 TTGGCACCCTGCCAAGGGGATGG + Intronic
1084179939 11:67441182-67441204 CTTGCCATCTGCCAGGAAGATGG + Exonic
1084948076 11:72649688-72649710 CTTGCACACTCCCAGGGACAGGG + Intronic
1085296003 11:75432110-75432132 CTTGCACACCTCCAGGGACAGGG + Intergenic
1085662106 11:78377829-78377851 CCTCCACCCTGCCAGAGATAAGG + Intronic
1085718146 11:78890818-78890840 CTTGCACACAGCCTGGGAAATGG + Intronic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1090405628 11:126474451-126474473 CCTGCTCCCTGCCAGGGAAGGGG - Intronic
1090412122 11:126516487-126516509 CTTGCATTCTGGCAGAGAGAAGG - Intronic
1090965677 11:131595992-131596014 CTTCCAGCCTGCCATGCAGATGG - Intronic
1091388246 12:108865-108887 CTCTCGGCCTGCCAGGGAGACGG - Intronic
1092178952 12:6431707-6431729 CAGGCCCCTTGCCAGGGAGAAGG + Intergenic
1097912153 12:64982075-64982097 GCTGCAGCCTGGCAGGGAGAGGG - Intergenic
1098316347 12:69197579-69197601 CTTGCTCATTGCCAGGGAGAGGG + Intergenic
1099069582 12:78028733-78028755 CTTGCTCACTGCCAGGAAGCTGG + Intronic
1102039677 12:109792760-109792782 CTCGATCCCTGCCAGGTAGAGGG + Exonic
1102814512 12:115853504-115853526 CTTCCAGCCTGCAATGGAGATGG + Intergenic
1103906090 12:124327884-124327906 CTTGGGCACTGCCAGGGAGGTGG + Intronic
1104401383 12:128479428-128479450 CTTTCGCACAGCCAGGGAGATGG + Intronic
1104633731 12:130425114-130425136 CATGCATCCAGCCAAGGAGAGGG + Intronic
1105349510 13:19602490-19602512 CTTGCAGGCTGCCAGAGAGTGGG + Intergenic
1105897291 13:24727077-24727099 CCTCCACCCTGACAGGCAGATGG + Intergenic
1106052688 13:26206297-26206319 GTGCCACCCTGCCAGGCAGATGG - Intronic
1108498241 13:51045591-51045613 CTTGCACACTCCCAGGGACTGGG + Intergenic
1108614531 13:52118694-52118716 CTAGCACACTGCCACGGAGAGGG - Intronic
1112318447 13:98385739-98385761 GTTGCACCCGGCCAAGGACAGGG + Exonic
1113455515 13:110446058-110446080 TGTGCTCCCTGCCAGGGAGAAGG + Intronic
1114178327 14:20343541-20343563 CGTGCGCCCTGGCAGGAAGATGG - Intergenic
1114500099 14:23162204-23162226 TGTGCACCCTGCCGGGCAGAGGG + Intronic
1118048149 14:61994762-61994784 CTGGCACAATGCCAGGGATAAGG - Intergenic
1118336617 14:64858698-64858720 CCTGGACCCTGCCTGGGAGAAGG + Intronic
1119035725 14:71228955-71228977 CTTGCACCCTCCCAGTGACCCGG + Intergenic
1119113279 14:71995401-71995423 CTTCCACCCTGCCAGGGGCCAGG - Intronic
1122977385 14:105176451-105176473 CTTGCACACTCCCAGGGACGGGG + Intronic
1124164977 15:27318398-27318420 CTTGCACCCTGCCAGGGAGATGG + Intronic
1124626347 15:31309578-31309600 CTTTCTCCCTGGCATGGAGATGG + Intergenic
1127770139 15:62224302-62224324 CCTGCACCCCGCCACGGAGGAGG - Intergenic
1130866549 15:87938180-87938202 CTTACAGCCTGCTGGGGAGAGGG - Intronic
1132298504 15:100762105-100762127 CTTACACCTGGCCAGGGACAAGG - Intergenic
1132389565 15:101428390-101428412 CTTTCATCCTGCCAGGCAGCAGG - Intronic
1132688890 16:1173642-1173664 CTTCCACCAGGCCAGGCAGAGGG - Intronic
1132836309 16:1954929-1954951 CTTGGCCGCTGCCTGGGAGAAGG - Intronic
1132952714 16:2573263-2573285 CATGCACGCTGCCATGCAGATGG + Intronic
1132961637 16:2626907-2626929 CATGCACGCTGCCATGCAGATGG - Intergenic
1134249901 16:12566979-12567001 GTTGCACCTTTCCAGGGACATGG - Intronic
1135329758 16:21551296-21551318 CTGGCACTGTGCCATGGAGAGGG - Intergenic
1136009004 16:27350236-27350258 CTTACACCCTGGAAGGGAGCTGG - Intronic
1136232469 16:28894699-28894721 CTTGCACCCTGGCAGAGGGCTGG - Intronic
1136340098 16:29637266-29637288 CTGGCACTGTGCCATGGAGAGGG - Intergenic
1137903596 16:52295904-52295926 CCTGCAAAGTGCCAGGGAGAAGG + Intergenic
1138352299 16:56352472-56352494 CCAGCACCCTGCCATGGAGGAGG + Intronic
1139480204 16:67226542-67226564 GTTTCCCACTGCCAGGGAGAAGG + Intronic
1140485321 16:75288824-75288846 CTGGCACCCTGGCAGGGACCAGG - Intergenic
1140516210 16:75544145-75544167 CTAGCACACTGCCTGGCAGATGG - Intronic
1141626949 16:85266429-85266451 CCTGCTCCCTGCCTGGCAGACGG - Intergenic
1141835150 16:86533637-86533659 CTCTCACCCTGCCAAGGATAAGG - Intronic
1142042776 16:87905837-87905859 CTGGCACTGTGCCATGGAGAGGG - Intronic
1142096480 16:88242666-88242688 CTAGGACCCTGCCTGGGAAAGGG - Intergenic
1142194709 16:88734043-88734065 ACTGCATCCTGCCTGGGAGAGGG + Exonic
1142702833 17:1674557-1674579 ATTGCACCGGGCCAGTGAGATGG - Exonic
1142810808 17:2394804-2394826 CTTGCACACAGCCCGGGGGATGG + Intronic
1142978100 17:3657064-3657086 CCTGAGCCCTGCCAGGGAGGAGG + Intronic
1143373451 17:6454381-6454403 CTTTCACACAGCCTGGGAGAGGG - Exonic
1144012579 17:11163730-11163752 CTTGCTCTGTCCCAGGGAGATGG - Intergenic
1144649980 17:17001410-17001432 CTTGCACACTTCCAGGGACAGGG - Intergenic
1145109071 17:20145765-20145787 CTTCCTGCCTGCCAGGGAGCTGG - Intronic
1145225413 17:21124149-21124171 CTGACACCATGCCAGGGAGAGGG + Intronic
1145733422 17:27211168-27211190 TTTTCACCCTGCCAGGAAGAAGG - Intergenic
1146359289 17:32160679-32160701 GTTGCAGCCTCGCAGGGAGATGG + Intronic
1146652701 17:34616351-34616373 TTTACAACCTGCCAGGGAGTAGG + Intronic
1146673612 17:34758293-34758315 CTTTCTGCCTGCCACGGAGATGG + Intergenic
1147041524 17:37722967-37722989 CTGGGAACCTGCCAGGTAGAGGG - Intronic
1147212780 17:38881717-38881739 CTGGCACTTTGCCAGGGAGTTGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148645488 17:49217720-49217742 CTTGAACCCTGTCATGCAGATGG + Exonic
1149505961 17:57194150-57194172 TTTGCTCCCTCCCAGGGAGACGG - Intergenic
1149577411 17:57724094-57724116 CATGCACCATCCCCGGGAGATGG + Intergenic
1150823787 17:68457308-68457330 CTCGGCCCCTGCCAGGGAGGTGG - Intronic
1151224536 17:72638843-72638865 CTCGCTCCCTGCCAGGAGGAGGG + Intergenic
1151669446 17:75564013-75564035 CTTCCACCTTCCCAGAGAGACGG + Intronic
1151693691 17:75703147-75703169 CCTCCACTCTCCCAGGGAGATGG - Intronic
1151722416 17:75864904-75864926 CTTGCATCTTGCCAGGGAAGTGG - Intergenic
1153878642 18:9400398-9400420 CTTGTACCCTGGTAGGGAAATGG + Exonic
1160428666 18:78796313-78796335 CTAGCACCCTGCCGTCGAGATGG - Intergenic
1160992014 19:1863883-1863905 CTTGCACCCTAGCGCGGAGAAGG - Intergenic
1161098089 19:2405381-2405403 CTTGCAGCCTGCCTGGAGGATGG + Exonic
1161338614 19:3728490-3728512 CTGGCACCCAGACAGGGAGAGGG - Intronic
1161387087 19:4000888-4000910 ATTGCACCCAGCCTGGGTGACGG + Intergenic
1162324806 19:9992873-9992895 CGTGGACCCTGCAAGGGAGCAGG + Exonic
1162359581 19:10210467-10210489 CATGGACCCTGGCAGGCAGAAGG - Intronic
1162558964 19:11404992-11405014 CGTGCAACCCGCCAGGGACAAGG + Intronic
1162997166 19:14343479-14343501 CTGGCACCCTGCCAAGCAGCAGG + Intergenic
1164830398 19:31315513-31315535 CCTGCCCTCTGCCAGGGAGCTGG + Intronic
1165362546 19:35345746-35345768 CCTGCACCCTGGGAGGGAGGCGG + Intronic
1167011936 19:46814163-46814185 CGGGCACCCTGCCAGGGATTGGG + Intergenic
1167750939 19:51379968-51379990 CTAACAACCTGCCAGGCAGACGG + Exonic
1168639189 19:58019544-58019566 CTTGCAGCCTGCCAGGGCCTGGG + Intergenic
926061782 2:9809023-9809045 CTCGTTCCCTGCCTGGGAGAGGG - Intergenic
926125795 2:10270859-10270881 CATGCTCCCTGCCAGGAAGGAGG + Intergenic
930036765 2:47090624-47090646 CAGGGACCCTGGCAGGGAGAAGG - Intronic
933903063 2:86862679-86862701 CATGCAGCCTGCAGGGGAGAGGG + Intergenic
934653392 2:96104708-96104730 CTTGAACCCTGGCTGTGAGATGG - Intergenic
935777483 2:106486591-106486613 CATGCAGCCTGCAGGGGAGAGGG - Intergenic
936734763 2:115427419-115427441 CATGCACCCTGCGAGAGTGAAGG - Intronic
936835311 2:116702677-116702699 AGTGCAGCCTGCCAGAGAGAAGG + Intergenic
938161085 2:128985145-128985167 CCAGCACCCTGCCTGGGTGAAGG + Intergenic
938714519 2:134007606-134007628 CTTGAACCATGCCTGGGACATGG + Intergenic
940021508 2:149160939-149160961 CTGGCAAACTGCCAAGGAGATGG - Intronic
941856096 2:170232590-170232612 TTTGAACCCAGGCAGGGAGAAGG - Intronic
943130000 2:183842401-183842423 GTTGCTCCATCCCAGGGAGATGG - Intergenic
944191587 2:197009789-197009811 AATGCACCCTGCTAGGAAGAAGG - Intronic
945851585 2:215014608-215014630 CTTGCAAGGTGCTAGGGAGAGGG + Intronic
947235307 2:227935338-227935360 CTTGCTCCCTGGCTGGCAGATGG - Intergenic
948212831 2:236207715-236207737 CTTGCCAACTGCCAGGAAGAGGG - Intronic
948545891 2:238728447-238728469 CTTTCAGCCTGCCAGGCAAAGGG + Intergenic
948999916 2:241607350-241607372 CGTGCATCCAGCCAGGGTGAGGG - Intronic
1168992157 20:2103802-2103824 CTTGGAACCAGACAGGGAGAGGG - Intronic
1171164931 20:22961300-22961322 CTGCCAGCCTGCCAGGGAAAAGG - Intergenic
1173302506 20:41816699-41816721 CTTACACCAGGCCTGGGAGATGG - Intergenic
1173502736 20:43565750-43565772 CTTCCACCCTGCAGGGGAGACGG - Exonic
1173609760 20:44358318-44358340 ACTGCACCCAGCCTGGGAGAGGG - Intronic
1173625047 20:44466336-44466358 ATTCCACCCTTCCAGGGAGATGG + Intergenic
1174284912 20:49465613-49465635 CACCTACCCTGCCAGGGAGACGG + Intronic
1175891355 20:62317413-62317435 CTTGCTGCCCGCCGGGGAGAAGG + Exonic
1176139794 20:63539924-63539946 CTGGAACCCACCCAGGGAGATGG + Intergenic
1177787898 21:25692098-25692120 CTGACAGCCTGCCAGGGAGCTGG + Intronic
1178499983 21:33117735-33117757 TCTCCTCCCTGCCAGGGAGAAGG + Intergenic
1178778831 21:35579909-35579931 CTTGCACCATGCCAGGCACATGG - Intronic
1178912744 21:36689075-36689097 CTAGCACACTGCCTGGAAGAAGG - Intergenic
1179879541 21:44287619-44287641 CTTGCCCCTGGCCAGGGAGAAGG - Intronic
1179880096 21:44289973-44289995 CCTCCACCCTGCAAGGAAGAGGG - Exonic
1179912836 21:44459500-44459522 CAGGCACCCTGGCATGGAGAAGG - Exonic
1180068065 21:45422654-45422676 CCAGCACCCTGCCAAGGAAAGGG + Intronic
1180158067 21:45987595-45987617 CTTGCAGGCTGCAAGGCAGAGGG - Exonic
1180734878 22:18008762-18008784 TTTTCACCCTGCCAGGAAGAAGG + Intronic
1180835914 22:18929356-18929378 CCTGCACTCTGCCAGGGGGCTGG - Intronic
1181440370 22:22932481-22932503 CTTGGACCCTTCAAGGGAGCTGG + Intergenic
1181511500 22:23391192-23391214 CCTGCAGGCTTCCAGGGAGAAGG + Intergenic
1181618025 22:24068293-24068315 CTTGCAGCCTGCCAGGTAACAGG - Intronic
1181762282 22:25066934-25066956 GTGGCCCCCTGCCATGGAGAAGG + Intronic
1181829332 22:25546785-25546807 CTGTCTCCCTCCCAGGGAGAAGG + Intergenic
1182502886 22:30760732-30760754 CTTGAACCCTGGCAGGGCGGAGG + Intronic
1183583603 22:38739624-38739646 CCTGGAACCTGCCAGGGAGCTGG + Intronic
1183727466 22:39597633-39597655 CTTGCCCACTGCCAGGGTTAGGG - Intronic
1184355307 22:43975612-43975634 CTTGCACCGGCCCAGAGAGAAGG - Intronic
1184437104 22:44485782-44485804 CTTGAATCCAGCCAGTGAGAGGG + Intergenic
1184778960 22:46636697-46636719 GTTGCATCCTGCCAGGGACCTGG - Intronic
1203286005 22_KI270734v1_random:154655-154677 CCTGCACTCTGCCAGGGGGCTGG - Intergenic
949980839 3:9500866-9500888 CCTGCTCCCTGCCAAGGGGAAGG + Exonic
950014804 3:9748025-9748047 CTTGCCCCCTGCCAGGGCAAAGG + Intergenic
950265268 3:11568738-11568760 CACGCATCCTGCCCGGGAGATGG + Intronic
950462398 3:13133263-13133285 CTTGCACCCTTCCAGGAATGGGG - Intergenic
950485315 3:13269826-13269848 CCTCCACCCTCCCTGGGAGAAGG - Intergenic
950922359 3:16707481-16707503 CTAGCGTGCTGCCAGGGAGATGG + Intergenic
951550819 3:23873399-23873421 CCTGCACCCTCCCAGGGCCATGG - Intronic
953335044 3:42087410-42087432 CTTCCTCCCTGGCAGGGAAAGGG - Intronic
954130986 3:48560871-48560893 CTGTCGCCCTGCAAGGGAGAGGG - Intronic
954387265 3:50250680-50250702 CTGGCCCCCAGCCAGGGAGTTGG + Intronic
957429666 3:80085814-80085836 CTTGCACCATGCCATAGAAAGGG - Intergenic
957450694 3:80378135-80378157 CTGGAGCCCTGCCAGGGTGATGG - Intergenic
957880861 3:86211370-86211392 CATGCACTCTGCAAGGGAAAAGG + Intergenic
960938637 3:122919274-122919296 CTTTCACCCTGCCTTTGAGAGGG - Intronic
961499679 3:127323443-127323465 CTTCCATTCTCCCAGGGAGAGGG + Intergenic
964151551 3:153531698-153531720 CTTGGCCACTGCCAGGGAGTTGG - Intergenic
967979593 3:195057888-195057910 CTTGCACACCCCCAGGGACACGG + Intergenic
968828156 4:2914807-2914829 CCTGCAGCCTGCCTGGGAGGAGG + Intronic
968945700 4:3662552-3662574 CTTGCAACCTGCTCGGGAGGTGG + Intergenic
968971628 4:3798659-3798681 CTTGCACACTGGCATGGAGCTGG - Intergenic
969220629 4:5756348-5756370 GTTGCACTCTGCCAGGTACATGG + Exonic
969263679 4:6050201-6050223 CTTGCTGCATGCCAGGCAGAGGG + Intronic
969289491 4:6229635-6229657 CTTGCACACCTCCAGGGACAGGG - Intergenic
969445744 4:7243889-7243911 CCTGCTGCGTGCCAGGGAGAGGG - Intronic
970015184 4:11505158-11505180 TTTCCTCCCTGCCAAGGAGAAGG + Intergenic
972324752 4:38004988-38005010 CTGGCTCCCTGGCAGGGAGGGGG + Intronic
973852348 4:54973746-54973768 TTCTCACCCTGCCAAGGAGAAGG + Intergenic
977674206 4:99730348-99730370 CCTCCACCCTGACTGGGAGATGG - Intergenic
979763482 4:124436212-124436234 CTTTCAGCCTGCCAGCCAGATGG - Intergenic
986073557 5:4311664-4311686 CTTGCTCCCTACAAGGGAAACGG - Intergenic
986496836 5:8350964-8350986 CTTGCACACTGCCAAACAGAAGG + Intergenic
987300907 5:16597577-16597599 CCAGAACCCTCCCAGGGAGAAGG + Intronic
988934780 5:36071048-36071070 CTGGCACCTGGCCAGGGTGAAGG - Intronic
989130923 5:38105997-38106019 CTTTCCCCCTGCCAGGGTGATGG + Intergenic
994871016 5:105350763-105350785 CTTGCAAGCTGCATGGGAGAAGG - Intergenic
996580925 5:125031420-125031442 CTTGCACCTTCCCAGGGGAAGGG - Intergenic
997199246 5:131999804-131999826 CTGGCACGCTGGCAGGGTGAGGG - Intronic
998402233 5:141853870-141853892 CCTGGACCCTGCATGGGAGAAGG + Exonic
999428996 5:151510084-151510106 TTTGCACCCTGCCTGGAAGGTGG - Exonic
999481254 5:151950112-151950134 CTGGCAGGGTGCCAGGGAGATGG + Intergenic
1000761217 5:165227055-165227077 CTTGCACAGTGCCAGGTATAAGG - Intergenic
1000973461 5:167739559-167739581 CTTGCTCCCTGCCAGCAAGATGG - Intronic
1001862357 5:175068422-175068444 CTGTCACCCTGAGAGGGAGAAGG - Intergenic
1002563299 5:180096809-180096831 CTTGCAGCCTCAGAGGGAGATGG - Intergenic
1003270073 6:4600790-4600812 CTTGCAACCGTGCAGGGAGAGGG - Intergenic
1004063685 6:12222489-12222511 CTGGCACCCTGTCACAGAGAGGG + Intergenic
1005302934 6:24488876-24488898 CATGCACGGTGCCAGGAAGATGG - Intronic
1005989111 6:30892328-30892350 ATTCCACCCCGCCAGGCAGACGG - Exonic
1006524136 6:34589323-34589345 CTAGCATCCTGGCAGGGAGGCGG + Exonic
1006727625 6:36211243-36211265 GTTGTCCACTGCCAGGGAGAAGG - Exonic
1014100539 6:117506690-117506712 CTTCCACCCTTCCAGGAAGCTGG - Intronic
1015579341 6:134706380-134706402 CTAGCTCCCTCCCAGGCAGAAGG - Intergenic
1015991229 6:138945560-138945582 CTTGCCCCCTGCCAGGTGGTGGG + Exonic
1016648274 6:146434783-146434805 CTTCCACCCTGTAAGGGGGAAGG + Exonic
1018486369 6:164244760-164244782 CTGCCATCCTTCCAGGGAGATGG + Intergenic
1019316380 7:388853-388875 CTGGCTCCCTGCCCGGGAGCCGG - Intergenic
1021031931 7:15747986-15748008 CTTGCATCCTCACAGAGAGAGGG + Intergenic
1021870548 7:25001987-25002009 GCTGCAGCCTGGCAGGGAGAGGG - Intergenic
1022335091 7:29414709-29414731 CTTGGACACAGCTAGGGAGAGGG - Intronic
1023258459 7:38335316-38335338 CTTCCAACTTGCAAGGGAGAAGG - Intergenic
1024511116 7:50205798-50205820 CTGGCACCCAGCCAGGCACAAGG + Intergenic
1026207483 7:68270810-68270832 GTTGCACCCTGCAAGGGGGTGGG + Intergenic
1026273011 7:68852817-68852839 CTTCCTCAGTGCCAGGGAGATGG - Intergenic
1026273166 7:68853787-68853809 CTTCCTCAGTGCCAGGGAGATGG + Intergenic
1026828457 7:73597569-73597591 CTGGCACCTTGGCAGGGGGAGGG + Exonic
1027046434 7:74994293-74994315 CTTTCACCCCGTCAGGGTGAGGG + Intronic
1028526327 7:91790877-91790899 GCAGCACCCTGGCAGGGAGAGGG + Intronic
1028706648 7:93855877-93855899 CATCCACCCTCCCAGAGAGAAGG - Intronic
1029087757 7:98024482-98024504 CATACACCCAGCTAGGGAGATGG - Intergenic
1029163395 7:98569038-98569060 CTGGCTGCCTGCCAGGGACACGG - Intergenic
1029627049 7:101726436-101726458 ATTGCACCCGGCCAGGGAGAAGG - Intergenic
1034712143 7:153203062-153203084 CCCTCACCCTGCCAGGGAGGAGG + Intergenic
1036054535 8:5236827-5236849 CGTGCACCATGCCTGGGACATGG - Intergenic
1039080713 8:33731609-33731631 CCTGGACCATGCCATGGAGAGGG + Intergenic
1039373310 8:37009069-37009091 CTTGTACCCTGCCAGAGCAATGG - Intergenic
1039512963 8:38105970-38105992 CTTGCACCCTGGCAGGAAGCTGG + Intronic
1041520098 8:58746299-58746321 CCTGTACCCTGACAGGGAGAGGG + Intergenic
1042857716 8:73285133-73285155 CTTGCACCCAGCCATGCAGTGGG - Intergenic
1044193479 8:89347050-89347072 CTTTCACTCTGCCTGGGAGTGGG - Intergenic
1045007320 8:97927964-97927986 CTTAGACCCTGCCATGGAGGAGG - Intronic
1045502898 8:102756993-102757015 CCTGCACCTTCCCAGGGAGGAGG - Intergenic
1046419217 8:113957601-113957623 CTGGAAAGCTGCCAGGGAGAAGG + Intergenic
1048966632 8:139619397-139619419 CTTGCACTATGCCACTGAGAGGG + Intronic
1049012712 8:139898062-139898084 CTCGTCCCCTGCCAGTGAGATGG + Intronic
1049274960 8:141715626-141715648 CTTGCTACCAGCCATGGAGAAGG + Intergenic
1049419790 8:142511457-142511479 CTCTCCGCCTGCCAGGGAGAGGG + Intronic
1049483560 8:142839611-142839633 CCTGCTCCCAACCAGGGAGATGG + Intronic
1050320708 9:4449248-4449270 TCAGCAGCCTGCCAGGGAGAGGG + Intergenic
1051502048 9:17788637-17788659 CTTGCACCATACCTGGTAGATGG - Intronic
1055645187 9:78356457-78356479 CCTCCGCCCTGCCAGGGACATGG - Intergenic
1056120535 9:83483458-83483480 TTTCCACCCCGCCAGTGAGATGG + Intronic
1056964694 9:91155912-91155934 TCTCCACCCTTCCAGGGAGAGGG + Intergenic
1057949248 9:99356724-99356746 CAGGAAGCCTGCCAGGGAGAGGG + Intergenic
1058960980 9:109992658-109992680 TTTGCACACTTCCAGGGATAAGG - Intronic
1059019273 9:110556264-110556286 CTTGCAGCCTGACATGGAGTGGG - Intronic
1059849248 9:118318846-118318868 CTTGTACCCTGCCAGGGCATGGG + Intergenic
1061136231 9:128735541-128735563 CTGGCAGGATGCCAGGGAGAAGG + Intronic
1061257489 9:129460943-129460965 CTTCAACCCAGCCAGGGACAAGG + Intergenic
1061818478 9:133209575-133209597 CCTGCACCCTCCCAGGGCCACGG + Intergenic
1189324475 X:40104672-40104694 CTTGCAGCCTGGCTTGGAGACGG - Intronic
1189657446 X:43260397-43260419 CTTGCACCCTGTTAGTGGGAAGG - Intergenic
1189919281 X:45887678-45887700 TTTGCACATTGCCAGGAAGAAGG + Intergenic
1190264307 X:48818205-48818227 ATAGCACACTGCCAGGGAGGGGG - Exonic
1191219115 X:57966799-57966821 CTTGCACCCTTGCAAGGACATGG - Intergenic
1192031199 X:67514300-67514322 ATTGGAGCCTGTCAGGGAGAGGG + Intergenic
1192192228 X:68998138-68998160 CTTGCTTCTTGGCAGGGAGAAGG - Intergenic
1194542892 X:95196587-95196609 CTAGCACCCTGCCAAAGTGAAGG - Intergenic
1195706166 X:107739403-107739425 CATGCACCCTTTCAGGGAGATGG + Intronic
1199530142 X:148837467-148837489 CTTGCAAACTGCCAGTGACAGGG - Intronic
1200246757 X:154530613-154530635 CATGTGTCCTGCCAGGGAGATGG - Intergenic
1200832908 Y:7704801-7704823 ACTGCACCCTGCCATGGATATGG - Intergenic