ID: 1124178865

View in Genome Browser
Species Human (GRCh38)
Location 15:27454339-27454361
Sequence GTAAATGCTTAGATAAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124178865_1124178871 8 Left 1124178865 15:27454339-27454361 CCACGCCTTATCTAAGCATTTAC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1124178871 15:27454370-27454392 CCTGGGAGATTTGATAGTAGAGG 0: 1
1: 0
2: 1
3: 12
4: 105
1124178865_1124178869 -9 Left 1124178865 15:27454339-27454361 CCACGCCTTATCTAAGCATTTAC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1124178869 15:27454353-27454375 AGCATTTACAAGGCTGTCCTGGG 0: 1
1: 0
2: 4
3: 17
4: 154
1124178865_1124178872 20 Left 1124178865 15:27454339-27454361 CCACGCCTTATCTAAGCATTTAC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1124178872 15:27454382-27454404 GATAGTAGAGGTCTACATGCAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1124178865_1124178868 -10 Left 1124178865 15:27454339-27454361 CCACGCCTTATCTAAGCATTTAC 0: 1
1: 0
2: 1
3: 8
4: 121
Right 1124178868 15:27454352-27454374 AAGCATTTACAAGGCTGTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124178865 Original CRISPR GTAAATGCTTAGATAAGGCG TGG (reversed) Intronic
900254129 1:1688309-1688331 GTAAAAGCTTAGAAACGGCCGGG + Intronic
901485301 1:9556003-9556025 TTAAATGCTAAGAAAAGGAGTGG + Intronic
905638233 1:39570303-39570325 GTAAATGCATAGAAAAGGTCTGG + Intronic
907745828 1:57212660-57212682 GTAAATAATGAAATAAGGCGGGG - Intronic
909518979 1:76545601-76545623 GTTAATGTTTACATAAGGTGAGG - Intronic
911887188 1:103318240-103318262 GGAAATGCTTATATAATGAGGGG + Intergenic
912545820 1:110450695-110450717 GTAAATGCCTAGATAAGTCTTGG + Intergenic
919626531 1:199915766-199915788 TTAAAAGTTTAGATAAGGCTGGG - Intergenic
922143390 1:222913609-222913631 GTAAAGGAGTAGATAAGGCTGGG + Intronic
1066644927 10:37596723-37596745 GTATATGCTTTGATAAAGGGAGG + Intergenic
1070513764 10:77184652-77184674 GAAAATGCTTAGCTAAGGAGAGG + Intronic
1070910038 10:80110007-80110029 GTAAATGCTTAGAACAGGGCTGG - Intergenic
1075583970 10:123643890-123643912 GTAAATGCTTAGAAAAGGGCTGG - Intergenic
1078092160 11:8270669-8270691 ATAAATGCAGAGATAGGGCGGGG - Intergenic
1079651361 11:22934109-22934131 ATAAATGGTTAGAAAAGGGGTGG + Intergenic
1082077806 11:47987844-47987866 GTAAATGGTAGGATAAGGGGTGG + Intronic
1083087952 11:60169450-60169472 GTAAATGGTTACATAATGCATGG + Intergenic
1089881681 11:121779921-121779943 GTAAATGCTTATTGAATGCGTGG + Intergenic
1091335958 11:134765940-134765962 GTGGGTGCTTAGATAAGGGGAGG + Intergenic
1094722964 12:33083926-33083948 GTAAAACCTCAGATAAGGAGAGG - Intergenic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1097715689 12:62963395-62963417 GAAAAAGCTCAGATAAGGAGGGG - Intergenic
1099465896 12:82987752-82987774 TTAAATGCCTAAATAAGGCAGGG + Intronic
1099728821 12:86470844-86470866 GTAAATACATAGATACGGAGAGG - Intronic
1105369039 13:19786720-19786742 TTAAATGCTTAACTAAGGCTGGG + Intergenic
1111308753 13:86452626-86452648 GTAAGTGTTTAAATAAGGCTTGG + Intergenic
1114490673 14:23099765-23099787 CTTAATGCTTGGATGAGGCGGGG - Exonic
1120599619 14:86485673-86485695 GTAAATGCTTAGAGAAGGAGAGG - Intergenic
1124178865 15:27454339-27454361 GTAAATGCTTAGATAAGGCGTGG - Intronic
1131130129 15:89893734-89893756 TTAAATGCTTAAGTAGGGCGAGG + Intronic
1134165406 16:11925601-11925623 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1134489897 16:14688841-14688863 GAAACAGCTTAGATAAGGCCAGG - Intronic
1134495278 16:14727958-14727980 GAAACAGCTTAGATAAGGCCAGG - Intronic
1134500667 16:14767084-14767106 GAAACAGCTTAGATAAGGCCAGG - Intronic
1134527205 16:14953691-14953713 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1134545196 16:15102651-15102673 GAAACAGCTTAGATAAGGCCAGG + Intronic
1134579915 16:15361965-15361987 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1134714793 16:16352233-16352255 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1134722670 16:16395595-16395617 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1134944758 16:18316276-18316298 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1134952022 16:18356426-18356448 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1135310365 16:21400497-21400519 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1135363309 16:21832910-21832932 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1135448481 16:22538150-22538172 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136149945 16:28340827-28340849 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136166179 16:28454631-28454653 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136196792 16:28660389-28660411 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136213132 16:28774512-28774534 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136257862 16:29054429-29054451 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136307107 16:29379637-29379659 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136320631 16:29481880-29481902 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136435204 16:30221220-30221242 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1139072187 16:63396096-63396118 GTAATTTCTTAGATAATGCCAGG - Intergenic
1139855237 16:69974630-69974652 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1139884953 16:70201755-70201777 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1140367562 16:74393762-74393784 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1141909899 16:87051674-87051696 GCAAGTTCTTAGATCAGGCGGGG - Intergenic
1145795363 17:27652411-27652433 GGACATGCTTAGTTAAGGCAAGG - Intergenic
1145809798 17:27757742-27757764 GGACATGCTTAGTTAAGGCAAGG - Intronic
1149272292 17:54993001-54993023 GCAAATTCTTAGGTCAGGCGTGG - Intronic
1154116661 18:11617606-11617628 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1155471466 18:26196545-26196567 TTAAATGCATAGGTAAGGCCAGG + Intergenic
1155471673 18:26198401-26198423 TTAAATGCATAGGTAAGGCCAGG + Intergenic
1160177763 18:76609854-76609876 CTAAATGCTAACATAAGGCTGGG + Intergenic
1165802935 19:38564000-38564022 GTAAATGCTTCAATAAGGCCAGG - Intronic
926487843 2:13485073-13485095 GTAAAAGGTTAGATAAGGTTAGG + Intergenic
929082062 2:38131080-38131102 GTCAATGCTTAGAACTGGCGTGG - Intergenic
932895559 2:75636332-75636354 GTCAATGTTTAGAGAAGGCAAGG - Intergenic
934036140 2:88089880-88089902 GTAAAAGCTTAGGCCAGGCGTGG - Intronic
935627943 2:105186338-105186360 GTAAAGGCTAAGATGAGACGTGG - Intergenic
937640866 2:124209606-124209628 GTAGAGGTTTAGATAAGGGGAGG - Intronic
938015650 2:127864875-127864897 GGAAAGGCTGAGATAAGGCTTGG + Exonic
939352543 2:141058238-141058260 GTTAATGCTTAGATAATTCTAGG + Intronic
939685096 2:145189279-145189301 GAAAATGCCTAGATAGGGCTGGG + Intergenic
941056020 2:160789556-160789578 CTAAATGCTTAGATAATTAGCGG + Intergenic
942432060 2:175922337-175922359 GTAACTGCTTAGAAAAGTTGAGG + Intergenic
948298532 2:236884398-236884420 GTAAATTATTAGATAAGATGAGG - Intergenic
1169367623 20:5003671-5003693 GTAAATGCCTAGAGAGGGAGAGG - Intronic
1173527553 20:43744585-43744607 TTAAAAGCTCAGATAAGCCGGGG + Intergenic
1175089976 20:56494444-56494466 GTAAATGCTCAGAAAAAGCAGGG - Intronic
1181842784 22:25678824-25678846 TGAAATGCTTAGATAAGAAGAGG + Exonic
1182505117 22:30776644-30776666 GTAAATTCTTAGAAAAGGGATGG + Intronic
954266806 3:49476008-49476030 GAAAATGCTTAGCTATGGCCGGG - Intronic
955187704 3:56731040-56731062 GTAAATGCTTATACAATGCCTGG + Intronic
958428385 3:94007075-94007097 GTTTAGGCTCAGATAAGGCGCGG - Intronic
958660004 3:97054552-97054574 GTAACTGCTTAAATAAGGAGAGG + Intronic
963580780 3:147124291-147124313 GTAAATGGTGAGATAATGGGTGG - Intergenic
964879819 3:161410966-161410988 GTAAATGCTTTAATAAGAGGAGG + Intergenic
971965015 4:33542575-33542597 TAAAATGCTTAGATTAGGAGAGG - Intergenic
972805129 4:42522016-42522038 GTTAATGCTTAGATGATGAGAGG + Intronic
974808057 4:66907317-66907339 GTGAATGCTTAAATAAGTTGTGG - Intergenic
974835131 4:67239147-67239169 GTAAATGCTTTGAACAGGCCTGG - Intergenic
976308601 4:83586956-83586978 GTATATGCATAGAGAAGGCCTGG - Intronic
978105302 4:104894934-104894956 GGAAATGCTTAGATAAAGGCAGG + Intergenic
979037855 4:115748216-115748238 GAAAATGCTTAGAGAAGAGGTGG + Intergenic
981684941 4:147443347-147443369 GTAAATGCTGAAATAAGAAGAGG + Intergenic
982909545 4:161121869-161121891 GAAAATACTTAGATCAGGCTGGG - Intergenic
984206074 4:176789732-176789754 GTAAATGCAAATATAAGTCGAGG + Intronic
987238382 5:15967588-15967610 GTAAATGCTTAGACAATGCTTGG - Intergenic
988307988 5:29518490-29518512 TTAAATGCCTAGATAATGCTGGG - Intergenic
990505680 5:56442063-56442085 GTAAATACTTAGAAAACGCCTGG - Intergenic
992361079 5:76038892-76038914 GTAAATGCTCAGATAAGCCATGG + Intergenic
995584227 5:113630360-113630382 ATAAAAGCTTAGGTAAGGCTGGG + Intergenic
996329511 5:122312659-122312681 GGAAAAGCTGAGATAAGGAGGGG + Intronic
996364720 5:122688986-122689008 CTAAAGACTTAGATAAGGCCGGG + Intergenic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
998978089 5:147670169-147670191 GTCAAGGCTTAGCTAAGGCAGGG + Intronic
1000338259 5:160257811-160257833 GTAAATGCTCAGTTAATGCTTGG + Intronic
1001369212 5:171179805-171179827 GTAAATACTCAGAAAAGGCCTGG + Intronic
1005353742 6:24961920-24961942 AAAAATGCTTAGAATAGGCGAGG - Intronic
1008811506 6:55506439-55506461 GTAAAACCTTAGATAAGGGAAGG - Intronic
1010656204 6:78514488-78514510 GTAAATACTTTGTTAAGGCCAGG - Intergenic
1012664644 6:101952302-101952324 GTAAATGCTTAAATAAACTGTGG - Intronic
1013106470 6:107030108-107030130 GTAAGTGCTTAATTAAGGGGAGG + Intronic
1020671794 7:11124523-11124545 TTAAATGCTTAGAAAATGCCAGG - Intronic
1025924948 7:65950821-65950843 GTAAATGCATAGAAAAGGGTCGG + Intronic
1028021494 7:85780721-85780743 GTATATGTGTAGATAAGGTGTGG - Intergenic
1032866369 7:135929344-135929366 GTGAAAGCTTAGTTAAGGTGAGG - Exonic
1034753401 7:153591865-153591887 TTTAATGCTTAGATAGGGCTTGG - Intergenic
1037656854 8:20891449-20891471 GAAAATGCTTTGATATGGAGAGG - Intergenic
1039855510 8:41408780-41408802 GAAAATGATCAGAAAAGGCGGGG - Intergenic
1040492110 8:47933442-47933464 GTAAATGCTTTGACAAGGATTGG - Intronic
1041426079 8:57722050-57722072 GTAGATGTTTAGATAAGGTCTGG - Intergenic
1042882625 8:73510868-73510890 GTAAATCCATTGATAAGGCTTGG - Intronic
1043795479 8:84532572-84532594 GAGAATGCTTAGATAGGTCGTGG - Intronic
1052498257 9:29256522-29256544 GGAAATGCTGAGTTAAGGAGTGG + Intergenic
1057563874 9:96151235-96151257 TTAAATTCTTAAATAAGGCCAGG + Intergenic
1060751672 9:126173741-126173763 GCAAAAGCTTAGAGAAGGGGAGG + Intergenic
1197782954 X:130174915-130174937 GTAAATGCTTTGATGGGGTGAGG - Intronic
1198467458 X:136916477-136916499 GTAAAAGCTTAAATAAGGCCGGG + Intergenic
1200326344 X:155244028-155244050 GTAAATGAATAGATACGGCATGG - Intergenic