ID: 1124172874

View in Genome Browser
Species Human (GRCh38)
Location 15:27392354-27392376
Sequence AGTCATCCCCAAAAATGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124172874_1124172878 11 Left 1124172874 15:27392354-27392376 CCCTGACATTTTTGGGGATGACT 0: 1
1: 0
2: 5
3: 47
4: 354
Right 1124172878 15:27392388-27392410 TTTTAGAATGCACCTCAATTGGG 0: 1
1: 0
2: 21
3: 164
4: 680
1124172874_1124172877 10 Left 1124172874 15:27392354-27392376 CCCTGACATTTTTGGGGATGACT 0: 1
1: 0
2: 5
3: 47
4: 354
Right 1124172877 15:27392387-27392409 TTTTTAGAATGCACCTCAATTGG 0: 1
1: 0
2: 3
3: 61
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124172874 Original CRISPR AGTCATCCCCAAAAATGTCA GGG (reversed) Intronic