ID: 1124167675

View in Genome Browser
Species Human (GRCh38)
Location 15:27342623-27342645
Sequence CCAGCTTCTCCCCTTGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124167675_1124167677 2 Left 1124167675 15:27342623-27342645 CCTCTTTCAAGGGGAGAAGCTGG 0: 1
1: 0
2: 1
3: 27
4: 276
Right 1124167677 15:27342648-27342670 CATTCTTCATCAGAGTATTGTGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124167675 Original CRISPR CCAGCTTCTCCCCTTGAAAG AGG (reversed) Intronic
900990725 1:6097016-6097038 CCATCCTCTTCCCATGAAAGCGG - Intronic
901134697 1:6985295-6985317 CCAGCTCCTCCCATTCACAGTGG - Intronic
903125428 1:21244425-21244447 CCACCTTCTCCCCAAGGAAGTGG - Intronic
903161457 1:21491980-21492002 CCTGCTGCACCCCTTGAGAGTGG + Intergenic
903814216 1:26052760-26052782 CCAGCGTGTCCCCTTTAAAGGGG + Intronic
905109347 1:35583844-35583866 AGAGCTTCTTCCCTTGAAAATGG - Intronic
905451643 1:38060721-38060743 CCTGCTTCTCCCCTGTAATGAGG - Intergenic
907015159 1:51005374-51005396 CCATTTACTCCCCTGGAAAGGGG + Intergenic
907432346 1:54420440-54420462 TCAGCTTCTCCCCTGGAAAATGG - Intergenic
907480495 1:54742639-54742661 CCAGCTGCTGTCCTTAAAAGTGG + Exonic
907594917 1:55710985-55711007 CCAGCTTTTCCTCTTGTAACTGG + Intergenic
908403928 1:63795247-63795269 CCAATTTTTCCCCTTGCAAGAGG - Intronic
911284644 1:95974919-95974941 CCATCCACTCCCCTGGAAAGAGG - Intergenic
913481367 1:119292644-119292666 TCAGTTTCTCCCCTGGAAAATGG - Intergenic
913682608 1:121200819-121200841 TCAGCTTCTCAGCTGGAAAGTGG + Intronic
914034451 1:143988448-143988470 TCAGCTTCTCAGCTGGAAAGTGG + Intergenic
914155001 1:145079522-145079544 TCAGCTTCTCAGCTGGAAAGTGG - Intronic
914225259 1:145714694-145714716 CCAGCTTCTCCCCTGGAGAAGGG - Intergenic
914247375 1:145896256-145896278 CCAGCTTCTCACCCTGAGAGTGG + Exonic
916052690 1:161047570-161047592 CCAGCTTCTCTCTTTGACTGTGG - Exonic
917251297 1:173064156-173064178 CCTGCCTCTTCCCTTGAAACAGG + Intergenic
920163338 1:204016907-204016929 CAAGCCTCTTCCCTTGAAACTGG - Intergenic
920386382 1:205572636-205572658 CCAGCTTCTCCCCTTGAGCTGGG + Intronic
920469920 1:206219337-206219359 TCAGCTTCTCAGCTGGAAAGTGG + Intronic
921117060 1:212102031-212102053 CTAGCTTCTGCCCTTTAAAATGG - Intronic
921461569 1:215433125-215433147 CCAGTCACTCCCCTGGAAAGGGG - Intergenic
921738252 1:218653428-218653450 CCAGTCACTCCCCTGGAAAGGGG + Intergenic
924624901 1:245689393-245689415 ACAGATTGTCCCATTGAAAGTGG + Intronic
1063491601 10:6469346-6469368 CTAGGTTCTGTCCTTGAAAGGGG - Intronic
1065078318 10:22102941-22102963 CCCGCATCTCCCCTTGCAAGGGG - Intergenic
1067821228 10:49532509-49532531 CCATCTTCTTCCTTTCAAAGTGG - Intronic
1068252281 10:54457904-54457926 CAAACTTCTCCACTTGAAACAGG - Intronic
1068974919 10:62998330-62998352 TCAGGTTCTCCACTTGAAAATGG - Intergenic
1070581698 10:77725227-77725249 CCAGTTTCTCCCTTTGGAATGGG + Intergenic
1071530558 10:86387999-86388021 CCAGCATCTCCACTTAAAGGTGG + Intergenic
1071674782 10:87645156-87645178 TCATCTTCTCCCCTTGAAAGTGG - Intergenic
1072622818 10:97091257-97091279 CCATCTTCTCCCCTGGAGAGGGG + Intronic
1073412211 10:103351270-103351292 CCAGATTTTCTCCTTGGAAGGGG + Intergenic
1073600782 10:104844035-104844057 GCAGCTTCTCTCCAGGAAAGAGG + Intronic
1074405905 10:113180295-113180317 GCACCTTCTCCCATGGAAAGGGG - Intergenic
1074581773 10:114725992-114726014 CCCGCTTTTGCCTTTGAAAGTGG + Intergenic
1074820702 10:117176036-117176058 CGAGTTTCTCTCGTTGAAAGCGG - Intergenic
1075813522 10:125246432-125246454 CCCGCTCCTCCCCTTGCAAGAGG + Intergenic
1076983157 11:216005-216027 CCAGCTCCTCCCTCTGAAGGTGG - Exonic
1077042198 11:529797-529819 CCAGCTCCTCCCCTTGAGGGAGG - Intergenic
1077214258 11:1388864-1388886 CCAGCTGCTCAACCTGAAAGAGG + Intergenic
1077418540 11:2437242-2437264 CCAGCTTGTCGTCTTGGAAGAGG + Intergenic
1077698411 11:4416891-4416913 CCAACTTCTCTCCTTAAAACAGG - Intergenic
1077746636 11:4914410-4914432 ACTTCTTCTCCCCTTGAAACTGG - Intronic
1081080227 11:38732079-38732101 CCATTTGCTCCCCTGGAAAGGGG - Intergenic
1084145332 11:67262129-67262151 CCAGCTGATCTCATTGAAAGCGG - Intergenic
1084396778 11:68916309-68916331 CCACCTTCTCCTTGTGAAAGAGG + Intronic
1086047162 11:82546806-82546828 CAACCTTCCCCCCTTGAATGGGG + Intergenic
1086935660 11:92743230-92743252 CAAGGTGCTCCCCTTAAAAGAGG - Intronic
1087008322 11:93490128-93490150 CCAGCTTCTCTCACTGAAGGTGG + Intronic
1087550864 11:99646227-99646249 CCAGCTTCTTCACTTGTAACAGG - Intronic
1089078687 11:115759457-115759479 CCAGCTTCTCCCCTTGGCTATGG - Intergenic
1089498926 11:118921802-118921824 CCACCTTCTCCCCTCCAGAGTGG + Intronic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1090307464 11:125703593-125703615 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1090688845 11:129156243-129156265 CCATTTACTCCCCTGGAAAGGGG + Intronic
1092008445 12:5088667-5088689 CCAGATTCCACCCTTGGAAGTGG + Intergenic
1094336348 12:29359697-29359719 CCAGTTTCACCACTTGAATGTGG - Intronic
1095248408 12:39948747-39948769 CCAGCTTCTTCCCTTTTAAGTGG - Intronic
1095629933 12:44363998-44364020 CCAGCTTCTCCTCCAGCAAGAGG + Intronic
1097625028 12:61989573-61989595 CTGGCTTCTCCCCTGTAAAGAGG - Intronic
1099249099 12:80230310-80230332 GCAGCTTCTCCCCTTGTCTGAGG + Intronic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1102266226 12:111488091-111488113 CATGCTTCTCTCCTTGACAGTGG + Intronic
1104342403 12:127963017-127963039 CCAGCTTCTCCTCGTGAACATGG - Intergenic
1107066464 13:36218720-36218742 GAAGCTTCTCTCCTTGAAGGTGG - Intronic
1107674105 13:42776939-42776961 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1107801314 13:44110240-44110262 CCAGCTCCACCTCTTGAGAGAGG - Intergenic
1108470096 13:50758899-50758921 CAATCTTCTCCCCTTGAATGTGG - Intronic
1109848914 13:68035100-68035122 CCATTTTCTCCCCTTCTAAGGGG - Intergenic
1111872664 13:93852973-93852995 CCATTTTATCCCCTTGAAATTGG - Intronic
1113168804 13:107474236-107474258 CCAGTTTATACCCTTGAAAAGGG - Intronic
1115867258 14:37761003-37761025 CCACTTACTCCCCTGGAAAGGGG - Intronic
1116420564 14:44727445-44727467 CAATCTTCTCCCCTTGAGTGTGG - Intergenic
1117463757 14:55972316-55972338 CCAGCTGCTCCCCTTCACAGGGG - Intergenic
1118501740 14:66368559-66368581 CCAACTTCTCCCTCTGAATGTGG - Intergenic
1119717748 14:76870673-76870695 CCAGTGGCTCCCCTTGAAAATGG + Intergenic
1120226591 14:81797432-81797454 CCAGCTTCTTCCCTGGAACAGGG - Intergenic
1121648474 14:95537018-95537040 ACAGCTTCTCTGCTTAAAAGAGG + Intronic
1121738975 14:96238210-96238232 CCAACTTGCCACCTTGAAAGTGG - Intronic
1122159644 14:99773929-99773951 CCCGCATCTCCCCTTGGAGGAGG + Intronic
1122663212 14:103311626-103311648 CCAGATTCTCCGCTTGAATTAGG + Intergenic
1122854818 14:104554975-104554997 CCCTTCTCTCCCCTTGAAAGGGG - Intronic
1123029741 14:105446075-105446097 CCAGCTTCTCCCCCGGGAACAGG + Intronic
1202843778 14_GL000009v2_random:148298-148320 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1202913183 14_GL000194v1_random:138538-138560 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1202879473 14_KI270722v1_random:44147-44169 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1124816215 15:32996197-32996219 TCAGCTTCTCACCTTTAAAGTGG - Intronic
1125777558 15:42231137-42231159 CCATTTTCTCCCCTTGAGATGGG - Intronic
1125903535 15:43370569-43370591 CCAGCTTCTCTCCTTGCGCGAGG - Intronic
1126608352 15:50503471-50503493 CCAACTTCTCACCTTGTAGGGGG - Exonic
1127158022 15:56149861-56149883 CCATTTACTCCCCTGGAAAGGGG + Intronic
1128155870 15:65391690-65391712 CAAGCTTCTCTCCATGACAGAGG + Intronic
1130192195 15:81748175-81748197 TAAGCTTCTACCCTTGAATGTGG + Intergenic
1131008723 15:88999775-88999797 CCTGCTTTTCCCCTTTAAATAGG - Intergenic
1131606591 15:93910364-93910386 ACTGCTTCTTCCCTTGAAAAGGG - Intergenic
1133568490 16:7018257-7018279 CCAGCTTCTCCTTATGCAAGGGG + Intronic
1135867378 16:26116398-26116420 TAACCTTCTCCCCTTGAATGCGG - Intronic
1136077524 16:27827241-27827263 CCAGTCTCTCCTCTTGAGAGAGG - Intronic
1137852757 16:51762849-51762871 TCAGATTCTGCCCTTGAGAGGGG - Intergenic
1138843679 16:60539262-60539284 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1139193927 16:64896578-64896600 GTGGCTTCTCCCCTTGCAAGGGG + Intergenic
1139799887 16:69513951-69513973 CCATCTTCTTTGCTTGAAAGTGG + Intergenic
1141746951 16:85932204-85932226 CCAGCGTCTCCTCTTGGCAGGGG - Intergenic
1142472863 17:172816-172838 TCAGCTCCTCCTCTGGAAAGTGG - Intronic
1146291324 17:31609480-31609502 CCAACTTCTGGCCTTGTAAGTGG + Intergenic
1147986357 17:44309493-44309515 CGATCTTCTCCCCTTGAACCTGG - Intronic
1148616392 17:49003838-49003860 CCAGCCGCTCCCCTTTAAAAGGG - Intronic
1149562850 17:57621101-57621123 CTTGCTTCTTCCCTCGAAAGTGG + Intronic
1150231567 17:63555134-63555156 CCAGCTTTTCCCAATAAAAGAGG - Intronic
1151147771 17:72057286-72057308 CCAGCTTCTCCCCCAGCAGGTGG + Intergenic
1151507852 17:74541248-74541270 CCTGCTTCTCCCTGTGAAAACGG + Exonic
1152045377 17:77931605-77931627 CCCGCTTCTCCCCGGGAATGTGG + Intergenic
1155596805 18:27497351-27497373 CTAGTTTCTCCCCTTTGAAGAGG - Intergenic
1157090969 18:44636643-44636665 CCAGGCACTCCCATTGAAAGTGG + Intergenic
1157240746 18:46007507-46007529 CCAGCTTCTCCTCCTGGCAGAGG - Intronic
1158259936 18:55595405-55595427 CCTGCTCCTCACCTTTAAAGGGG - Intronic
1158519795 18:58162344-58162366 CCAGCTTCCCCCCATCAAACGGG + Intronic
1161459558 19:4388742-4388764 CCTGCTTCCCCCCTTGATCGAGG - Intronic
1161529747 19:4780895-4780917 CAATTCTCTCCCCTTGAAAGTGG + Intergenic
1162733416 19:12732494-12732516 CCACCTTCTCCCATTGATTGAGG + Intronic
1164903182 19:31945738-31945760 CCAGCTTCTCCCACTGGAAAAGG + Intergenic
1165469218 19:35993939-35993961 CCAGCTTCTCCTCTCTGAAGGGG + Intergenic
1165559740 19:36668504-36668526 CCAGCTTCTTCCCTTCTCAGGGG - Intergenic
1165923158 19:39311101-39311123 CCAGCCTCTGTCCTTGAAAAGGG - Intronic
1166827181 19:45616757-45616779 TCAGCTTCTCCCCAGGTAAGCGG - Exonic
1202655091 1_KI270708v1_random:13156-13178 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
925072375 2:980269-980291 CCACCTGCTCACCTTTAAAGAGG - Intronic
925467901 2:4126090-4126112 ACAGCAGCTACCCTTGAAAGAGG + Intergenic
926081848 2:9993798-9993820 CCAGCTTCTCCACTGCAAAGTGG + Intronic
926633972 2:15161558-15161580 CCTGCTTCTCCCTTAGAAAAGGG - Intergenic
929868969 2:45741876-45741898 CCAGGGTCTCTCCTTTAAAGAGG + Intronic
929871397 2:45762066-45762088 GCAGCTACTCCCCTAGAGAGTGG - Intronic
930305852 2:49673563-49673585 CAATCTTCTCCCCTTGAATTCGG - Intergenic
932452842 2:71826575-71826597 ACAGCTGTTCCCCTGGAAAGTGG - Intergenic
932670473 2:73733576-73733598 CCAGCTTCTCATCTTTAAAATGG - Intronic
937115155 2:119399520-119399542 CCAGGTTCTCACCTTTACAGAGG + Intergenic
937289594 2:120774050-120774072 CCTGCTCCTCACCTTGAAATTGG - Intronic
939883836 2:147659620-147659642 CTGGCTTCTCTGCTTGAAAGGGG + Intergenic
940594031 2:155767059-155767081 CCATTTACTCCCCTGGAAAGGGG - Intergenic
941264948 2:163349143-163349165 CCAGCTTTTAGCCTTGAAAGGGG - Intergenic
941471888 2:165898216-165898238 CCAGCTTCTCACCTAAAAAAGGG - Intronic
942397495 2:175567400-175567422 CCAGCTTCTTCCCCTGAATAAGG - Intergenic
944331207 2:198468460-198468482 CCACCTTCTCTCCTTCAAGGGGG + Intronic
944504860 2:200400972-200400994 CCTGCCTCTCCCCTTAAAACTGG + Intronic
945058462 2:205888226-205888248 CCAGCTTCTCCCCTGGGCACAGG + Intergenic
945138604 2:206658675-206658697 CCAGCTTCTCACTTTGCAGGGGG - Intronic
945184359 2:207124248-207124270 CCTGCTGCTCCCCGTGGAAGCGG - Exonic
945877367 2:215292523-215292545 GCAGCTTCACTCCTTGACAGAGG - Intergenic
946663418 2:222025426-222025448 TCAGCTTCTCAGCTTGAAAATGG - Intergenic
948190512 2:236054768-236054790 CCAGCTCCTGCCTTTGGAAGCGG + Intronic
1169944227 20:10971806-10971828 CAACCTTCTCCTCTTGAATGTGG - Intergenic
1170718171 20:18850064-18850086 TAAGCTTTGCCCCTTGAAAGGGG - Intergenic
1171000828 20:21413986-21414008 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1172672871 20:36646275-36646297 GCAGCTGCTCCCCTAGAAACAGG - Intergenic
1173793690 20:45844085-45844107 CCACCTTCTCCCCATGCAAAGGG + Intronic
1174412125 20:50343155-50343177 CAGTCTTCTCACCTTGAAAGTGG - Intergenic
1175040932 20:56050018-56050040 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1175257786 20:57657429-57657451 CCAGTTTCTCCTCTGGAAAGTGG + Intronic
1176448276 21:6840532-6840554 CCAGCTGCTCCGCCTGACAGGGG - Intergenic
1176632532 21:9153208-9153230 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1176640778 21:9301609-9301631 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1176826446 21:13705554-13705576 CCAGCTGCTCCGCCTGACAGGGG - Intergenic
1176913781 21:14600207-14600229 CCAGCTTCTCCATTTGACAGTGG + Intronic
1177607313 21:23398274-23398296 CAAGCTTCTCCTCCTGAAAATGG + Intergenic
1180349803 22:11790992-11791014 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1180374082 22:12074444-12074466 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1180388405 22:12201260-12201282 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1183463780 22:37968745-37968767 CCAGCTCCTCCTCTTTGAAGGGG - Exonic
1184105200 22:42363393-42363415 TCAGCTTCTTTCCCTGAAAGTGG - Intergenic
1184157705 22:42679225-42679247 CCAGCTTCTCCCATTTGAATGGG + Intergenic
951748580 3:26007790-26007812 CCAGTTTCTTCCCTTGGAACTGG - Intergenic
952150445 3:30583571-30583593 CCATCTTCTCACTTTGAAGGTGG + Intergenic
953202251 3:40787875-40787897 CCAACTTCTCCCATTTAAAATGG + Intergenic
954139121 3:48595863-48595885 CCGGCTTATCCCCTACAAAGAGG - Intergenic
955105648 3:55895382-55895404 ACAGATCCTCCCCTTTAAAGTGG + Intronic
958719665 3:97828161-97828183 CCAGCTTCCCCACATGAAACTGG - Intronic
959647634 3:108721710-108721732 TCAGCTTCTACCCTGGAATGTGG + Intergenic
961627896 3:128276164-128276186 GCAGCCTCTGCCCTTGACAGTGG + Intronic
961769101 3:129235529-129235551 TCAACTCCTCCCTTTGAAAGTGG + Intergenic
962080630 3:132135853-132135875 CCAGCTTTCCCCCTTGCCAGTGG + Intronic
965653041 3:170953487-170953509 CCTGCTGCTCCCCGTGGAAGCGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966968373 3:185018655-185018677 CCAGGTTCTCCTCTTGTAATGGG - Intronic
1202746115 3_GL000221v1_random:103415-103437 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
968807691 4:2786453-2786475 CCAGCTTCACCCCCTGTCAGAGG + Intergenic
968895731 4:3401986-3402008 CCAGCTCCACCCCTGGGAAGGGG + Intronic
969262801 4:6044215-6044237 CCCGCTGCCCCCCTTGAAGGTGG + Intronic
970227862 4:13878657-13878679 CCAGCATCTCCCCTTTACCGAGG + Intergenic
972261690 4:37415357-37415379 CCAGCTTCTCCACATGAGAAGGG - Intronic
974192200 4:58520037-58520059 CCAACTTCTCCACTTGTAATAGG - Intergenic
975053383 4:69894921-69894943 TCAGCTTCCTCCCTGGAAAGTGG - Intergenic
975177886 4:71308881-71308903 CCGTTTTCTCCCCTAGAAAGGGG + Intronic
977067139 4:92332729-92332751 CCTGCTTCTCCCCTTTGAAATGG - Intronic
977416064 4:96733981-96734003 CCAGTTTCTCCCTTTGGAATGGG + Intergenic
977994431 4:103484908-103484930 CCATTTACTCCCCTGGAAAGGGG + Intergenic
980855206 4:138431575-138431597 CTATCTACTCCCCTGGAAAGGGG + Intergenic
981148026 4:141348934-141348956 CCAGCTGCTTCCCGTGGAAGAGG + Intergenic
981859874 4:149341523-149341545 CCATTTACTCCCCTGGAAAGGGG - Intergenic
982144400 4:152367436-152367458 TCAGCATCTCCCATTGAGAGAGG + Intronic
1202755665 4_GL000008v2_random:59883-59905 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
985655595 5:1130001-1130023 TCTGCTTCTTCCCCTGAAAGAGG + Intergenic
985972372 5:3388577-3388599 CCATCTTCTCTCCTTTAGAGGGG + Intergenic
986426817 5:7640298-7640320 CCAGATTCTACCCTTTAAAGAGG + Intronic
990307081 5:54504290-54504312 CCAGGTTCTCCCTTTGTAATGGG - Intergenic
990614118 5:57489755-57489777 GCAGCTACTCCCCTTAGAAGAGG + Intergenic
990724777 5:58741345-58741367 GCATCTTCTCTCCTTGGAAGTGG + Intronic
992615485 5:78542672-78542694 ACTGCTTCTCCCACTGAAAGGGG + Intronic
993757648 5:91751201-91751223 CCATCAACTCCCCTGGAAAGGGG - Intergenic
994053047 5:95383560-95383582 CCAGCTTCTCTCCTAGTGAGTGG - Intergenic
995169595 5:109091632-109091654 CCAGCCTCAACCCTTGAGAGCGG + Intronic
996723944 5:126657438-126657460 TCAGCTTCTCATCTTGAAAGTGG + Intergenic
998307921 5:141096986-141097008 CCACCATCTGCCCTGGAAAGGGG - Exonic
998308557 5:141102839-141102861 CCACCATCTGCCCTGGAAAGGGG - Exonic
998691647 5:144594729-144594751 CCATTTACTCCCCTGGAAAGGGG - Intergenic
999363842 5:151008294-151008316 ACTGCTTCTCCCATTGACAGTGG - Intergenic
999533525 5:152489411-152489433 CAACCTTCTCCCCTTGAATGGGG - Intergenic
1002092773 5:176814578-176814600 CCACCTCCTCCCCTGCAAAGGGG + Intronic
1002831664 6:827288-827310 CACGCTTCTCCCCTTGAATCAGG - Intergenic
1002842402 6:917613-917635 CCATCTCCTCCTCTTGACAGGGG - Intergenic
1003534769 6:6967148-6967170 CCAGCTTCTCCCCATCTTAGAGG + Intergenic
1003699568 6:8446866-8446888 CCACCTCCTCCCGTTGAATGAGG + Intergenic
1003818196 6:9864962-9864984 ACTGATTCTCCCCTTGTAAGAGG - Intronic
1004030133 6:11860141-11860163 GAATCTTCTCCCCTTGAATGTGG + Intergenic
1007231291 6:40349230-40349252 CCAGCTTCTTCCCTGGGAGGAGG - Intergenic
1007938187 6:45752613-45752635 CCAGGGTCTCCCCTTCAGAGAGG + Intergenic
1009570157 6:65374554-65374576 CCATTTACTCCCCTGGAAAGTGG + Intronic
1009718280 6:67428363-67428385 CCATCCACTCCCCTGGAAAGGGG - Intergenic
1010459446 6:76097698-76097720 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1013672598 6:112421533-112421555 CCACTTACTCCCCTGGAAAGAGG + Intergenic
1015750331 6:136552321-136552343 TCAGCTCCTCCCCTGGAATGGGG - Intergenic
1015802051 6:137070285-137070307 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1016111447 6:140230286-140230308 CCATTTACTCCCCTAGAAAGGGG + Intergenic
1017642573 6:156508555-156508577 CCAGATTGTCTCCATGAAAGTGG + Intergenic
1019975641 7:4579196-4579218 GCATCTTCTCCCCTTGAAACTGG + Intergenic
1020608171 7:10363218-10363240 CCAATTTCTCCCATTTAAAGAGG + Intergenic
1021256576 7:18399788-18399810 CCAGCTTCTTTCCTGGAATGTGG - Intronic
1022234413 7:28447051-28447073 CTAACTTCTCACCTGGAAAGTGG + Intronic
1026110033 7:67451720-67451742 CCACCTCCTCCCCTAGAGAGAGG - Intergenic
1030082264 7:105788248-105788270 ACATTTTCTCCCCCTGAAAGAGG - Intronic
1030527561 7:110672649-110672671 CCAGTTTCTCCCATTGGAATGGG - Intronic
1030644664 7:112046782-112046804 CCAGCTTACTCCCTTGATAGAGG + Intronic
1032382190 7:131496956-131496978 CAAGCATATCCCCTTTAAAGAGG - Intergenic
1032398001 7:131604560-131604582 CCAGCTTTTCCCCTTGGAGGGGG + Intergenic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1035413651 7:158666492-158666514 CCTGCTTCTTACCTTTAAAGTGG - Intronic
1036692848 8:10955744-10955766 CCAACTTCTTCTCTAGAAAGGGG - Intronic
1037614962 8:20510724-20510746 TGATCTTCTCCCCTTGAGAGTGG + Intergenic
1040779871 8:51095124-51095146 CCATTTGCTCCCCTAGAAAGTGG + Intergenic
1040968833 8:53112472-53112494 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1041706787 8:60854914-60854936 CCAGCTTCTTGACTTGGAAGAGG + Intronic
1042772783 8:72397555-72397577 CTAGCTTCTGCTCTGGAAAGGGG + Intergenic
1043511310 8:80952824-80952846 CCATTCACTCCCCTTGAAAGGGG + Intergenic
1044215656 8:89607218-89607240 CCAGCTTCTCAACTAGAAAGAGG - Intergenic
1045151811 8:99416406-99416428 CCATTTGCTCCCCTGGAAAGGGG - Intronic
1046392909 8:113600416-113600438 TCAGCTTTGCCCCATGAAAGAGG - Exonic
1046796979 8:118384079-118384101 CCAGCCTCACCCCTTCAGAGAGG - Intronic
1047616115 8:126563833-126563855 CCAGCCTCTCCCCTTGCAGTGGG - Intergenic
1047626790 8:126664889-126664911 GCAGATTCTCCCTTAGAAAGTGG - Intergenic
1048270716 8:133026033-133026055 CCTGCTTCTTCCCTAGACAGGGG + Intronic
1048914149 8:139165662-139165684 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1049623346 8:143609154-143609176 CCTGCTGCTCCCCATGAGAGGGG + Intronic
1052496260 9:29229514-29229536 CCTGATTCTCCCTTTGAAACGGG - Intergenic
1055386852 9:75771865-75771887 CCATTTACTCCCCTGGAAAGGGG - Intergenic
1058029249 9:100177277-100177299 CCATTCTCTCCCCTGGAAAGGGG + Intronic
1060218624 9:121752991-121753013 TCAGTTTCTCCCCTGTAAAGCGG + Intronic
1060274202 9:122169986-122170008 TCAGTTTCTCCCCTTCAAAATGG + Intronic
1061577922 9:131519166-131519188 CCAGTTTATCCCCGTGCAAGTGG + Intronic
1061902171 9:133678511-133678533 CCAGCTCCTCCCCAGAAAAGTGG - Intronic
1062083125 9:134634907-134634929 TCAGGTTCTCCTCTGGAAAGTGG - Intergenic
1062092182 9:134684104-134684126 GCAGCCCCTCCCCTTGGAAGTGG - Intronic
1062400462 9:136370425-136370447 CCAGCTTCCCCTCCTGAAGGGGG + Exonic
1203520915 Un_GL000213v1:43986-44008 CCAGCTGCTCCGCCTGACAGGGG + Intergenic
1203687270 Un_GL000214v1:6926-6948 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1203755364 Un_GL000218v1:120832-120854 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1203714735 Un_KI270742v1:133372-133394 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1203536468 Un_KI270743v1:44719-44741 CCAGGTTCTCCTTTTGAAATGGG + Intergenic
1203649005 Un_KI270751v1:97127-97149 CCAGGTTCTCCTTTTGAAATGGG - Intergenic
1185911124 X:3982169-3982191 CCACTTACTCCCCTGGAAAGGGG + Intergenic
1188161481 X:26809599-26809621 CCATCTACTCCACTTGGAAGAGG + Intergenic
1189561727 X:42197797-42197819 TCAGCTTCCTCCCTTGAAACGGG - Intergenic
1191005052 X:55702574-55702596 CCATCCACTCCCCTGGAAAGGGG + Intergenic
1191969646 X:66799183-66799205 CCATTTACTCCCCTGGAAAGAGG + Intergenic
1193046518 X:77060310-77060332 TCAGCTTCTTCCCTTTAAAGTGG - Intergenic
1194559519 X:95403551-95403573 CCATTCTCTCCCCTGGAAAGGGG + Intergenic
1194771776 X:97915411-97915433 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1195435941 X:104843393-104843415 CCATCCACTCCCCTGGAAAGGGG - Intronic
1195491087 X:105470740-105470762 CCAGCTTCTGCCTTGGTAAGAGG - Intronic
1195720756 X:107865599-107865621 CCAGTTTCTCCCCTTATATGGGG - Intronic
1196635083 X:117992968-117992990 CCAGTTTCTCACCTTCAAGGTGG + Intronic
1197124534 X:122928834-122928856 GCAGATTCTCCCCTTGGTAGAGG - Intergenic
1197191070 X:123648465-123648487 CCATCCACTCCCCTGGAAAGGGG + Intronic
1198518969 X:137433529-137433551 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1198970916 X:142278644-142278666 ACAGCTTGTCACATTGAAAGTGG - Intergenic
1200046450 X:153405351-153405373 CCAGCTACACCTCTTGAAAGGGG - Intergenic
1200664105 Y:5999106-5999128 CCATTTACTCCCCTGGAAAGGGG + Intergenic
1201644078 Y:16208278-16208300 GCATCAACTCCCCTTGAAAGTGG + Intergenic
1201658737 Y:16377043-16377065 GCATCAACTCCCCTTGAAAGTGG - Intergenic
1202096315 Y:21251281-21251303 CCATTTACTCCCCTGGAAAGAGG - Intergenic