ID: 1124172874

View in Genome Browser
Species Human (GRCh38)
Location 15:27392354-27392376
Sequence AGTCATCCCCAAAAATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124172874_1124172877 10 Left 1124172874 15:27392354-27392376 CCCTGACATTTTTGGGGATGACT 0: 1
1: 0
2: 5
3: 47
4: 354
Right 1124172877 15:27392387-27392409 TTTTTAGAATGCACCTCAATTGG 0: 1
1: 0
2: 3
3: 61
4: 375
1124172874_1124172878 11 Left 1124172874 15:27392354-27392376 CCCTGACATTTTTGGGGATGACT 0: 1
1: 0
2: 5
3: 47
4: 354
Right 1124172878 15:27392388-27392410 TTTTAGAATGCACCTCAATTGGG 0: 1
1: 0
2: 21
3: 164
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124172874 Original CRISPR AGTCATCCCCAAAAATGTCA GGG (reversed) Intronic
901214166 1:7545507-7545529 TGTAATCTTCAAAAATGTCAAGG - Intronic
901406205 1:9048054-9048076 AGCCAACCCCAAAATTGTCCTGG + Intronic
902363609 1:15956392-15956414 AGTCATTCTCAAAAAAGCCAGGG - Intronic
902456908 1:16539995-16540017 AGTCACCCCCAAAAATGTTTTGG + Intergenic
902495261 1:16867918-16867940 AGTCACCCCCAAAAATGTTTTGG - Intronic
904100622 1:28023612-28023634 AGTACTCCTCAAAACTGTCAAGG + Intronic
904699642 1:32350932-32350954 AGACATCCCCAAAAAAGTAGAGG - Intergenic
907063423 1:51454619-51454641 AGTATTCTTCAAAAATGTCAAGG + Intronic
908005353 1:59722101-59722123 AGTACTCCTCAAAAATGTCAAGG - Intronic
909340854 1:74529406-74529428 TGTCATCCTCAAAAATGTCACGG + Intronic
909484263 1:76156039-76156061 AGTACTCCTCAAAACTGTCAAGG - Intronic
910683213 1:89889266-89889288 AGTACTCCTCAAAACTGTCAAGG + Intronic
910953811 1:92679712-92679734 AGTACTCCTCAAAACTGTCAAGG - Intronic
912436423 1:109665171-109665193 AGGCATCCACCAAACTGTCAGGG + Intronic
912438513 1:109679893-109679915 AGGCATCCACCAAACTGTCAGGG + Intronic
915632885 1:157165528-157165550 AGTACTCCTCAAAACTGTCAAGG + Intergenic
915683057 1:157601196-157601218 AGTACTCCTCAAAACTGTCAAGG - Intergenic
915830821 1:159128300-159128322 AGTCATGCAGAAAAATGGCAGGG - Intronic
916248997 1:162717626-162717648 AGTAATCCTCAAAACTGTCAAGG - Intronic
916256938 1:162798422-162798444 AGTACTCCTCAAAACTGTCAAGG - Intronic
916588618 1:166168657-166168679 AGTCCTCTTTAAAAATGTCAAGG - Intergenic
917145931 1:171891631-171891653 AGTACTCCTCAAAACTGTCAAGG - Intronic
917341781 1:173986927-173986949 AGTGCTCCTCAAAACTGTCAAGG - Intronic
917466510 1:175282241-175282263 AGTAATCTTCAAAACTGTCAAGG + Intergenic
918201490 1:182271439-182271461 AGTACTCCTCAAAACTGTCAAGG + Intergenic
918279761 1:182992786-182992808 AGTAATTCTCAAAAATATCAAGG + Intergenic
918436396 1:184517826-184517848 ATTCATCCCCAAAGATCTCATGG + Intronic
918650591 1:186957408-186957430 AATCATCCCCACAAATGTGTTGG + Intronic
920906745 1:210177129-210177151 AGTCCTCCTCAAAACTGTCAAGG - Intergenic
921607081 1:217168352-217168374 TGTCCTCTTCAAAAATGTCAAGG - Intergenic
921802371 1:219416304-219416326 AGTACTCCTCAAAACTGTCATGG - Intergenic
922235968 1:223722966-223722988 AATATTCCCCAAAACTGTCAAGG - Intronic
923001843 1:230012635-230012657 ACCCATCCCCAAACCTGTCAGGG - Intergenic
923236378 1:232037078-232037100 AGACATTCCCAAGAATGACATGG - Intronic
1063640883 10:7829489-7829511 AATAATCCTCAAAACTGTCAAGG - Intronic
1064706868 10:18081946-18081968 AGACATCCCCAAATACCTCAAGG - Intergenic
1065166022 10:22977939-22977961 AGTACTGCCCAAAAATGTCATGG - Intronic
1065178538 10:23101969-23101991 AGTCCTCCCCAAAACTGTAAAGG - Intronic
1065645853 10:27833143-27833165 AGTCACCTCTAAATATGTCATGG - Intronic
1066295794 10:34053386-34053408 TGTAATCTTCAAAAATGTCAAGG + Intergenic
1066547807 10:36520073-36520095 AGTAATCTTCAGAAATGTCAAGG + Intergenic
1066723400 10:38364117-38364139 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1067074765 10:43170924-43170946 ATTCTTCCTCAAAACTGTCAGGG + Intronic
1067961892 10:50863598-50863620 TCTCATCCCCCAAAATATCATGG + Intronic
1068867501 10:61909941-61909963 AGTCAACCCATAAAAAGTCAGGG + Intronic
1069139345 10:64804039-64804061 AGTCTTCCCCAAAAAGATCTTGG - Intergenic
1069406423 10:68104669-68104691 AGTCATACAAAATAATGTCAGGG + Intergenic
1071175440 10:82921275-82921297 AGTAATTCTCAAAAGTGTCAAGG + Intronic
1071400205 10:85261373-85261395 AGTCAAACCCAAAGTTGTCATGG - Intergenic
1071814686 10:89220389-89220411 AGGCATCCTCAAAAATGTAGGGG + Intronic
1071924344 10:90388478-90388500 AGTCATGGCAAAAAATCTCATGG + Intergenic
1072315705 10:94200917-94200939 AGTAATTCTCAAAAATGTCAAGG + Intronic
1072707802 10:97694386-97694408 TGTATTCCTCAAAAATGTCAAGG + Intergenic
1073433881 10:103504362-103504384 AGTAATCCTCAAAACTGTCAAGG - Intronic
1074310735 10:112320948-112320970 AGTACTCCTCAAAAGTGTCAAGG + Intergenic
1075015889 10:118909790-118909812 CGTGGTCCCCAAAGATGTCAGGG + Intergenic
1076384538 10:130046864-130046886 TGTCACCCCCAGAAAGGTCAGGG - Intergenic
1076627227 10:131829520-131829542 AGTTATCACCAAAAATGTCATGG - Intergenic
1077944046 11:6875721-6875743 AGTCATCACAAAGAATTTCAGGG + Intergenic
1079636970 11:22754828-22754850 ATTCTTCCACAAAGATGTCATGG - Intronic
1079663408 11:23071616-23071638 AGTCTTCCTCAAAACTGTCAAGG + Intergenic
1079990847 11:27245081-27245103 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1080161244 11:29179480-29179502 AATCTTCCCTGAAAATGTCATGG + Intergenic
1080388324 11:31823310-31823332 AGACTTCCCCAGAAATCTCATGG - Intronic
1081133034 11:39403692-39403714 AGTCATCCTCAAAACCATCAAGG + Intergenic
1081580615 11:44349050-44349072 TGTCATCCTCAAAGATGGCAGGG - Intergenic
1081836265 11:46157632-46157654 AGTGCTCCTCAAAACTGTCAAGG - Intergenic
1084108619 11:66998170-66998192 AGTCCTTCTCAAAACTGTCAAGG + Intergenic
1084306788 11:68290853-68290875 AGTCCTCCTCAAAACTGTCAAGG + Intergenic
1085432946 11:76471580-76471602 AGTACTCCTCAAAATTGTCAAGG - Intronic
1085441529 11:76568278-76568300 AGTATTCCCCAAAACTGTCAAGG - Intergenic
1085996673 11:81925069-81925091 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1086128173 11:83371331-83371353 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1086985946 11:93249353-93249375 AGTCATCAAAAAAAATGACAGGG - Intergenic
1087308785 11:96515905-96515927 AGCCCTCCTCAAAAATGTCAAGG - Intergenic
1088124122 11:106403616-106403638 AGTACTCTCCAAAACTGTCAAGG - Intergenic
1088536529 11:110867715-110867737 AGTCTTCCAGAAAAATGCCAGGG + Intergenic
1090448354 11:126784048-126784070 AGTACTCCCCAAAATTGTGAAGG + Intronic
1096017266 12:48288278-48288300 AGTAATCCTCAAAACTCTCAAGG - Intergenic
1096440892 12:51643210-51643232 AGTCATTGTCAAAGATGTCATGG + Intronic
1096673134 12:53211765-53211787 AGTCATCCTCAAACATTTCAGGG + Exonic
1097395735 12:59072475-59072497 AGGCATCCCCTACAATGTTAAGG - Intergenic
1097537116 12:60886131-60886153 AGTTACCCCCAAAAAAGTCCAGG - Intergenic
1097723453 12:63048722-63048744 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1098966041 12:76789830-76789852 AGTTATTCTCAAAACTGTCAAGG + Intronic
1099535835 12:83843187-83843209 TGTCTTCCTCAAAAAAGTCATGG + Intergenic
1100752264 12:97711569-97711591 AGTACTCCTCAAAACTGTCACGG + Intergenic
1102975041 12:117200775-117200797 AATGATCCCCAAACATGTCCAGG + Intergenic
1104823228 12:131690659-131690681 AGTCCTCCTCACAACTGTCAAGG + Intergenic
1105334093 13:19448266-19448288 AGTCATATCCAAAAATATCTTGG - Intronic
1105786056 13:23750410-23750432 AGTACTCCTCAAAACTGTCAAGG - Intronic
1105922734 13:24980827-24980849 AGTCATATCCAAAAATATCTTGG - Intergenic
1105949355 13:25215517-25215539 AGGACTCCCCAAAACTGTCAAGG + Intergenic
1106730998 13:32541272-32541294 AGTTTTCCTCAAAATTGTCAAGG - Intergenic
1106867101 13:33977095-33977117 AGTATTCCTCAAAACTGTCAAGG + Intergenic
1109422234 13:62129164-62129186 AATCATCCATAAAACTGTCAGGG - Intergenic
1110178766 13:72590262-72590284 AGTCAGCCACAAAAATGGAATGG + Intergenic
1110701084 13:78549959-78549981 AGTGGTCCTCAAAACTGTCAAGG + Intergenic
1111145935 13:84180129-84180151 AGTTATCACCAAAAATATGATGG + Intergenic
1111434524 13:88189336-88189358 AGTTCTCCTCAAAAACGTCAAGG + Intergenic
1113980743 13:114273021-114273043 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1115875363 14:37855034-37855056 TATAATCACCAAAAATGTCAAGG - Intronic
1115900505 14:38141977-38141999 AGACATTCCCAATTATGTCAGGG - Intergenic
1116994183 14:51305135-51305157 AGTCAAAACCACAAATGTCAGGG - Intergenic
1117415093 14:55487537-55487559 AGTCCTCCTCAAAACTGTCAGGG - Intergenic
1118231793 14:63958373-63958395 AGTAATCTCTAAAACTGTCAAGG - Intronic
1118243033 14:64080189-64080211 AGTCATCTCTAAAAATGTCCAGG + Intronic
1119221719 14:72914045-72914067 TGTAATCTCCAAAAATGTGAAGG - Intergenic
1120224968 14:81780449-81780471 AGTACTCCCCAAAACTGTCAAGG - Intergenic
1121677205 14:95763196-95763218 AGTAATCATCAAAACTGTCAAGG + Intergenic
1121689657 14:95867742-95867764 AGTGATCTCTAAAAATGTGATGG + Intergenic
1121882143 14:97510337-97510359 AGTCCTCCTCAAAGTTGTCAAGG - Intergenic
1122147718 14:99703009-99703031 TGTCATCTTCAAAAATGTTAAGG - Intronic
1122807723 14:104268974-104268996 CGTTCTCCCCAAAACTGTCAAGG - Intergenic
1123909019 15:24948690-24948712 AGTAATCCCCAAAACTGTCAAGG - Intronic
1124064332 15:26325878-26325900 AGTCATTTCAAAATATGTCAAGG + Intergenic
1124172874 15:27392354-27392376 AGTCATCCCCAAAAATGTCAGGG - Intronic
1124656516 15:31513553-31513575 TGTAATCTTCAAAAATGTCAAGG - Intronic
1125445646 15:39752620-39752642 AGTACTCCTCAAAACTGTCAAGG + Intronic
1125504073 15:40256956-40256978 TGTCATCTACAAAAATGTCGAGG + Intronic
1125909034 15:43419780-43419802 AGGACTCCCCAAAACTGTCAAGG + Intronic
1126212033 15:46110946-46110968 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1126232858 15:46347389-46347411 ATTAATCCTCAAAACTGTCAAGG - Intergenic
1126840176 15:52710070-52710092 ACTCATCAACACAAATGTCAGGG - Intergenic
1127365977 15:58290863-58290885 AGTCATTCTCACAAATGTTAAGG - Intronic
1127405375 15:58638842-58638864 AGTACTCCTCAAAACTGTCAGGG + Intronic
1127953202 15:63830403-63830425 AGTACTCATCAAAAATGTCAAGG + Intronic
1128370880 15:67038341-67038363 ATTCTTCCCAAAAAATGTGAGGG + Intergenic
1129634583 15:77301503-77301525 AGTAATCCTCAGAACTGTCAAGG - Intronic
1130180192 15:81619196-81619218 AGTACACCCCAAAACTGTCAAGG - Intergenic
1132174046 15:99694171-99694193 AGTACTCCTCAAAACTGTCAAGG - Intronic
1132722562 16:1323937-1323959 AGCCACCTCCATAAATGTCATGG + Intronic
1133662292 16:7930015-7930037 AGACATCCCCAAAAGTGTCTAGG + Intergenic
1135023539 16:18982237-18982259 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1136392982 16:29977175-29977197 AGTCACTCTCAAAAAAGTCAGGG - Intronic
1138221341 16:55253958-55253980 AGTATTCCTCAAAATTGTCAAGG + Intergenic
1139060881 16:63250140-63250162 AGTAATCCTCAAAAATGTCAAGG + Intergenic
1139255741 16:65540625-65540647 ATTCTTCCCCACAACTGTCAAGG - Intergenic
1139509773 16:67420638-67420660 AGTCATGCAAAAAGATGTCAAGG - Intergenic
1142529577 17:570548-570570 AATCCTCTTCAAAAATGTCAAGG + Intronic
1143922904 17:10344967-10344989 AGTTATCTCCAAGAATGTGATGG - Intronic
1143945361 17:10586985-10587007 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1144232127 17:13218104-13218126 AGTATTCCTCAAAACTGTCAAGG + Intergenic
1145111637 17:20168509-20168531 AAACATCCCCATAAAGGTCAGGG + Intronic
1148532892 17:48411814-48411836 AGTACTCCTCAAAACTGTCAAGG + Intronic
1148666911 17:49381888-49381910 AGTCATGGCCAAAAATGGCCAGG + Intronic
1148937973 17:51180054-51180076 GGTCATCACCACAAAGGTCATGG - Exonic
1150936243 17:69638732-69638754 TGTCATCCCTTAAAATTTCAAGG - Intergenic
1151179320 17:72314551-72314573 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1151197652 17:72443259-72443281 TGTCCTCCCAAAAAATGTCCTGG + Intergenic
1151223885 17:72634276-72634298 AAGCATCCCCAAAAACCTCAAGG + Intergenic
1153726696 18:7963899-7963921 AGGCATCCTCAAACATGTCAGGG - Intronic
1155310662 18:24519697-24519719 TGTCACCTTCAAAAATGTCAAGG - Intergenic
1155841175 18:30644344-30644366 AGTGTTCCACAAAATTGTCAAGG + Intergenic
1157137643 18:45072645-45072667 AGTGTTCCTCAAAACTGTCAAGG - Intergenic
1157995518 18:52550224-52550246 AGTCCTCCTTAAAACTGTCAAGG + Intronic
1158203385 18:54964211-54964233 AGGCATCACCAAAAAAGTGATGG - Intergenic
1158224737 18:55189291-55189313 AGGCACACCCATAAATGTCAGGG - Intergenic
1158449286 18:57549052-57549074 CCTCATCCCCAAAAAGGTAATGG + Intronic
1158988266 18:62841654-62841676 AGTATTCCTCAAAACTGTCAAGG - Intronic
1162305987 19:9874273-9874295 AGTAATCCTCAAAACTGTCAAGG - Intronic
1164775161 19:30847198-30847220 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1165421187 19:35722740-35722762 GGTCATCCCCAAACCTGACATGG - Intronic
1166261245 19:41642928-41642950 AGACCTCCTCAAAAGTGTCAAGG + Intronic
1166428513 19:42701326-42701348 AGGCATCTCCAAAGAGGTCAAGG - Intronic
1167512587 19:49903607-49903629 AGTAAACCCCAAAAATGTCAGGG - Intronic
927076103 2:19579619-19579641 AGTTGTCTTCAAAAATGTCAAGG - Intergenic
927350294 2:22104328-22104350 AGTGCCCCCCAAAACTGTCAAGG + Intergenic
928183378 2:29086932-29086954 AGTATTCCTCAAAACTGTCAAGG - Intergenic
929162099 2:38842237-38842259 AATAATCTTCAAAAATGTCAAGG + Intronic
929504673 2:42519280-42519302 AGTACTCCTCAAAACTGTCAAGG + Intronic
929767684 2:44861615-44861637 AATAATCCCCTTAAATGTCAAGG + Intergenic
930667081 2:54110046-54110068 AGTAATCCTCAAAACTGTCAAGG - Intronic
930805861 2:55489645-55489667 AGTCATAGCCAAAAATGTAACGG + Intergenic
930963922 2:57296493-57296515 AGTTTTCGCCAAAAATGTCAAGG + Intergenic
932210772 2:69928051-69928073 ATTAATCCCTTAAAATGTCAAGG - Intronic
933982906 2:87568063-87568085 AGTGTTCCTCAAAACTGTCAAGG + Intergenic
935304438 2:101723193-101723215 TGTAATCCCCATAAATTTCAAGG - Intronic
936226025 2:110653133-110653155 AGTACTCCTCAAAACTGTCAAGG - Intronic
936310934 2:111382731-111382753 AGTGTTCCTCAAAACTGTCAAGG - Intergenic
937943491 2:127309672-127309694 AGTACTCCTCAGAAATGTCATGG - Intronic
938029485 2:127980546-127980568 AGTCATGCACAAAAATGTTCAGG + Intronic
939161296 2:138592853-138592875 AGTAATCTTCAAAAATGTCAAGG - Intergenic
939585420 2:143998479-143998501 AGTCATACCAAAAAATTCCAAGG - Intronic
939605475 2:144249768-144249790 ACTCAAAACCAAAAATGTCAGGG + Intronic
939847140 2:147261112-147261134 CGCCACCCCCAAAAAAGTCAGGG + Intergenic
939905664 2:147910704-147910726 AGTCATCCCAAAATAGGTAAGGG - Intronic
940294331 2:152106614-152106636 AGTACTCCTCAAAATTGTCAAGG + Intergenic
940964093 2:159818458-159818480 AGTGTTCCTCAAAACTGTCAAGG + Intronic
941270750 2:163424753-163424775 AATAATCCTCAAAACTGTCAGGG + Intergenic
941540247 2:166773223-166773245 AGCCATCTCAAAATATGTCAAGG - Intergenic
941543190 2:166812671-166812693 AGTACTCCTCAAAACTGTCAAGG + Intergenic
941774065 2:169372756-169372778 AGTACTCCTCAAAACTGTCAAGG - Intergenic
945716385 2:213362699-213362721 AATGCTCCCCAAAATTGTCAAGG + Intronic
945729903 2:213520945-213520967 AGAAAGACCCAAAAATGTCAAGG - Intronic
945905360 2:215586873-215586895 AGTTATTCCCAAAGATTTCATGG + Intergenic
947072064 2:226299952-226299974 AGTGCTCCTCAAAACTGTCAAGG + Intergenic
947547076 2:231017701-231017723 AGCCATCCCAAAATATGCCAAGG - Intronic
947647217 2:231751619-231751641 AGTTCTCCTCAAAACTGTCAAGG - Intronic
947959810 2:234226562-234226584 AGTCGTCCTCAAAACTTTCAAGG + Intergenic
948463405 2:238140928-238140950 AGTCACCCGCAAACATGGCATGG - Exonic
1168991519 20:2100326-2100348 AGTATTCTTCAAAAATGTCAAGG + Intergenic
1169808322 20:9582334-9582356 AGTACTCCTCAAAACTGTCAAGG - Intronic
1170089728 20:12577393-12577415 AGTAGTCCCCAAAACTGTCAAGG + Intergenic
1170435166 20:16319056-16319078 AGTCTTCCTCAAGAGTGTCAAGG + Intronic
1171164693 20:22959453-22959475 AGCCAGCCCCAAGAATTTCAGGG + Intergenic
1171274446 20:23843852-23843874 AGTTATCTTCAAAAATGACAGGG - Intergenic
1172636951 20:36416425-36416447 TTTCATTCTCAAAAATGTCATGG - Intronic
1172763569 20:37338606-37338628 AGTATTCCTCAAAACTGTCAGGG - Intergenic
1173714026 20:45186227-45186249 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1176738965 21:10580404-10580426 AGTCATATCCAAAAATATCTTGG + Intronic
1177954459 21:27579877-27579899 AGTCATCCCCTAAGATGTGATGG + Intergenic
1178171380 21:30044092-30044114 AGTAATATCCAAAAATGGCATGG + Intergenic
1179170631 21:38970304-38970326 GGTCATCCACAAAAAAGTGAAGG - Intergenic
1180097942 21:45569137-45569159 AGTCCTCCTCAAAACTGACAAGG + Intergenic
1181163713 22:20972596-20972618 AGTCATACCCTGAGATGTCAGGG + Intronic
1181873655 22:25923062-25923084 AGTGCTCCTCAAAACTGTCAGGG - Intronic
1182606989 22:31513449-31513471 TCTCATCACAAAAAATGTCAAGG - Intronic
1183804804 22:40199533-40199555 TGTAATCCTCAAAAATTTCAGGG + Intronic
1184312297 22:43654604-43654626 AGTAATCCTCAGAACTGTCAAGG + Intronic
1184376341 22:44116156-44116178 AGTAATCCTCAAAACTGTCAAGG - Intronic
949697867 3:6720179-6720201 AGTACTCCTCAAAACTGTCAAGG + Intergenic
949868184 3:8563948-8563970 AGTACTCCTCAAAACTGTCATGG + Intronic
950236878 3:11329977-11329999 AGTACTCCTCAAAAATGTCAAGG - Intronic
950342602 3:12260667-12260689 AGTCCTCTGCAAAACTGTCAAGG + Intergenic
952014889 3:28944739-28944761 ACTAATCCTCAAAACTGTCAAGG - Intergenic
952280860 3:31922013-31922035 AGTAGTCCTCAAAACTGTCAAGG + Intronic
955036498 3:55273198-55273220 AGACATCCCCAAATATTCCATGG + Intergenic
958431723 3:94047145-94047167 ATTCATAACTAAAAATGTCAAGG - Intronic
958622536 3:96580393-96580415 AATCATCCCCAGAAATCTCCTGG + Intergenic
959348535 3:105231112-105231134 AGTAATCCTCAAAACTGTCATGG - Intergenic
960306586 3:116069301-116069323 AGTCTTCCCCCAAATTGTGAAGG - Intronic
961490626 3:127254586-127254608 TGTCATTCCCTACAATGTCACGG - Intergenic
961604059 3:128080656-128080678 AGTCCTCCTCAAAACTGTCAGGG + Intronic
963933645 3:151030162-151030184 AGTCAACCTCAAAAATGTGAGGG + Intergenic
964095161 3:152922858-152922880 AGTACTCCTCAAAATTGTCATGG + Intergenic
965202577 3:165678267-165678289 AGTCAATTCCCAAAATGTCATGG + Intergenic
965206001 3:165719852-165719874 AAGCACCTCCAAAAATGTCAGGG + Intergenic
966544156 3:181125792-181125814 AGTATTCCTCAAAACTGTCAAGG - Intergenic
968146507 3:196303640-196303662 AGTACTCCTCAAAAAAGTCAAGG + Intronic
968709079 4:2099503-2099525 AGTCCTCCTCAAAACTGTCAGGG + Intronic
968986009 4:3874762-3874784 AGTCCTCCTCAAAACTGTCAAGG - Intergenic
969075034 4:4571255-4571277 AGTCATCTTCAAAAGAGTCAAGG - Intergenic
969602686 4:8186300-8186322 AGTTCTCCCCAGAACTGTCAAGG + Intronic
971541217 4:27819219-27819241 AGTCAACTCCAAATATGTCCAGG + Intergenic
972175087 4:36394314-36394336 AGTGCTCCCCCAAACTGTCAAGG - Intergenic
972191212 4:36593473-36593495 AGTACTCCCCAAAACTATCAAGG + Intergenic
972825001 4:42748193-42748215 AGTCATCCCCAAAACCCTCTTGG + Intergenic
973828360 4:54732584-54732606 AGTCCTACCCTTAAATGTCATGG + Intronic
974208171 4:58734626-58734648 AGTAATTCCCAAGAATTTCAAGG - Intergenic
974329040 4:60452644-60452666 TATCATCACCAAAAATGACATGG + Intergenic
974777602 4:66506706-66506728 AGTATTCCTCAAAACTGTCAAGG + Intergenic
975140447 4:70913108-70913130 TGTAATCCTCAAAAATGTAAAGG - Intronic
975200559 4:71583228-71583250 AGTATTCTCCAAAATTGTCAGGG + Intergenic
975213251 4:71725214-71725236 AGTACTCCTCAAAACTGTCAAGG - Intergenic
975234298 4:71973321-71973343 AGTATTCCTCAAAATTGTCAAGG - Intergenic
975385536 4:73755260-73755282 AGTGCTCCTCAAAACTGTCAAGG + Intergenic
975488775 4:74965785-74965807 AGTGATTCTCAAAAGTGTCAAGG + Intronic
975828006 4:78339804-78339826 AGTCCTCTCCAAAACTCTCATGG - Intronic
976005111 4:80420365-80420387 AGTCATCTCAAAATATGTCAAGG + Intronic
976505731 4:85844932-85844954 AGTTATCTCTGAAAATGTCATGG + Intronic
977033306 4:91916111-91916133 ACTCATCACAGAAAATGTCAAGG + Intergenic
977112548 4:92977311-92977333 AGTCAACCACAAAAATTTCTGGG + Intronic
978266665 4:106835042-106835064 AGTGTTCCTCAAAAGTGTCAAGG - Intergenic
978530889 4:109711993-109712015 AGTACTCCTCAAAACTGTCAAGG + Exonic
978915051 4:114115055-114115077 AGTCCTTATCAAAAATGTCAAGG - Intergenic
979155231 4:117378820-117378842 AGTAATTCTCAAAACTGTCAGGG + Intergenic
979532757 4:121786551-121786573 AGTCATCTGCAATAATGTGAAGG - Intergenic
979643969 4:123045524-123045546 TGTAATCTACAAAAATGTCAAGG - Intronic
981011217 4:139926985-139927007 AGTTCTCCTCAAAAGTGTCAAGG - Intronic
981262959 4:142744478-142744500 AGAAATCCCCAAACACGTCATGG + Intronic
981861925 4:149365782-149365804 GGTAATCCTCAAAACTGTCAAGG + Intergenic
982427987 4:155288591-155288613 AGTAATCTTCAAAACTGTCAAGG + Intergenic
983613308 4:169674205-169674227 TGTACTCTCCAAAAATGTCAAGG - Intronic
984334242 4:178368106-178368128 ATCCAACCCCATAAATGTCAAGG + Intergenic
985272641 4:188208700-188208722 AGTACTCCTCAAAACTGTCAAGG - Intergenic
986730828 5:10633723-10633745 AGTCCTCCTCAAAACTGTCGAGG - Intronic
986843764 5:11729019-11729041 GGACATCCCCAAAAAGCTCATGG + Intronic
986848026 5:11778596-11778618 AGTACTCCCCAAAACTGTCAAGG + Intronic
986947228 5:13037690-13037712 AGTACTCCCCAAAATTCTCAAGG + Intergenic
987057777 5:14211010-14211032 AGCAATTTCCAAAAATGTCAAGG - Intronic
988017587 5:25579177-25579199 AGTCATACTCAAAAATTCCAGGG + Intergenic
990393684 5:55354848-55354870 AATCATCCTCAAATCTGTCATGG - Intronic
990752027 5:59027112-59027134 AGTACTCCTCAAAACTGTCAAGG - Intronic
991221253 5:64222103-64222125 AGTACTCCTCAAAACTGTCAAGG - Intronic
991288450 5:65007247-65007269 AGTATTCCTCAAAACTGTCAAGG + Intronic
992307501 5:75458102-75458124 AGTCATACTCAAGAATGACATGG + Intronic
992340399 5:75817305-75817327 AGTACTCCTCAAAACTGTCAAGG + Intergenic
992951524 5:81862760-81862782 AATCATCCTCAAAAATATCTGGG - Intergenic
993811791 5:92488697-92488719 AGTAATCCTCAAGACTGTCAAGG + Intergenic
994122369 5:96130312-96130334 AGTCCTCCTCAAAACTGTCAAGG + Intergenic
994124440 5:96153532-96153554 ATTGGGCCCCAAAAATGTCAGGG + Intergenic
994985286 5:106925550-106925572 AGCCATCTCAAAATATGTCAAGG + Intergenic
996598226 5:125229750-125229772 AGTTCTCCTCAAAACTGTCAAGG - Intergenic
996810195 5:127507891-127507913 AGTATTCCTCAAAACTGTCACGG - Intergenic
996948959 5:129101859-129101881 AGTGCTCCTCAAAACTGTCAAGG - Intronic
999010497 5:148033317-148033339 TGTCATTCCCAATATTGTCATGG - Intronic
999022048 5:148177273-148177295 AGGCATTCCCAAAGATGTAAAGG + Intergenic
999833706 5:155346271-155346293 TGTAATCCCCAACAGTGTCAAGG - Intergenic
1000594555 5:163199382-163199404 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1000668003 5:164022847-164022869 AATCATCCCCAAAAATTGCATGG + Intergenic
1001151782 5:169235701-169235723 AGTCCTCCTCAAAACTGTTAAGG - Intronic
1002338684 5:178499538-178499560 AGTACTCCTCAAAACTGTCAAGG + Intronic
1002950062 6:1800883-1800905 AGTCACACCAAAAGATGTCAAGG + Intronic
1003754607 6:9102714-9102736 AGTACTCTTCAAAAATGTCAAGG - Intergenic
1004189102 6:13448626-13448648 AGTCTTCCTCATAAGTGTCAAGG + Intronic
1004804765 6:19190822-19190844 AGTCATCACCAAAAATTCTAAGG - Intergenic
1007209818 6:40184212-40184234 AGACATTCCCAAACATGTCTGGG + Intergenic
1008112806 6:47511325-47511347 AGTACTCCTCAAAAATGTCAAGG + Intronic
1008858620 6:56122111-56122133 AATGACCCACAAAAATGTCATGG + Intronic
1009244299 6:61216597-61216619 AGTAGTCTCCAAAACTGTCAAGG - Intergenic
1010710266 6:79165624-79165646 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1011177061 6:84575385-84575407 AGTTATCCCCAAACAATTCAGGG - Intergenic
1011364515 6:86567022-86567044 AGTATTCCTCAAAAATGTCAGGG + Intergenic
1011425336 6:87222866-87222888 AGTACTCCTCAAAACTGTCAAGG - Intronic
1012193385 6:96308756-96308778 AGTCTTCCCAAATAATGTCAAGG - Intergenic
1012494261 6:99816993-99817015 AGTTCTCCTCAAAACTGTCAAGG - Intergenic
1012809297 6:103937569-103937591 AGCAATCCCCTAAACTGTCAAGG + Intergenic
1014324013 6:119968153-119968175 AGTAATCCTCAAAGCTGTCAAGG + Intergenic
1014491773 6:122071356-122071378 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1014769605 6:125445725-125445747 AGCCATCCCCCAAAATGCCTGGG - Intergenic
1015560977 6:134515409-134515431 ACTGGTCCCCACAAATGTCATGG - Intergenic
1015876459 6:137827710-137827732 AGTAATCCTCAAAACTATCAAGG - Intergenic
1017203817 6:151783869-151783891 AGTATTCCTCAAAACTGTCAAGG - Intronic
1017643114 6:156513428-156513450 AGTCAATCCCAAAGATGTCTGGG + Intergenic
1018391561 6:163345276-163345298 ACACACCCCCAAAAATGTCTTGG - Intergenic
1018715077 6:166525808-166525830 AATCATCCTGAAGAATGTCAAGG - Intronic
1019582243 7:1770591-1770613 ACTGATACCCAACAATGTCAGGG + Intergenic
1020016684 7:4835575-4835597 AGTCATCCCCAAAACTGTGTGGG + Intronic
1020410015 7:7881778-7881800 AGTACTCCTCAAAACTGTCAAGG - Intronic
1020730604 7:11874342-11874364 AACCGTCCCCAAAAATGTCCTGG + Intergenic
1021784899 7:24142033-24142055 AGTCATCACCAACAATGTGCTGG - Intergenic
1022728270 7:32999914-32999936 TGTCATCTTCAAAACTGTCAAGG - Intronic
1022782278 7:33598332-33598354 AGTACTCCTCAAAACTGTCAAGG + Intronic
1022782900 7:33603687-33603709 AGCCATACCCGAAAATGACAAGG - Intronic
1022997636 7:35774172-35774194 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1023902774 7:44496566-44496588 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1024108200 7:46115416-46115438 AGTCCTCCTCACAACTGTCAAGG - Intergenic
1024710997 7:52014538-52014560 AGTCATTCAAAACAATGTCAGGG - Intergenic
1024724037 7:52171788-52171810 AGTCCTCCTCAAAAGTGTCCAGG + Intergenic
1024778002 7:52810593-52810615 AGTCCTCCTCACAATTGTCAAGG - Intergenic
1025045381 7:55688103-55688125 TGTCATCTTCAAAACTGTCAAGG + Intergenic
1026284538 7:68951635-68951657 TGTGATCCACAAAAATGCCAAGG + Intergenic
1026701878 7:72654397-72654419 AGTCCTGCTCAAAACTGTCAAGG + Intronic
1028148883 7:87349526-87349548 ATTCATGCACTAAAATGTCAAGG - Intronic
1028406225 7:90477573-90477595 AGTAGTCCTCAAAACTGTCAAGG + Intronic
1029097280 7:98097927-98097949 AGTAGTCTTCAAAAATGTCAAGG - Intergenic
1030824493 7:114138762-114138784 AGTACTCCTCAAAACTGTCAAGG + Intronic
1030826344 7:114164020-114164042 AGTTATCTCCAAAATTGACAAGG + Intronic
1031040210 7:116831314-116831336 AGTGCTCCCCAAAACTATCAAGG + Intronic
1031497175 7:122464722-122464744 AGTACTCCTCAAAACTGTCAAGG + Intronic
1032342288 7:131086017-131086039 AGTTCTCTCCGAAAATGTCAAGG + Intergenic
1035392351 7:158513283-158513305 AGGCCTCCTCAAAACTGTCAGGG + Intronic
1037039581 8:14214250-14214272 AGTAATTCTCAAAACTGTCAAGG + Intronic
1037178985 8:15981732-15981754 TGTACTCTCCAAAAATGTCAAGG - Intergenic
1038299386 8:26328188-26328210 AGTCATAACCATATATGTCAAGG + Intronic
1038741003 8:30216778-30216800 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1038774876 8:30519971-30519993 ATTCATACCCAGAAATGGCAAGG - Intronic
1039384626 8:37123394-37123416 GGTAATCCTCAAAACTGTCAAGG + Intergenic
1040457799 8:47616977-47616999 AGTAATCCTCAAAATTGTCCTGG - Intronic
1040683407 8:49841562-49841584 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1041088098 8:54275367-54275389 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1041264769 8:56053343-56053365 TGTCATCTCCTAAAGTGTCAAGG + Intergenic
1041635762 8:60141463-60141485 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1042043417 8:64620566-64620588 TGTCATCCCCAAAAGTCTCAAGG - Intronic
1042949884 8:74189962-74189984 AGTACTCCTCAAAACTGTCAAGG - Intergenic
1044651776 8:94503498-94503520 AGTACTCTCCAAAAATGTCAAGG + Intronic
1046172251 8:110525862-110525884 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1046324658 8:112625875-112625897 GGTAATCATCAAAAATGTCAAGG - Intronic
1046584704 8:116136836-116136858 AGTATGTCCCAAAAATGTCATGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1046976145 8:120280014-120280036 AGTCATCCACAAAGAAGACATGG - Exonic
1047088079 8:121541892-121541914 AGTTCTCCTCAAAACTGTCAAGG - Intergenic
1048092595 8:131257496-131257518 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1048117084 8:131535641-131535663 AGTAATCATCAAAACTGTCACGG - Intergenic
1049131177 8:140844020-140844042 AGTACTCCTCAAAACTGTCAAGG - Intronic
1050072410 9:1829529-1829551 AGTAATCCTCAAAGCTGTCAAGG + Intergenic
1050140022 9:2507781-2507803 AGTATTCCTCAAAAAAGTCAAGG - Intergenic
1050745853 9:8875104-8875126 AATCATCCCCAAAACTTTAAAGG - Intronic
1051261138 9:15265889-15265911 AGTACTCCTCAAAACTGTCAAGG + Intronic
1051814127 9:21085190-21085212 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1053653215 9:40190162-40190184 AGTAATCTTCAAAAGTGTCAAGG + Intergenic
1053903618 9:42819452-42819474 AGTAATCTTCAAAAGTGTCAAGG + Intergenic
1054531367 9:66186056-66186078 AGTAATCTTCAAAAGTGTCAAGG - Intergenic
1055639165 9:78306065-78306087 AATCATCTTCAAAAATGGCATGG - Intronic
1056892025 9:90503150-90503172 AGTATTCCTCAAAACTGTCAAGG - Intergenic
1057573592 9:96221930-96221952 AGGCATCCTCAAAAATGTTTAGG + Intergenic
1057746188 9:97753413-97753435 AGTATTCTTCAAAAATGTCAAGG - Intergenic
1058212519 9:102187732-102187754 AGTACTCTTCAAAAATGTCAAGG - Intergenic
1058274177 9:103019451-103019473 ATTCATCTCCAAAAATTTCTGGG + Intergenic
1186323497 X:8454386-8454408 AGTACTCCTCAAAATTGTCAAGG + Intergenic
1186398627 X:9235902-9235924 AGTCCTCCTCAAAACTGTCAAGG + Intergenic
1186745655 X:12565570-12565592 AGTACTCCTCAAAACTGTCAAGG + Intronic
1189284670 X:39843163-39843185 AATCACAGCCAAAAATGTCAAGG + Intergenic
1189626482 X:42902674-42902696 AGCAATCCTCAAAACTGTCAAGG + Intergenic
1191770664 X:64754738-64754760 AATCATACTCCAAAATGTCAAGG - Intergenic
1192208042 X:69109110-69109132 AGTCATCCCCAGAGATGAGAAGG - Intergenic
1192236341 X:69298530-69298552 AGTCACCAGCAAAAATGTGATGG - Intergenic
1195896133 X:109747854-109747876 AGTACTCCTCAAAACTGTCAAGG + Intergenic
1196261871 X:113592510-113592532 AGTACTCTCCAAAACTGTCAGGG - Intergenic
1196935470 X:120726293-120726315 AGTACTCCCCAAAACTGTCAAGG - Intergenic
1197712392 X:129680779-129680801 AGTCATCCATGAGAATGTCAGGG - Intergenic
1197743099 X:129910810-129910832 ATTCATCCCCAAACGTGTTAGGG - Intronic
1198138707 X:133781269-133781291 CCTCATCCACAAAAATGTAATGG + Intronic
1198663147 X:138993104-138993126 AGTATACCTCAAAAATGTCAAGG + Intronic
1198806057 X:140495935-140495957 AGAAATCCTCAAAACTGTCAAGG - Intergenic
1199479892 X:148286648-148286670 AGGCATCTCCATAAATGTGATGG - Intergenic