ID: 1124174149

View in Genome Browser
Species Human (GRCh38)
Location 15:27406442-27406464
Sequence CTCACCAGTGATGAGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124174143_1124174149 16 Left 1124174143 15:27406403-27406425 CCTGACAAACCTAATGGCATCCA 0: 1
1: 0
2: 1
3: 8
4: 86
Right 1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG 0: 1
1: 0
2: 1
3: 19
4: 150
1124174146_1124174149 -4 Left 1124174146 15:27406423-27406445 CCAAGTGATCAAGGTGACCCTCA 0: 1
1: 1
2: 6
3: 94
4: 425
Right 1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG 0: 1
1: 0
2: 1
3: 19
4: 150
1124174144_1124174149 7 Left 1124174144 15:27406412-27406434 CCTAATGGCATCCAAGTGATCAA 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG 0: 1
1: 0
2: 1
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124174149 Original CRISPR CTCACCAGTGATGAGCCATG TGG Intronic
900709061 1:4100928-4100950 CTCATAATTGATGAGCCATAGGG - Intergenic
900963555 1:5941838-5941860 CCCACCAGTGAGGAGACAGGGGG + Intronic
904450214 1:30606192-30606214 CTCACCAGAGATGAGAGAAGGGG - Intergenic
904832175 1:33312261-33312283 CTCCCCAGTGCTGAGCCCTAGGG + Intronic
905769031 1:40625567-40625589 CCCACCAGGAATGAGCCCTGAGG + Exonic
908459655 1:64337008-64337030 CTCACCAGTGAGAAGCCCTGGGG - Intergenic
910960233 1:92754345-92754367 CTCACCAGTAATGAAGTATGGGG + Intronic
912425404 1:109584339-109584361 CTCACGAGTGATAATCCATGTGG - Intronic
917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG + Intronic
917795107 1:178527730-178527752 CCCACCAGTAATCAGCCCTGGGG - Intronic
920101785 1:203521482-203521504 GCCACCAGTGATCTGCCATGGGG + Intergenic
920851977 1:209634292-209634314 CCCACCAGTAATGACCCCTGTGG - Intronic
922398784 1:225229160-225229182 ATCTGCAGTGCTGAGCCATGTGG + Intronic
1063344434 10:5297973-5297995 GTCACCAATGATGGGCAATGGGG + Intergenic
1067531122 10:47074331-47074353 GTCAACAGTGATAAGTCATGTGG - Intergenic
1070552444 10:77501456-77501478 TGCAGCAGTGATCAGCCATGAGG - Intronic
1072726090 10:97815126-97815148 GTCACCAGTGATGTGCCAGGAGG - Intergenic
1073882568 10:108000178-108000200 CACAACATTGATGAGCCTTGAGG + Intergenic
1074687041 10:115971078-115971100 CTCACCAGTGTGGAGCCAGAGGG + Intergenic
1075989871 10:126826364-126826386 TCCACCAGGGGTGAGCCATGGGG - Intergenic
1076438467 10:130462844-130462866 GGCTCCAGTGATGGGCCATGAGG + Intergenic
1076516584 10:131048578-131048600 CTCACCAGTGATGCTCCTTCAGG - Intergenic
1078300492 11:10126006-10126028 ATCACCAGTAATAAGTCATGTGG - Intronic
1080208298 11:29756191-29756213 CTCAGCAGTGAGGAGACCTGTGG + Intergenic
1080706920 11:34703826-34703848 CCTACCAATGTTGAGCCATGAGG - Intergenic
1081715713 11:45248677-45248699 ATAATCAGTGATGAGCCAGGAGG - Intronic
1081964668 11:47162233-47162255 CTCACCAGTTACCAGACATGAGG - Exonic
1088580647 11:111312535-111312557 CTCACCAGTGAGTTGCTATGGGG - Intergenic
1089009908 11:115123810-115123832 CCCCACAGTGATGAGCCATATGG + Intergenic
1090440559 11:126721813-126721835 CACACCTGTGAAGAGCCATCTGG + Intronic
1091214368 11:133891598-133891620 CTCTCCAGTGATGAGCAGGGTGG + Intergenic
1091354586 11:134926500-134926522 CTCACCAGTGTTGAGGCAGGTGG + Intergenic
1091354619 11:134926788-134926810 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354629 11:134926896-134926918 CTAACCAGTGTTGAGGCATGTGG + Intergenic
1091354640 11:134927004-134927026 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354689 11:134927472-134927494 CTCACCAGTGTTGAGGCAGGTGG + Intergenic
1091354693 11:134927508-134927530 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354756 11:134928120-134928142 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354768 11:134928228-134928250 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354778 11:134928336-134928358 CTAACCAGTGTTGAGGCATGTGG + Intergenic
1091354789 11:134928444-134928466 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354838 11:134928912-134928934 CTCACCAGTGTTGAGGCAGGTGG + Intergenic
1091354842 11:134928948-134928970 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354904 11:134929560-134929582 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354906 11:134929596-134929618 TTAACCAGTGTTGAGACATGTGG + Intergenic
1091354913 11:134929668-134929690 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1091354921 11:134929740-134929762 CTAACCAGTGTTGAGGCAGGTGG + Intergenic
1094411709 12:30174068-30174090 CTGACCACTGGTGAGCCAGGCGG + Intergenic
1095087118 12:38069215-38069237 CTGACCACTGGTGAGCCAGGCGG + Intergenic
1096686612 12:53292286-53292308 CTCGCCAGTGCTGAGTCAAGGGG + Exonic
1098692905 12:73511544-73511566 CTCATCAGCTATGATCCATGAGG - Intergenic
1100269888 12:93014586-93014608 GTCAACAGTGAGGAGCCAGGGGG + Intergenic
1103822417 12:123709679-123709701 CTTACAGGTGATGTGCCATGTGG - Intergenic
1105882469 13:24616296-24616318 GTCACCAGCCATGAGCCAGGAGG - Intergenic
1106120944 13:26859770-26859792 CTCACCAATGATGTGCTGTGTGG + Intergenic
1106462986 13:29989362-29989384 CTCACCAATGTTGGCCCATGGGG + Intergenic
1106580551 13:31014465-31014487 CTCACCCATGCTGAGCCAGGAGG - Intergenic
1108849355 13:54708095-54708117 CTCACCAGAGAGGAGACCTGAGG + Intergenic
1110328869 13:74248718-74248740 CTCTCCAGCTCTGAGCCATGGGG + Intergenic
1110605632 13:77429049-77429071 TTCACCTGTGATTAGCTATGGGG - Intergenic
1114201896 14:20528987-20529009 CTCACAAGTGAGGAGACTTGTGG - Intergenic
1114512932 14:23277419-23277441 CTCACCAGTCATGTGGCTTGGGG - Intronic
1118472867 14:66091392-66091414 CTCACTAGTAATGAGATATGTGG - Intergenic
1121877872 14:97470538-97470560 ATCACCAGTGAGGAGTCATGTGG - Intergenic
1124174149 15:27406442-27406464 CTCACCAGTGATGAGCCATGTGG + Intronic
1125602772 15:40924588-40924610 CTCATAAGGGATGAGGCATGAGG - Intergenic
1128528100 15:68426061-68426083 CTGACCAGTGATGGGGCAGGGGG + Intronic
1129591864 15:76922501-76922523 CACACCATGGATGAGCCTTGAGG - Intergenic
1130916863 15:88312009-88312031 CTCACCAGAGATTATTCATGAGG - Intergenic
1132800778 16:1751874-1751896 CTCAGCAGTGAAAAGCCAGGAGG - Intronic
1132948853 16:2548863-2548885 GTCACCAGCGATGAGTCACGTGG - Intronic
1132965734 16:2653264-2653286 GTCACCAGCGATGAGTCACGTGG + Intergenic
1133305261 16:4804365-4804387 GCCACTAGTGATGAGCCAAGAGG - Exonic
1133805620 16:9124131-9124153 CTCACCAGGGATGACCCAGCAGG + Intergenic
1134240080 16:12499491-12499513 CTGACCAGTGCAGAGCTATGTGG - Intronic
1137065362 16:35835628-35835650 CTCAGCAATGATGAGCAATGAGG - Intergenic
1140218617 16:73027913-73027935 CTCTGCAGTGCTGAGCGATGAGG - Intronic
1141484642 16:84330565-84330587 CTCAGCTCTGATGAGCCCTGGGG - Intergenic
1142754116 17:2005573-2005595 CACACCAGCCATGAGCCCTGTGG - Intronic
1143176018 17:4955539-4955561 CTCCCCAGTGATGTGCCGTGCGG - Exonic
1146289084 17:31595295-31595317 CTCTGCAGTCCTGAGCCATGAGG - Intergenic
1148767972 17:50050465-50050487 CTCAGCACTGATGAGCCATGAGG + Intergenic
1148809270 17:50279903-50279925 CCCACCACTGATGAGCCACCTGG + Exonic
1151550286 17:74818687-74818709 CTCACCAGAGATGCGGCAGGCGG - Intronic
1152783541 17:82236855-82236877 CTCACCCGTGATGACCCCAGTGG - Exonic
1153821650 18:8837282-8837304 CTCAGCAGAGAGGGGCCATGGGG + Intergenic
1155796292 18:30041618-30041640 CTCACCAGTTATCACCTATGGGG - Intergenic
1157603865 18:48913378-48913400 CTCTCCAGTGGTGCCCCATGAGG - Intergenic
1157814750 18:50722469-50722491 TCCACCAGTGATGAGCTGTGTGG + Intronic
1160011525 18:75110090-75110112 TTCACCAGTGATGGGCCCAGGGG - Intergenic
1160120083 18:76122289-76122311 CTCACCAGAGATGCGCCACGAGG + Intergenic
1160411806 18:78680096-78680118 CTCAGCAGTGCTGAGACATGGGG + Intergenic
1161439557 19:4282958-4282980 CTCACCACTCATGACCCATTGGG - Exonic
1161509817 19:4664019-4664041 CTCAGCATGGATGAGCCTTGAGG + Intronic
1164377757 19:27704095-27704117 CTGACCACTGGTGAGCCAGGTGG - Intergenic
925021525 2:573347-573369 CTCAGGATTTATGAGCCATGGGG + Intergenic
926219296 2:10924533-10924555 CTGGCCAGTGAGCAGCCATGGGG - Intergenic
926654904 2:15391532-15391554 CACAGTATTGATGAGCCATGAGG + Intronic
930028661 2:47045120-47045142 CTCACCAGTGGTGAGTAGTGAGG - Intronic
931007634 2:57870133-57870155 GTCACCTGTGCTTAGCCATGAGG - Intergenic
931802145 2:65768878-65768900 CTTACCAGTGATGAGTCTGGAGG + Intergenic
934986974 2:98894514-98894536 CTCACCAGTGCTGGGCCAGGAGG - Intronic
935881512 2:107570403-107570425 CTCCCCAGCGGTGAACCATGTGG - Intergenic
936051083 2:109224030-109224052 CTATCCATTAATGAGCCATGTGG - Intronic
939997285 2:148931787-148931809 CTGACCAGTGAGGACTCATGGGG + Intronic
942891821 2:180999331-180999353 CTCACCAGTTGTGAGCCTTTTGG + Intronic
944936560 2:204575675-204575697 CTCACCAGTGCTGAGACAGCTGG + Intronic
946895392 2:224318721-224318743 CTCTGCAGTGAAGAGCCATCAGG + Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948223873 2:236293728-236293750 CTCACCAGCCACGTGCCATGGGG + Intergenic
1170561551 20:17562997-17563019 CTCACAAGTGCTGTGTCATGCGG + Intronic
1173571067 20:44076390-44076412 CTCACCAGAAACCAGCCATGCGG + Intergenic
1176317314 21:5258426-5258448 CTCACCAGTCATGAGGGATATGG - Intergenic
1178111185 21:29371752-29371774 CTCACCAGCTATGTGCCTTGTGG - Intronic
1179992662 21:44956750-44956772 CTCACCAGAGTTGGGCCGTGGGG - Intronic
1184869966 22:47231635-47231657 CTGAGCAGTGAGAAGCCATGGGG - Intergenic
950115323 3:10447076-10447098 CTCACTAGTGCTGAGTCCTGGGG + Intronic
959887142 3:111516064-111516086 GTCACCTCAGATGAGCCATGTGG - Intronic
961469964 3:127105411-127105433 GTCACCAGTCATTGGCCATGGGG - Intergenic
962476442 3:135759211-135759233 CTGACCTGTGAGGAGCCCTGTGG - Intergenic
966819155 3:183911231-183911253 CTCACCAGGGATGAGCTCCGAGG - Intergenic
968484150 4:850654-850676 CCCACCAGCGCTGAGCCATCTGG + Intronic
969496720 4:7530419-7530441 CTCAGCAGTGATCAGACATGGGG + Intronic
976853831 4:89579959-89579981 ATCAGCTGTGATGAGTCATGTGG - Intergenic
978002352 4:103572079-103572101 CTCTTCAGGGATGAGTCATGTGG + Intergenic
984704470 4:182837790-182837812 CTCACCAGTGAGGAGTGAAGTGG - Intergenic
984746857 4:183229551-183229573 ATCACCAGGGATGAGTCATGTGG + Intronic
990237545 5:53784086-53784108 CTCACCAGTAAGGAGCAAAGGGG - Intergenic
990627631 5:57632426-57632448 CTCCTAAGTCATGAGCCATGAGG - Intergenic
992150666 5:73899409-73899431 CTCCCCAGTCATGAGAGATGTGG - Intronic
992974039 5:82093909-82093931 CTCACCAGTCGTAAGTCATGGGG - Intronic
993872829 5:93272107-93272129 CTCACCAGTCACGTGTCATGAGG + Intergenic
995436269 5:112139499-112139521 ATCACCAGTGATAAGTCATGTGG + Intergenic
997010801 5:129875091-129875113 CTCAACTGTGTTGAGACATGGGG + Intergenic
1000256057 5:159539839-159539861 CACGCCAGTGATAAGCAATGAGG + Intergenic
1001360030 5:171074160-171074182 ATCACCAGTGATAACTCATGTGG + Intronic
1003506474 6:6744523-6744545 CACAAAACTGATGAGCCATGAGG + Intergenic
1007836944 6:44681341-44681363 CTCTCCAATGACCAGCCATGGGG + Intergenic
1012006218 6:93716304-93716326 CCCAAGGGTGATGAGCCATGAGG + Intergenic
1014827893 6:126066781-126066803 CTTATCAGTGATGAGGCTTGGGG + Intergenic
1018054778 6:160042333-160042355 ATCACCACTGATGAGTCATGGGG + Intronic
1018094663 6:160374704-160374726 GTCCCCAGAGATGAGCCCTGTGG - Intronic
1018194027 6:161338990-161339012 CCCACCAGTGATGCTCCAGGTGG - Intergenic
1018551462 6:165002904-165002926 ATCAGCAGTGATGAGTCACGTGG - Intergenic
1021267179 7:18539184-18539206 ATCACCAGTGATAAGTCATGTGG + Intronic
1023236875 7:38099253-38099275 CTCAGCAGAGATGCTCCATGAGG - Intergenic
1024829881 7:53438365-53438387 ACCAACAGTGATGAGTCATGTGG - Intergenic
1030601387 7:111597058-111597080 CTCACCACCGGTGAGCCAGGCGG + Intergenic
1030889760 7:114985119-114985141 CTCACCAGTGATGTGTCTTTGGG + Intronic
1032089329 7:128903451-128903473 CTCCCCAATCATGAGACATGGGG - Intronic
1033014773 7:137661190-137661212 ATCACCAGAGATGGGACATGGGG + Intronic
1033208760 7:139444614-139444636 CTCACCAGGAATGGACCATGTGG + Intergenic
1033431637 7:141294904-141294926 CTCACCTGTGAAGAGACATCAGG + Intronic
1036078700 8:5528750-5528772 CTCACCAGTGTGGAGGCATCTGG + Intergenic
1049010658 8:139884874-139884896 TTCACCTGTGAGGAGCCAGGAGG + Intronic
1049415317 8:142492340-142492362 CTCCCCAGTGAGGAGGGATGGGG + Intronic
1049526598 8:143129972-143129994 CTCGCCGGTGAGGAGCCACGGGG - Intergenic
1051558547 9:18412591-18412613 ACCACCAGTGATGATCTATGAGG + Intergenic
1061947198 9:133914945-133914967 CACACCAGTGCTGGGCCAAGCGG + Intronic
1203415578 Un_KI270582v1:3474-3496 CTCACCAGTCATGAGGGATATGG - Intergenic
1185871633 X:3669568-3669590 CTCAGCAGTGCTGACACATGGGG - Intronic
1187830938 X:23380472-23380494 CTCTCCATTGAGCAGCCATGTGG + Intronic
1188199771 X:27283757-27283779 CTCAGCAGTGATGAGTCCCGGGG - Intergenic
1189473835 X:41334243-41334265 CTCTTCAGGGATGAGTCATGTGG + Exonic
1190292311 X:49001090-49001112 CTCCCCAGTCATGATCCATTGGG + Intronic
1190414797 X:50170362-50170384 CTTACTAGTGATAAGTCATGTGG + Intergenic
1191155271 X:57266659-57266681 CTGTCTAGTGATGAGCAATGTGG - Intergenic
1192763566 X:74121002-74121024 CTCTTCAGGGATGAGTCATGTGG + Intergenic
1196354512 X:114774837-114774859 CTCTTCAGTGATGGGCCTTGAGG + Intronic
1198016551 X:132617124-132617146 CACTCCAGGTATGAGCCATGAGG - Intergenic
1201338417 Y:12904927-12904949 CTCTTCAGGGATGAGTCATGTGG + Exonic