ID: 1124168327

View in Genome Browser
Species Human (GRCh38)
Location 15:27349534-27349556
Sequence TCCTTGGCTTCCACTCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124168325_1124168327 1 Left 1124168325 15:27349510-27349532 CCACAAAAGTCACAAAGGTTGGT 0: 1
1: 0
2: 2
3: 13
4: 155
Right 1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG 0: 1
1: 0
2: 1
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124168327 Original CRISPR TCCTTGGCTTCCACTCTCAA TGG Intronic
900192376 1:1356899-1356921 GCCCTGGCTTCCCCACTCAAGGG - Intronic
901741890 1:11347214-11347236 TCCCAGGCTTCCACTCTGCATGG - Intergenic
902664698 1:17929355-17929377 TCCATCGCTGCCACCCTCAATGG + Intergenic
903280748 1:22248628-22248650 CCCAGGGCTTCCACTCTCATGGG - Intergenic
904596182 1:31647147-31647169 TCCTTGGCTTCAACTCCCTGGGG + Intergenic
905251999 1:36655366-36655388 TTCTTCGCTTCCACACACAATGG + Intergenic
905263877 1:36738075-36738097 TCCTTTGCTACCACTCACCATGG - Intergenic
905583201 1:39097836-39097858 GCATTGGCCACCACTCTCAAGGG + Intronic
907706915 1:56840274-56840296 TCCTCTGCTTCCACTTACAATGG + Intergenic
907936884 1:59049397-59049419 TCCTTCTCTTCCTCTCTCAGTGG - Intergenic
908905594 1:69005351-69005373 TGCTTAGATTCCTCTCTCAATGG + Intergenic
913939818 1:125090969-125090991 TCCTTGAGTTCTGCTCTCAAAGG + Intergenic
914239351 1:145842217-145842239 TTCTTTCCATCCACTCTCAAGGG + Intronic
915361042 1:155286530-155286552 TCCTTGGATTTCACTGTCTAAGG - Intronic
916269975 1:162930016-162930038 TCCTTGGCCTCCATTATCATCGG - Intergenic
916463394 1:165048975-165048997 TACTAGGCTTCCCCTCTGAAGGG + Intergenic
919396982 1:197062909-197062931 TTCTTGTCTTCCACTTTCAGTGG + Exonic
920366224 1:205449730-205449752 TCCTTTCCTTCCTCTCTCATGGG + Intronic
920599541 1:207309790-207309812 TCCTTGGCTATCAGTCTGAAGGG - Intergenic
921880264 1:220247529-220247551 TCCTTAGCTTCCACTTACAAGGG - Intronic
922614792 1:226955363-226955385 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614797 1:226955379-226955401 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614802 1:226955395-226955417 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614806 1:226955411-226955433 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614813 1:226955443-226955465 TCCTTGGCTGCCACTCTCCCTGG + Intronic
922614820 1:226955475-226955497 TCCCTGGCTGCCACTCTCTCTGG + Intronic
922614829 1:226955521-226955543 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614857 1:226955630-226955652 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614872 1:226955678-226955700 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614885 1:226955724-226955746 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614901 1:226955786-226955808 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614923 1:226955880-226955902 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922614953 1:226956004-226956026 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614964 1:226956052-226956074 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922614998 1:226956196-226956218 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615009 1:226956242-226956264 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615017 1:226956274-226956296 TCCCTGGCTTCCACTCTCCCTGG + Intronic
922615030 1:226956338-226956360 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615054 1:226956434-226956456 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615065 1:226956480-226956502 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615081 1:226956542-226956564 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615103 1:226956636-226956658 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615114 1:226956682-226956704 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615156 1:226956868-226956890 TCCCTGGCTCCCACTCTCCCTGG + Intronic
922615178 1:226956962-226956984 TCCCTGGCTGCCACTCTCCCTGG + Intronic
922615219 1:226957148-226957170 TCCCTGGCTTCCGCTCTCCCTGG + Intronic
923227616 1:231953793-231953815 CCTTTGGCTTCCATTTTCAAAGG + Intronic
1064890647 10:20168442-20168464 TCCTGTGGTTCCACTCTGAAGGG - Intronic
1067348694 10:45456529-45456551 TCCAGGGCTTCCACTCTGAAAGG + Exonic
1068070077 10:52184024-52184046 TCCTGGGCTTCCAGTCACCATGG + Intronic
1068573797 10:58660704-58660726 TCCTTGGCTACCAGTCTCATAGG + Intronic
1070815596 10:79321018-79321040 GCCTTGGCTTCCTCTCCCCAAGG + Intergenic
1072576287 10:96703578-96703600 TTCTTTGCTTCAAATCTCAATGG - Intronic
1072718228 10:97765562-97765584 GCCTTGGCTTCCGCTCCCAGAGG - Intergenic
1074618188 10:115092238-115092260 TGTTTGGCTTCCTTTCTCAAGGG + Intergenic
1075085446 10:119411489-119411511 CCCTTGTCTCCAACTCTCAAAGG - Intronic
1076569128 10:131420825-131420847 TCTGTGGCTTCCATTCTCCATGG + Intergenic
1078043935 11:7895854-7895876 TCCTTATCTTCCAGTCTCCATGG - Intergenic
1079016455 11:16873037-16873059 TCCTTGGGTTAAAGTCTCAAAGG + Intronic
1080245161 11:30171842-30171864 TCCTTGGCTACCTCTCTGGATGG - Intergenic
1080450838 11:32377603-32377625 TCCTTGGTTTCTTCTCTCAGAGG - Intergenic
1083565230 11:63709348-63709370 TTTCTAGCTTCCACTCTCAAGGG - Intronic
1084158969 11:67334278-67334300 TCCTGGGCTCCCAGGCTCAAAGG + Intronic
1085483019 11:76838254-76838276 GCCCTGGCTTCCATTCTCAGTGG + Intergenic
1085762514 11:79254492-79254514 TCCTTAGCTGCCTCTCTCCAAGG - Intronic
1088200695 11:107330369-107330391 TTCTTGTATTCCACTCACAATGG + Intronic
1088417359 11:109604616-109604638 TCCTTGGCTTCAACTCTCAGCGG + Intergenic
1090376180 11:126291275-126291297 TGCTTGGCTTCTCCTCTAAATGG - Intronic
1092783058 12:12005025-12005047 TCCTTATCATCCATTCTCAAGGG - Intergenic
1094424462 12:30304125-30304147 TCCCTGGGTTCCAGTCTAAAAGG + Intergenic
1096114307 12:49046370-49046392 CCCCTGGCTTCCACTGTGAATGG - Exonic
1096606354 12:52769146-52769168 TCCTTGGCTTCCAGTTTCCCAGG - Intronic
1097342258 12:58452697-58452719 TTCTTGGTTACCACTCGCAAGGG + Intergenic
1100303942 12:93333325-93333347 TCCCTGGATTCGACTCTCTATGG - Intergenic
1100575997 12:95892048-95892070 TCCCTGGTTTCCCCTCTCCAAGG + Intronic
1104991217 12:132624845-132624867 TCCTTGGCCTCCTCTCTGAGTGG - Intronic
1107562050 13:41565999-41566021 CCCTTGGATTCCACTTCCAAAGG + Intergenic
1108472283 13:50779550-50779572 TGCCTGGCATCCACTCTCAAAGG - Intronic
1115198215 14:30825031-30825053 TCCTTCACTGCCACTCTCCAAGG - Intergenic
1115834344 14:37381234-37381256 TCCTTACCTTCTACTCTCATTGG + Intronic
1118289461 14:64505889-64505911 TCCTTGGGTTCGAGTGTCAAAGG - Intronic
1118724308 14:68617885-68617907 TCTTTGGCTTCAAATCCCAAGGG + Intronic
1121473338 14:94173932-94173954 TCCTCTGCTTCCGCTCTCATTGG + Intronic
1121993265 14:98581967-98581989 CCCCTGGCTTCCACCCTCAGGGG + Intergenic
1123967892 15:25477394-25477416 TCATTGTCTTCCAGTCTCAAAGG + Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG + Intronic
1126935045 15:53697477-53697499 TCCTGAGCTTCAACTCTCACTGG + Intronic
1127020515 15:54742423-54742445 TCCTGGGCTTCCAGTCACCACGG - Intergenic
1127614281 15:60668102-60668124 TCCTTGGCTGCTGCTCTCAGGGG + Intronic
1127835760 15:62789630-62789652 TCCCTCCCTCCCACTCTCAAGGG + Intronic
1130394522 15:83490410-83490432 ACCTTGGCTTCCTCTCTGAGAGG - Intronic
1130546360 15:84859691-84859713 TCCTTGGACCCCACTCTCAGAGG - Intronic
1131700442 15:94929692-94929714 TCCCTGGCTTCCCCTCTTAAGGG - Intergenic
1132497515 16:270861-270883 GCCCTGGCTGCCACTCTCGATGG - Intronic
1137477034 16:48818025-48818047 GCCTTGGCTTCGATTCTCAGCGG - Intergenic
1137515404 16:49139113-49139135 TCCTGGGCTTCCTTTCTCCAAGG - Intergenic
1140690794 16:77481486-77481508 TCCTTGGCTCCCACCCTGAAAGG - Intergenic
1141669509 16:85484510-85484532 TCCCTGGCTTCGTCACTCAAGGG - Intergenic
1143419494 17:6777731-6777753 TCCTTGCCTTTCTCTCCCAAGGG - Intronic
1144422422 17:15110447-15110469 TCCTCGGCTCCAACTCTCACTGG - Intergenic
1145268087 17:21390064-21390086 TTCTTGGCTTTCTCCCTCAAGGG + Intronic
1146517383 17:33499819-33499841 TCTGTGGCCTCCATTCTCAAAGG - Intronic
1149684849 17:58529388-58529410 CCCTTGGCTCCCACCCTCCAAGG + Intronic
1150170401 17:62987678-62987700 TCCTGGACTTCCAGTCACAACGG + Intergenic
1151698035 17:75727983-75728005 ACCTTCCCTTCCATTCTCAAGGG + Intronic
1151950494 17:77350898-77350920 TCCTTGTCTTTCACTCTGCAGGG - Intronic
1152336832 17:79703486-79703508 TCCTGGCCTTCCAGACTCAACGG + Intergenic
1154014544 18:10604782-10604804 TTCATGGCGTCCCCTCTCAAGGG + Intergenic
1155404961 18:25477731-25477753 TTCCTGGCTGCCAATCTCAATGG + Intergenic
1156763887 18:40627824-40627846 TCCCTGTCATCCAGTCTCAAAGG + Intergenic
1156799571 18:41093122-41093144 TCCATGTCTTCAACTCACAAAGG + Intergenic
1157792253 18:50543046-50543068 TCCCTGGCTTCTCCTCTCAGAGG + Intergenic
1158514387 18:58119230-58119252 TCCCAGGCTTCCACTCTCCATGG - Intronic
1160254728 18:77238884-77238906 CCCTTGGCTTCCTCGCTCCAAGG - Intergenic
1160953057 19:1676689-1676711 TCCTTTCCTCCCACACTCAAGGG - Intergenic
1162908480 19:13836981-13837003 CCCTTGGCTTCCTCTCCCCATGG - Intergenic
1163323590 19:16588777-16588799 CCTTCGGCTTCCTCTCTCAATGG - Intronic
1164846583 19:31437871-31437893 TCCATGGCTGCCACTCACCATGG + Intergenic
1165821205 19:38677229-38677251 TCCTTGGCTCTCCCTCTCGAGGG + Intronic
1167519873 19:49948053-49948075 TCCTTCTCCTCCACTCTAAAGGG - Intronic
1168374748 19:55867349-55867371 TGCTTGGCTTACAGTCTCTAGGG - Intronic
926829862 2:16950033-16950055 TCCTGGGGTCCCATTCTCAATGG + Intergenic
928911287 2:36424326-36424348 TACATGGTTCCCACTCTCAAAGG - Intronic
930805964 2:55490833-55490855 TCCTTAGCTTCCGCTCTTCATGG + Intergenic
931144336 2:59500650-59500672 TGCTTCACTTCCACTCTCATGGG + Intergenic
933263941 2:80160828-80160850 TCCTTGGTTTCCAATCTTATAGG + Intronic
935714590 2:105928815-105928837 TTCTTGGCGTCCAGTCCCAAGGG - Intergenic
937036556 2:118786980-118787002 TCCTGGGTTTCCATTCCCAAAGG + Intergenic
937502067 2:122489934-122489956 TCCTTGGCTTCCTCTCCCCATGG - Intergenic
938139404 2:128783679-128783701 ACCATGGTTTCCACTCTCAAGGG + Intergenic
938742265 2:134244112-134244134 AGATTTGCTTCCACTCTCAAAGG - Intronic
938760885 2:134424816-134424838 TTCTTGGCTTGCAGCCTCAAAGG + Intronic
939541423 2:143498745-143498767 TCATTGTCTTCTTCTCTCAATGG + Intronic
940329996 2:152464404-152464426 TGTTTGGCTTCCACTCTTCAGGG + Intronic
941934271 2:170971111-170971133 TTCTTGCCGTCCACTCTCCATGG + Intergenic
942081116 2:172400359-172400381 TTCCTTTCTTCCACTCTCAAGGG + Intergenic
942990178 2:182191230-182191252 TCCTTGGCTTCCAGTGCGAATGG + Intronic
943715686 2:191150309-191150331 TTCTTTGCTTTCACTCTCTAGGG + Intronic
944059404 2:195556543-195556565 TTCTTTCCTTCCATTCTCAAAGG + Intergenic
947734585 2:232448087-232448109 TCCTTGGCCAACACTCTGAATGG + Intergenic
948321415 2:237072662-237072684 TGCTTGATTTCCACTATCAAAGG + Intergenic
1169252959 20:4074219-4074241 ACCTTGGCTTCCCCTTTAAAGGG - Intronic
1169350597 20:4865089-4865111 ACCTTTGCTTCCCCTCTCACAGG + Intronic
1173284683 20:41659517-41659539 CCCTTGGCTTCCTCTCTTTAGGG + Intergenic
1174840755 20:53899291-53899313 TCCTTGGTTCCCACTCCCATGGG - Intergenic
1175468853 20:59211281-59211303 TCCCTGGCTCCCATTTTCAAAGG + Intronic
1180169469 21:46050410-46050432 CCCTTGGCATCCTCTCTCATTGG + Intergenic
1182739272 22:32555297-32555319 TCCTTGTGTTCCTCTCTCAGGGG - Intronic
1183183105 22:36274787-36274809 TCCTTGGATTCCCTTCTCACTGG - Intergenic
1184232906 22:43168193-43168215 TCGTTGGCCTCCACTCTGCAGGG + Intronic
1184857239 22:47153084-47153106 TCTGTGGCTTCCATTCTCAGAGG + Intronic
1185213556 22:49585875-49585897 GCCCTGGTTTCCCCTCTCAAGGG - Intronic
949526564 3:4910456-4910478 TCCTTGTCTACCTCTCTCAAGGG - Intergenic
953432828 3:42853877-42853899 TCCTTGGCTTCATATTTCAAAGG + Intronic
953878416 3:46679287-46679309 TCCCTGGCTTCCTCTCCCCAAGG - Exonic
955077593 3:55628638-55628660 TCCTTGGATTCCAGTCCTAAAGG + Intronic
959374842 3:105576508-105576530 TTCTTGGTTTCCACTTGCAATGG + Exonic
960533914 3:118795551-118795573 TCCATGGCCTCCACGATCAATGG + Intergenic
960975472 3:123169741-123169763 CCTTTGTCTTCCACTCTCACTGG - Intronic
961034139 3:123630550-123630572 TACCTGGCTTCCAATCTCACTGG - Intronic
961627900 3:128276174-128276196 GCCCTGACTTCCACTGTCAAGGG - Intronic
962357719 3:134709161-134709183 TCCTCGGCCTCCTCTCTCATGGG - Intronic
962671493 3:137713478-137713500 TACTTGGCTTCCAATCTAGAAGG - Intergenic
968943846 4:3653455-3653477 TGTCTGCCTTCCACTCTCAAAGG - Intergenic
970436679 4:16042422-16042444 TCCTTGTCTTCCACTTTGAATGG - Intronic
971584178 4:28383840-28383862 TCCTTGGCTCCCACCCTAAAGGG - Intronic
971910627 4:32792340-32792362 TCCGTGGCTTTCAATCTCATAGG + Intergenic
973096490 4:46207797-46207819 TTCTTAGCCTCCACTCCCAAAGG - Intergenic
975111033 4:70626688-70626710 TCCTTTGCCTCCACTCTTTAAGG - Intergenic
975989545 4:80243379-80243401 TCTTTGTTTTCCACTCTCCATGG + Intergenic
977381536 4:96280224-96280246 TCATTGGCCTTCACTCTCTAAGG + Intergenic
979346015 4:119587922-119587944 TCCTTGGCCTCCACACTCCATGG + Intronic
981243068 4:142501935-142501957 TCCTTGACTTCCATGCTCACGGG - Intronic
982473597 4:155824003-155824025 TCCTTGGCATTCAATCTCCATGG + Intergenic
985702867 5:1384049-1384071 TCCTGGGCCTCCGGTCTCAAGGG + Intergenic
990301986 5:54458558-54458580 TCCAGGGCTGCCACTCTCACAGG + Intergenic
990349568 5:54902041-54902063 TCCTTGGCTTCTTCTTTCACGGG - Intergenic
992177458 5:74164615-74164637 TGCTTGGCTTCCTCTCCCTAAGG + Intergenic
993039376 5:82794908-82794930 TCCCTGACTACCATTCTCAATGG + Intergenic
994176562 5:96718218-96718240 TTCTTGGCTTCCTCTCTTTAAGG + Intronic
996507970 5:124288932-124288954 TCCTTATTTTCCACTATCAAGGG + Intergenic
996590122 5:125137637-125137659 TCATTGGCGTCCAATCCCAATGG + Intergenic
999445777 5:151638113-151638135 TCCGTGGCTTCCCCTCTAAGTGG + Intergenic
1001192553 5:169644158-169644180 TCCTTGGCTTTTACTCTGAATGG + Intronic
1001897931 5:175397340-175397362 TCCATGGCTTGCACTCTCACGGG - Intergenic
1002213292 5:177610833-177610855 CCCTTGCCTCCCACTCTCATGGG - Intergenic
1003036683 6:2646119-2646141 TCCTTGCCTTCCACTTGGAATGG + Intergenic
1004872656 6:19922868-19922890 TCCTTGGCTGCCACTAATAAAGG + Intergenic
1005497308 6:26398996-26399018 TCATTGTCTTCCATTCTGAAAGG - Intergenic
1005502089 6:26437495-26437517 TCATTGTCTTCCATTCTGAAAGG - Intergenic
1006212941 6:32412745-32412767 TCCTTTGCTGCCACTCTGAGAGG - Intergenic
1006402890 6:33828071-33828093 ACTTTGGCTTCCACTCTGAGTGG - Intergenic
1006599535 6:35216258-35216280 TCCAGGGCTTCCACTTTCATTGG + Intronic
1008130197 6:47712436-47712458 TCCTTGAGCTACACTCTCAATGG - Exonic
1013603969 6:111731102-111731124 TCCTCGGCTTTCATTCTCAGCGG - Intronic
1017529590 6:155275535-155275557 TTCTTGGCTCCTACTCTAAAGGG + Intronic
1018225926 6:161628831-161628853 TCATTGGCTTCCTGCCTCAAGGG - Intronic
1021767877 7:23967668-23967690 TCCTTTGCTGCCACTCTTCAAGG - Intergenic
1022465877 7:30653023-30653045 CCCTTGGCCTCCACACTCAGTGG - Intronic
1024405008 7:48969183-48969205 TCCTAGTCATTCACTCTCAAGGG + Intergenic
1024541709 7:50480160-50480182 TCGATGGCTTCCAATCTCCAGGG + Intronic
1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG + Intergenic
1027802019 7:82766182-82766204 GCCAAGGCTGCCACTCTCAAAGG - Intronic
1028123927 7:87089539-87089561 TCCTTGGCCTCCCTTTTCAAAGG - Intergenic
1028318707 7:89435393-89435415 ACCATGGCTGCCAATCTCAAAGG + Intergenic
1028747249 7:94341246-94341268 CCCTTAGCATCCATTCTCAAGGG + Intergenic
1029544525 7:101203213-101203235 TCTTTGACTTCCACCCTCACAGG - Intergenic
1032358695 7:131234421-131234443 TCCTAGGCTTCCAGTCTCCAGGG + Intronic
1034270579 7:149801822-149801844 GCCTGGGCTTCCAGCCTCAAGGG + Intergenic
1035616839 8:1008605-1008627 ACATTGGCTTCCACTGACAAAGG - Intergenic
1036558684 8:9883584-9883606 TCCTTGGTTTCCAGACTCATGGG - Intergenic
1037910647 8:22741794-22741816 TGCTTGGCTTCCAGTCCCCATGG + Intronic
1040636850 8:49285077-49285099 TCCTTTGCCTCCAATCTTAAAGG - Intergenic
1041397067 8:57402271-57402293 TTTTTGGCTTACACTCTTAAGGG - Intergenic
1041589779 8:59564415-59564437 TCCATGGCTTCTACTTTAAAGGG + Intergenic
1042965781 8:74350498-74350520 GCCTTGCCTTCCGCCCTCAAGGG - Exonic
1043954716 8:86346774-86346796 TCCTTGGATACCACTATAAAGGG - Intronic
1044279001 8:90334982-90335004 ATCTTGGCTTCCACTCTCTTTGG - Intergenic
1045787718 8:105942012-105942034 TCCTTTCCTTTCACTCTCAAAGG + Intergenic
1046355295 8:113076304-113076326 TCTTTTGCTGCCACTGTCAAGGG + Intronic
1046479128 8:114791811-114791833 TCCTTGGGTTTCACAGTCAAAGG - Intergenic
1046549678 8:115699044-115699066 GCCTTGTCTTCAACTTTCAAAGG - Intronic
1048514865 8:135097182-135097204 GCCTGGGCTTCCACTCTCATGGG + Intergenic
1049307600 8:141913866-141913888 TCCTGGGCGTCCACTCTAAAGGG - Intergenic
1056769319 9:89465414-89465436 TCTTTGACTTCCCCTCTGAAGGG - Intronic
1057692190 9:97295125-97295147 TCCTGGGCTTCCTAGCTCAAGGG - Intergenic
1060489463 9:124071831-124071853 TCCTTTGCTTCTACTGTCTATGG + Intergenic
1060600767 9:124875952-124875974 TCCTTGGCCTCCCCTCTCCTGGG + Intronic
1185595460 X:1303998-1304020 TCCTCGGCTTCCTCTTTAAAAGG + Exonic
1185764828 X:2716832-2716854 TGATTGGCTTCCATTCTCAGAGG + Intronic
1186189660 X:7056243-7056265 TCCCTGGCCACCACCCTCAAAGG - Intronic
1187448067 X:19374961-19374983 TCCTGGGCTTCCTCTCTGCATGG - Intronic
1192484624 X:71514359-71514381 TCTTTTCCTTCCCCTCTCAATGG - Intronic
1192864651 X:75117856-75117878 TCTTTGCCTTCCCCTCCCAATGG + Intronic
1194073939 X:89364652-89364674 TCCCTGTCTCCCACTCTCTATGG - Intergenic
1194185136 X:90765853-90765875 ACCTTGGCTTCACCTTTCAATGG - Intergenic
1195605757 X:106803596-106803618 TCTTTGGGATCCCCTCTCAAAGG + Intronic
1196083359 X:111657531-111657553 CCCATGCCTTCCAATCTCAAGGG - Intergenic
1197283441 X:124565529-124565551 TCCATGGCTACCACACTCCATGG + Exonic
1200729327 Y:6716205-6716227 TCCCTGTCTCCCACTCTCTATGG - Intergenic