ID: 1124170182

View in Genome Browser
Species Human (GRCh38)
Location 15:27366213-27366235
Sequence TGGACTCGGGAGATGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124170174_1124170182 18 Left 1124170174 15:27366172-27366194 CCGATTGCTCTTCTAGTTTAAAT 0: 1
1: 0
2: 1
3: 24
4: 282
Right 1124170182 15:27366213-27366235 TGGACTCGGGAGATGGCAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124170182 Original CRISPR TGGACTCGGGAGATGGCAGA AGG Intronic
900466200 1:2826667-2826689 TGGACGAGGGAGATGGCCCAGGG - Intergenic
900837201 1:5014099-5014121 TTGACTCTGCAAATGGCAGAAGG - Intergenic
903451533 1:23456826-23456848 GAGTCTGGGGAGATGGCAGAGGG + Intronic
905375194 1:37515201-37515223 TGAACTAGTGAGGTGGCAGAAGG - Intergenic
906442171 1:45857741-45857763 TGGAGTCGGGGGAGGGGAGAGGG - Intronic
910466852 1:87509329-87509351 TGGAGTAGGGAAATGGCAGGAGG + Intergenic
917729205 1:177857519-177857541 TGGAAACGGCAGGTGGCAGATGG - Intergenic
918006543 1:180546788-180546810 TGAACCTGGCAGATGGCAGATGG - Intergenic
920891655 1:209993031-209993053 TGGACATGCGAGCTGGCAGAGGG + Intronic
920916682 1:210263268-210263290 TGCACTTGGGAGAAGGGAGAGGG - Intergenic
922686185 1:227640291-227640313 TTGACTGGGAAGATGGCAGCTGG + Intronic
922821998 1:228490968-228490990 TGGCCATGGGAGATGGGAGAGGG + Intronic
923347340 1:233066996-233067018 TTGACTCTTGAGATGGGAGAGGG - Intronic
923380364 1:233411325-233411347 TGGAGTCTGCAGAGGGCAGAAGG - Intergenic
924549314 1:245060120-245060142 TGGAGTCTGGGGATGGCAAAGGG + Intronic
1063383086 10:5598771-5598793 TGAACTCTGGAGAGGGCAGATGG + Intergenic
1066950817 10:42113707-42113729 TGGACACGGTAGATTGAAGATGG - Intergenic
1067032167 10:42885389-42885411 TGGACCCTGCAGAGGGCAGAGGG + Intergenic
1067668675 10:48300415-48300437 TGGGCTTGGGAAAAGGCAGAGGG - Intergenic
1069772544 10:70908774-70908796 TGGACTGGGAAGAGGGCAGACGG - Intergenic
1071755598 10:88535375-88535397 TGGAAACGGGAGAGGGAAGAAGG + Intronic
1074434027 10:113418486-113418508 AGGACCTGGGAGATGGCAGGGGG + Intergenic
1074677612 10:115869475-115869497 TGGACAGGGGAGGTGGAAGAGGG + Intronic
1076134483 10:128036143-128036165 TGGGCTCGGGGGAGGGCAGAAGG - Intronic
1076273185 10:129174543-129174565 TGGAGTGGGCAGATGGCAGCAGG - Intergenic
1076491857 10:130867133-130867155 TGGAACCGGCACATGGCAGAGGG + Intergenic
1076776894 10:132702947-132702969 TGGACGTGGGAGCTGGCAGAGGG + Intronic
1080610746 11:33901695-33901717 AGGAGACGGGAGAGGGCAGAGGG - Intergenic
1083436138 11:62644741-62644763 TGAACTCGGGAGGTGGAAGCTGG + Intronic
1083594245 11:63911510-63911532 TGGAGTGGGGAGAGGGCAGTTGG - Exonic
1083752820 11:64770562-64770584 TGGAATGGGGAGATGGAAGCTGG + Intronic
1083880968 11:65548089-65548111 TGCCCTGGGGATATGGCAGAAGG - Intronic
1084151557 11:67289948-67289970 CTGACCAGGGAGATGGCAGAGGG - Intronic
1084408818 11:68994312-68994334 TGGACTTGGGAGAGGGCAAGTGG + Intergenic
1087936384 11:104038187-104038209 TGGACAAGGGAAATGGAAGAGGG - Exonic
1088554902 11:111051921-111051943 TGGGGTCGGGGGAGGGCAGAGGG + Intergenic
1088991873 11:114960891-114960913 TGGATTTGGGAGATGGGAGTGGG + Intergenic
1090480428 11:127062797-127062819 TGAACTCCAGAGATGGCAAATGG + Intergenic
1090532426 11:127605044-127605066 TGAACTTGGGAGATGGGAAACGG - Intergenic
1091593187 12:1857535-1857557 TGTACTCAGCAGATAGCAGAGGG + Intronic
1091663748 12:2403695-2403717 TGGACTGGAGAGATGGAGGAGGG - Intronic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1093333760 12:17875270-17875292 AGAACTTGGGAGATAGCAGAGGG + Intergenic
1094547599 12:31419367-31419389 TGAACTCGGGAGGTTGCAGTGGG + Intronic
1096230188 12:49892434-49892456 TGGGCTCGGAAGATGGAGGAGGG - Intronic
1097250503 12:57630070-57630092 TGGAGTGGGCAAATGGCAGAGGG - Intronic
1097279542 12:57836188-57836210 TGGACTTGGGAGAAGGTATAGGG - Intronic
1098453954 12:70651334-70651356 TTGAATCTGGAGATGGGAGATGG - Intronic
1098604170 12:72370277-72370299 TGGACTGGAGAGATGGCAGTAGG - Intronic
1099288401 12:80744539-80744561 GGGACATGGGACATGGCAGAGGG - Intergenic
1101069020 12:101053525-101053547 TGGATTCTGGTGATGGCTGATGG + Intronic
1101175893 12:102151314-102151336 TGGGATGGGGGGATGGCAGAGGG + Intronic
1101249110 12:102914908-102914930 TGGATTCAGGTGATGGCAGTGGG - Intronic
1101859802 12:108473885-108473907 TGTATTCAGGAGATGGGAGAGGG - Intergenic
1104850358 12:131870191-131870213 TGAACCCAGGAGATGGCAGTGGG - Intergenic
1108103549 13:46983916-46983938 TGGACTCGGGATCTGGAAGATGG - Intergenic
1108172019 13:47751428-47751450 TGGACTAGGGTGATGACTGAGGG - Intergenic
1108180275 13:47833796-47833818 GGGAGTTGGGAGAAGGCAGAAGG + Intergenic
1109538793 13:63745876-63745898 TGGAGTGGGGAGAGGGGAGAGGG + Intergenic
1109545042 13:63833890-63833912 TGGAGTGGGGAGAGGGGAGAGGG - Intergenic
1110189718 13:72716314-72716336 GTGACTGGGGAGAGGGCAGAAGG + Intronic
1111012716 13:82331806-82331828 TGGAGTCGGGGGAGGGCGGAAGG - Intergenic
1111102220 13:83603250-83603272 TGCACTCTGGACATGGAAGAGGG + Intergenic
1113514504 13:110882459-110882481 TGGACTCGGCATCTGGTAGACGG + Intronic
1113933534 13:113981305-113981327 TGGCCTGGAGAGATGCCAGAGGG + Intronic
1116250227 14:42472798-42472820 TAGACTAGGTAGGTGGCAGAAGG - Intergenic
1119242885 14:73076675-73076697 TGGTCCTGGGAGATGGGAGAAGG + Intronic
1120266498 14:82257717-82257739 TTGACTTTGAAGATGGCAGAAGG + Intergenic
1120573220 14:86147718-86147740 TGGAATGGGGGGATGGCAGCAGG + Intergenic
1122084718 14:99291568-99291590 TGGCCTGGGGAGGTGGCAGTAGG - Intergenic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1124170182 15:27366213-27366235 TGGACTCGGGAGATGGCAGAAGG + Intronic
1124601154 15:31133790-31133812 TTGGCTCTCGAGATGGCAGATGG + Intronic
1125814881 15:42575693-42575715 TGGACTTGGGTTGTGGCAGACGG + Exonic
1127265725 15:57360026-57360048 TGAACCTGGGAGATGGAAGATGG + Intergenic
1127617132 15:60697404-60697426 TGTACTTGGAAGATGGAAGAAGG - Intronic
1127979560 15:64024688-64024710 TGGACTGGGCAGAGGGGAGAAGG - Intronic
1129350130 15:74951205-74951227 TGGATAGAGGAGATGGCAGAGGG - Intergenic
1131674925 15:94662113-94662135 TGCACTTGGTAGCTGGCAGAAGG + Intergenic
1132646740 16:1002697-1002719 TGGACTGGGGGGACGGCCGAGGG + Intergenic
1134847305 16:17450805-17450827 TGATCTAGAGAGATGGCAGATGG - Intronic
1135056712 16:19238091-19238113 TGGACTGGAGAGGTGGCAGAAGG + Intronic
1136065438 16:27755256-27755278 TGGACTCCAGAGATGGCATGGGG - Intronic
1138189047 16:54999403-54999425 TGGAGTGGGGAGAGGGCAGAAGG - Intergenic
1138621904 16:58218246-58218268 AGGACTCTAGACATGGCAGAAGG + Intergenic
1139198645 16:64950297-64950319 AGGACTCGGGAACTGGAAGAAGG - Intronic
1139289021 16:65840513-65840535 AGGAGGCAGGAGATGGCAGAGGG + Intergenic
1142108147 16:88317300-88317322 TGCCCTGGGGAGAAGGCAGAAGG - Intergenic
1142142736 16:88479782-88479804 TGGGATGGGGAGATGGGAGAGGG - Intronic
1142863609 17:2777616-2777638 TGGACCTGGGAGCTGGCTGAGGG + Intronic
1143284756 17:5780888-5780910 TGAAGTCTGGAGATCGCAGATGG + Intronic
1143360513 17:6365373-6365395 TGGAGGAGGGAGATGACAGAAGG + Intergenic
1143646593 17:8234456-8234478 TGGGCTGGGCAGAAGGCAGAGGG + Exonic
1145968466 17:28938690-28938712 TGGAATTGGGGGATGGGAGAGGG - Intronic
1146603551 17:34238669-34238691 AGGACTTGGAAGGTGGCAGAGGG + Intergenic
1146908427 17:36632605-36632627 TGGGGTGGGGAGATGGCAGTGGG - Intergenic
1147325425 17:39667540-39667562 CGGACCCGGGTGAGGGCAGAGGG - Intergenic
1147357064 17:39906462-39906484 TGAGCTGGGGAGATGGAAGATGG - Intronic
1147895867 17:43750981-43751003 TGGACAAGGGAGAAGACAGAGGG + Intergenic
1149234598 17:54575127-54575149 TGCCCTAGGGAGATAGCAGAGGG - Intergenic
1150304152 17:64070144-64070166 TGGACTCTTGATATGGCAGCGGG - Intronic
1151323923 17:73367462-73367484 TGCTCTCAGGAGGTGGCAGAGGG - Intronic
1151358950 17:73576994-73577016 GGGACCTGGGAGATGGCAGCAGG - Intronic
1151385225 17:73751181-73751203 TGGAGTCGGGAGGAGGCACAGGG - Intergenic
1155776939 18:29776563-29776585 TAGACACTGGAGATGCCAGAAGG - Intergenic
1157512837 18:48290805-48290827 TGGACTAGGGAGGTGGCAGGAGG - Intronic
1157719700 18:49914257-49914279 TGGAATGGGGAGCAGGCAGAAGG - Intronic
1158619660 18:59021664-59021686 TGGCCTCTGGATATGGCAGGTGG - Intergenic
1160954193 19:1682609-1682631 GGGACTGGGGAGATTGGAGAAGG - Intergenic
1161990363 19:7681139-7681161 TGGGCGCGCGAGATGGGAGAGGG - Intronic
1162378262 19:10317543-10317565 TGGGCTCGGGCGAGGGCAGCAGG + Exonic
1165953860 19:39489596-39489618 TGGACTTGGCAGAAGTCAGAAGG + Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1168525914 19:57088646-57088668 TGGACCCGGGAGAAGGCAAATGG + Intergenic
925825681 2:7846554-7846576 TGGACTTGGAAGGAGGCAGAAGG + Intergenic
925955730 2:8962012-8962034 TGCTCTGGGGAGCTGGCAGAAGG - Intronic
926397350 2:12457330-12457352 TGGATTCTGGAAATAGCAGATGG + Intergenic
926811556 2:16759398-16759420 TGGACAAGGCAGATGGCTGATGG - Intergenic
927252815 2:21013370-21013392 GGAACTCTCGAGATGGCAGATGG + Exonic
928249116 2:29659402-29659424 TGGGCTGGGGAGATGGCATAGGG + Intronic
928909225 2:36401983-36402005 TGTACTTAGGGGATGGCAGAAGG - Intronic
929790144 2:45016297-45016319 TGGTCTTGGTAGATGGCAGAGGG + Intergenic
930687399 2:54324464-54324486 TGGCATCAGGAGAAGGCAGAGGG - Intergenic
931164671 2:59733612-59733634 TGAACTCAGGAGATGGCTTAGGG - Intergenic
931244977 2:60484845-60484867 GGGTCTGGGGAGATGGGAGAAGG + Intronic
931431993 2:62215694-62215716 TGGCCTCGTGATATGGCAGGGGG + Intronic
931762845 2:65432240-65432262 GGGGCTCGGGAGCGGGCAGAGGG + Intronic
932132100 2:69197078-69197100 GGGAGACGGGTGATGGCAGATGG - Intronic
933235175 2:79856821-79856843 TGGACCAAGGAGATGGGAGAGGG - Intronic
934301527 2:91779408-91779430 TGAACTCGGGAGGTGGAAGTTGG + Intergenic
944752651 2:202726785-202726807 TGGGCTGGGGCGATGGGAGAGGG + Intronic
946449558 2:219768222-219768244 TGGACTTTGAAGATGGAAGAGGG + Intergenic
1169340219 20:4790646-4790668 TGGACCTGGGACATGGCACATGG + Intronic
1170643519 20:18176665-18176687 TGGAACCTGGTGATGGCAGAGGG + Intronic
1170837768 20:19899702-19899724 TGGCCTTAGGACATGGCAGATGG + Intronic
1173916004 20:46709438-46709460 GGGACCCGGGAGATGGCGGGTGG + Intergenic
1174255718 20:49253435-49253457 TGGACTAGGTAAATAGCAGAGGG + Intronic
1175745217 20:61451746-61451768 TGGACTCTGGACAGGGCAGGAGG + Intronic
1177356018 21:20008972-20008994 TGGTATCTGGAGATGGTAGAAGG + Intergenic
1177968450 21:27758988-27759010 TTGACTCCAGAGATGGCAGCTGG + Intergenic
1179645185 21:42771235-42771257 TGGGCCCGGGAGCTGGCAGGTGG - Intronic
1179795262 21:43778777-43778799 TGGCCTGGGGAGACGGAAGAGGG + Intergenic
1181085820 22:20438877-20438899 GGGACTTGAGAGCTGGCAGAAGG + Intronic
1181116056 22:20633148-20633170 TGGAGGAGGGAGAGGGCAGAGGG - Intergenic
1182284034 22:29233499-29233521 TGAAGTTGGTAGATGGCAGAGGG + Intronic
1183587644 22:38762372-38762394 TGGCCTGGGGAGAGGCCAGAAGG - Intronic
1183694765 22:39415476-39415498 TGGAAGAGGGAGAGGGCAGAGGG - Intronic
1183919525 22:41153668-41153690 TGAACCCGGGAGATGGAAGGAGG + Intronic
1184751413 22:46488516-46488538 TGGACTCGGCACAGGCCAGAGGG + Intronic
1184918661 22:47590467-47590489 TGGGATCATGAGATGGCAGATGG - Intergenic
1185375500 22:50481215-50481237 CGGACTCGGGAGGTGGTTGACGG + Intergenic
949862153 3:8515668-8515690 TGGAATCGGGAAATAGGAGACGG + Intronic
951117063 3:18876541-18876563 TGGACTTGGCAGGTGGCTGAAGG + Intergenic
954729767 3:52649842-52649864 TTGAATCGGGTGATGGCAAAAGG + Intronic
957962229 3:87271321-87271343 TGGCCTCGGGAGTTTGCAGCTGG - Intronic
963005178 3:140720423-140720445 TGTTCTCTGGAGCTGGCAGATGG - Intergenic
964590497 3:158358349-158358371 TAGACTAAGGAGATGGCAGTGGG - Intronic
966910859 3:184559280-184559302 AGGACTTGGGAGGGGGCAGAAGG - Intronic
967629236 3:191723913-191723935 TTGACTTGGAAGATGGAAGAAGG - Intergenic
969100901 4:4767585-4767607 GGGACTTGGGAGAGGGAAGAAGG + Intergenic
969670061 4:8585177-8585199 TGGAGACGGGGGAGGGCAGATGG + Intronic
969940748 4:10728666-10728688 TGAACCCGGGAGGTGGGAGATGG - Intergenic
971757435 4:30721329-30721351 AGGACTCGGGGGAGGGCAGGCGG + Exonic
972375134 4:38462786-38462808 TGGTCAGGGGAGATTGCAGAAGG - Intergenic
973158097 4:46982862-46982884 TGGACTAGGGATGTGGCAGTGGG + Intronic
973565084 4:52177686-52177708 TGGTCCCTGGAGAGGGCAGATGG + Intergenic
976365440 4:84228206-84228228 TGGACTAGGGTGGTGGGAGAAGG - Intergenic
976412609 4:84733476-84733498 TGGATGCTGGAGATGACAGAAGG - Exonic
976450287 4:85181691-85181713 GGGACTCGGGGGATGGGAGGGGG - Intergenic
977726757 4:100305015-100305037 TGCAGTTGGGAGATTGCAGATGG + Intergenic
978948269 4:114525262-114525284 TGGGCTGGGGAGAGGTCAGAGGG + Intergenic
981453033 4:144921017-144921039 TGGACTGGGGACATGGCCAAGGG + Intergenic
982884726 4:160764542-160764564 TGGACCCGGGAGGTGGGAGGCGG - Intergenic
984815033 4:183828240-183828262 TGGACTCGGAAACTGGCAGAGGG + Intergenic
984918911 4:184747162-184747184 TGGACTCAGCAGATGGCACCTGG + Intergenic
985683442 5:1269199-1269221 TGGGCTCTGGGGATGGCTGAGGG - Intronic
986063084 5:4209963-4209985 TGAACATGGGAGCTGGCAGAAGG + Intergenic
990610348 5:57450722-57450744 TGGACTTGGGTGATAGCAGTGGG + Intergenic
996397886 5:123031743-123031765 TGCACTGGGGTGGTGGCAGAAGG + Intronic
996909085 5:128634942-128634964 TGGAGCCAGGAGATGGGAGATGG + Intronic
997384486 5:133462059-133462081 TGGACTCAGGTGAGGTCAGATGG - Intronic
998430455 5:142065632-142065654 TGGCTTCCTGAGATGGCAGAGGG - Intergenic
999550359 5:152679782-152679804 TGAGCTAGGGAGATGGGAGATGG - Intergenic
1000179295 5:158792309-158792331 TGAACTTGGGAGCTCGCAGAAGG + Intronic
1002418771 5:179134853-179134875 TGGACCCGGGAGCTGGGAGCTGG - Intronic
1002418841 5:179135052-179135074 TGGACCCGGGAGCTGGGAGCTGG - Intronic
1004947478 6:20631487-20631509 TAGACATGGGAGATGACAGAGGG - Intronic
1006375625 6:33670280-33670302 AGGACACGGCAGATGGCAGCCGG - Intronic
1006851137 6:37099570-37099592 GGGAGTCTGGAGATGGGAGAGGG + Intergenic
1007424442 6:41737624-41737646 TGGAGTCGGAAAATGGCACAAGG + Intronic
1009561600 6:65252182-65252204 TGCACAGGGGAGATGGCAGAGGG + Intronic
1012500412 6:99881935-99881957 TGGACAGGGGAGAAGACAGAGGG + Intergenic
1016328609 6:142932017-142932039 AGGACTCAGGAGATAGCAAAAGG - Intronic
1017681767 6:156871612-156871634 AGGACTCTGGAGATGCCACATGG + Exonic
1018117468 6:160601386-160601408 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018118020 6:160606947-160606969 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018118637 6:160613411-160613433 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018119238 6:160618963-160618985 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018119841 6:160624509-160624531 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018120442 6:160630053-160630075 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018121640 6:160641145-160641167 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1018122242 6:160646693-160646715 TGGATTGGGCAGAAGGCAGAAGG - Intronic
1019496642 7:1343704-1343726 GGCAGTCGGGAGCTGGCAGAGGG - Intergenic
1020256808 7:6507056-6507078 GGGACCCAGGAGATGGCAGTGGG + Intronic
1020548911 7:9573096-9573118 TGGGGTGGGGAGAGGGCAGAAGG - Intergenic
1020652546 7:10893113-10893135 TGGACACGGAAGAAGGCAGGTGG - Intergenic
1021950276 7:25767526-25767548 AGGACTGGGTTGATGGCAGATGG + Intergenic
1022508027 7:30918804-30918826 TGGACTTGGGAGCTGGCAGAAGG - Intronic
1023054895 7:36283463-36283485 ATGACTTGGGAAATGGCAGATGG + Intronic
1023460592 7:40392134-40392156 TGGAGTGGGGAGATGGGGGAGGG + Intronic
1032782837 7:135177933-135177955 TGAACTCGGCAGTGGGCAGAAGG + Intergenic
1033246208 7:139718383-139718405 TGGACTAGGGTGATGGTTGATGG - Intronic
1033493183 7:141864545-141864567 TGGATTGGAGAGAGGGCAGAGGG + Intergenic
1033495439 7:141889206-141889228 TGGAATGGAGAGAGGGCAGAGGG + Intergenic
1036691124 8:10945402-10945424 TGAACTCGGGAGGTGGAAGTTGG + Intronic
1037326264 8:17694264-17694286 TGGACTAGGGTAATGGCAGGTGG + Intronic
1038344533 8:26719990-26720012 TGCACTGAGGAGATGGAAGAGGG - Intergenic
1040034005 8:42851178-42851200 TGGACTGCGGTGGTGGCAGAGGG + Intronic
1044490971 8:92814398-92814420 TGGGCTAGGGAGTTGGCAGTGGG + Intergenic
1044500169 8:92945339-92945361 TGGAATCTGGAGGTGGCAGGAGG - Intronic
1044521063 8:93199830-93199852 TGGGCTGGGGTGCTGGCAGATGG - Intergenic
1047900539 8:129416824-129416846 TGCACTGGGGAGATGGCAGAAGG + Intergenic
1048856753 8:138693045-138693067 TGGACTGTGGAGCTGGCGGAAGG - Intronic
1048879521 8:138861037-138861059 TGGAGTGGGGTGATGGCAGCAGG - Intronic
1049200294 8:141336783-141336805 GGGAGTCGGGAGAGAGCAGATGG + Intergenic
1049226200 8:141451696-141451718 TGGACTAGGGTGGTGGCAGCGGG + Intergenic
1049403718 8:142442469-142442491 TGGCCTTGGGAGAAGGCTGAGGG + Intergenic
1050307706 9:4322019-4322041 TGGGCTCGGGGGATGGGGGAGGG - Intronic
1052274651 9:26663615-26663637 GGGAGACGGGAGATGGGAGACGG - Intergenic
1053368644 9:37542150-37542172 TGGGCTCAGGAGATGGCAGGGGG - Intronic
1056099581 9:83287856-83287878 TCCACTGGGGAGATGGCAGTGGG - Intronic
1056578220 9:87871878-87871900 TGGACTTGAGGGATGGCAGGTGG - Intergenic
1057666229 9:97047568-97047590 AAGAGTCGGGCGATGGCAGAAGG + Intergenic
1058826261 9:108778378-108778400 GGGACTCGGGAAAAGGCAGTGGG + Intergenic
1058896930 9:109408619-109408641 TGGACTGTGGGGATGGCAGAGGG - Intronic
1059420243 9:114186141-114186163 TGGACTCTGGAGGAGGAAGATGG - Intronic
1059694778 9:116720813-116720835 TGGACTGGGGAGATATCAAAAGG - Intronic
1060158633 9:121338902-121338924 TGGACCTGGGAGACAGCAGATGG + Intergenic
1061806017 9:133138132-133138154 TGGCCTCTGGAGAGGGCACAGGG + Intronic
1061872394 9:133527919-133527941 TGGCCTGGGGAGCTGGGAGAGGG + Intronic
1062371450 9:136241254-136241276 TGGACTCGGGAGGATGGAGAGGG - Intronic
1186595591 X:10978440-10978462 TGGACTTGGTAGAGGACAGATGG - Intergenic
1186669784 X:11757655-11757677 TGGCCTCGGGCGAGGGCAGAAGG - Intergenic
1189283969 X:39838980-39839002 TGGCTTCGGGGGAAGGCAGAGGG - Intergenic
1193181656 X:78465566-78465588 GGGACTCGGGGGATGGGTGAAGG - Intergenic
1194767229 X:97855852-97855874 TGGATTAGGGAGTTGGCAGCAGG - Intergenic
1198191507 X:134311389-134311411 TGGGGTGGGGGGATGGCAGAGGG + Intergenic
1199843371 X:151673058-151673080 TGGAATCTGGTGATGGCAGTAGG + Intronic
1199976344 X:152897112-152897134 TGGACTAGGGTGGTGGCAGCAGG + Intergenic