ID: 1124182553

View in Genome Browser
Species Human (GRCh38)
Location 15:27490466-27490488
Sequence GTGTTGACTAAGATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124182553_1124182555 -3 Left 1124182553 15:27490466-27490488 CCATTTTCCATCTTAGTCAACAC 0: 1
1: 1
2: 0
3: 16
4: 361
Right 1124182555 15:27490486-27490508 CACAGAATCTGAAGAAATGCAGG 0: 1
1: 0
2: 4
3: 30
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124182553 Original CRISPR GTGTTGACTAAGATGGAAAA TGG (reversed) Intronic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
904879731 1:33686542-33686564 GTGTGGTCCAAGCTGGAAAATGG - Intronic
905690909 1:39941991-39942013 ATGTGCACTAAGAGGGAAAATGG - Intergenic
907725687 1:57018219-57018241 GTGTTCACTATTTTGGAAAATGG + Intronic
907823912 1:57997161-57997183 ATGTTCACTAAGAGGTAAAATGG + Intronic
908296311 1:62717064-62717086 GTGTTGAATAAGATAGATAAAGG - Intergenic
909447409 1:75763557-75763579 GTATTTACTATGATGAAAAAAGG + Intronic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
911138094 1:94464689-94464711 ATGTTGACTTAGATGAAACATGG + Intronic
911189087 1:94929873-94929895 GTGTGAACTAAGAGGCAAAATGG - Intergenic
911237536 1:95427421-95427443 CTGTTGGCTAATATGTAAAATGG + Intergenic
911405831 1:97438002-97438024 TTTTTGACAAAGATGCAAAAAGG - Intronic
912058257 1:105632176-105632198 CTTTTGGCTAAGTTGGAAAAGGG + Intergenic
913502356 1:119482981-119483003 GTGTTTAAGAAGATTGAAAAAGG - Intergenic
916581814 1:166115815-166115837 GATTTGACTGAGATGGGAAATGG - Intronic
916587553 1:166161765-166161787 TTGTTTACTAAGATGAAGAATGG + Intronic
916863075 1:168827119-168827141 GTTTTGGATAAGAAGGAAAAGGG - Intergenic
917103136 1:171465730-171465752 ATGTTCACTAAGAGGCAAAATGG - Intergenic
918685709 1:187412314-187412336 GTGTTGCCTAATATTGAGAAAGG + Intergenic
919090606 1:192974659-192974681 GAGTTGAGAAAGATGGAAGAAGG + Intergenic
920679107 1:208059274-208059296 GAGATGAGGAAGATGGAAAAAGG - Intronic
921027212 1:211296599-211296621 CTGATGACTAAGATGGCATATGG - Intronic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
921651904 1:217689829-217689851 GGGTTGACTAGGATCAAAAATGG - Intronic
922312619 1:224409910-224409932 GTGTTGAGAAAAATAGAAAAAGG - Intronic
922457775 1:225790748-225790770 GTGTTAAATAAGGGGGAAAAAGG - Intergenic
924429162 1:243982033-243982055 GTGTTAAACAAGATCGAAAAGGG - Intergenic
1064552442 10:16518288-16518310 GTGTGGACTATTTTGGAAAATGG - Intronic
1066540374 10:36440309-36440331 GGGTTGACTAAGAAGCCAAATGG - Intergenic
1067179701 10:43975315-43975337 GTGTCAATAAAGATGGAAAATGG + Intergenic
1071429229 10:85593237-85593259 GAGTAGAGAAAGATGGAAAATGG - Intergenic
1071509579 10:86252993-86253015 TACTTAACTAAGATGGAAAATGG + Intronic
1075603371 10:123787202-123787224 GTGCAGACAGAGATGGAAAAGGG + Intronic
1077849694 11:6063480-6063502 GTGTTGTTTAAGATGAAGAAAGG - Intergenic
1078673933 11:13391646-13391668 ATGTTGAGTAAGATGGATATTGG - Intronic
1080087686 11:28304923-28304945 GTTTTCACTCTGATGGAAAATGG + Intronic
1080248847 11:30210210-30210232 GTGGTGAGTAAGGGGGAAAAGGG - Intergenic
1080299453 11:30768091-30768113 GTGTTAACCTAGATGGCAAAAGG - Intergenic
1080426728 11:32161754-32161776 CTGATGATTAAGAAGGAAAATGG - Intergenic
1081907023 11:46676705-46676727 GTGTGGACTGTGATGGACAATGG - Intergenic
1083063757 11:59901540-59901562 GTTTGGACAAAGAAGGAAAAGGG - Intergenic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1088532615 11:110827199-110827221 GTGCTATCTAATATGGAAAATGG + Intergenic
1091700551 12:2656854-2656876 GTGTTGCCAAAGAGGAAAAAGGG + Intronic
1092343661 12:7697641-7697663 GTGTTAAATAAGATAGAAACAGG - Intergenic
1092666288 12:10802843-10802865 CTGTTTACTAAGATGCAAATTGG + Intergenic
1092702655 12:11249199-11249221 CTGTTGAATAAAATGTAAAAAGG + Intergenic
1092967173 12:13655434-13655456 GAATTGACTGAGAAGGAAAATGG + Intronic
1094371347 12:29740779-29740801 GTCTTTACAAAGAAGGAAAAAGG + Intronic
1097727555 12:63092140-63092162 GTTTTCTCTAAGATGGCAAAAGG - Intergenic
1098636657 12:72792506-72792528 TTGATGACTAAGAGTGAAAAAGG - Intergenic
1099517400 12:83614587-83614609 ATTTTGCCTAAGATGGAGAAGGG + Intergenic
1100414774 12:94360232-94360254 GTGTTGAATAAGATTGACAAGGG - Intronic
1100442415 12:94629056-94629078 GATTTGACTCAGATGGAAGAAGG - Intronic
1103976093 12:124703712-124703734 TTGATGATTAAGATGGAAAAAGG + Intergenic
1107526164 13:41233835-41233857 ATGCTGAGTAAGATGGAAAAAGG + Intronic
1107734720 13:43386610-43386632 TTGTTGACTTGGATGTAAAATGG + Intronic
1109847362 13:68013009-68013031 GTGTAAACTAAAATAGAAAAGGG - Intergenic
1110419383 13:75288221-75288243 GTCTAGACTAAAATGGAAATTGG - Intronic
1111392829 13:87621050-87621072 GAGGTGATTAAGATGGAAAAAGG - Intergenic
1111481641 13:88835055-88835077 GTGTTGATGAATATGAAAAAAGG + Intergenic
1116297583 14:43133188-43133210 GTGTTACCTCAGGTGGAAAAGGG + Intergenic
1116534247 14:46011775-46011797 GTATTGCCAAAGATGGGAAAAGG - Intergenic
1117198914 14:53368204-53368226 GTCTTAAATAAGATGGAAACTGG + Intergenic
1118763492 14:68894923-68894945 GGAATGACTAAGATGGAAGACGG + Intronic
1119350910 14:73964705-73964727 TTGTTGACAAAGATGGGAAGGGG + Exonic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1121722314 14:96118192-96118214 GTGTGCACTAAGACGCAAAACGG - Intergenic
1124165757 15:27324334-27324356 GTATGTACTAAGGTGGAAAAGGG + Intronic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1124987012 15:34629693-34629715 ATGTGTACTAATATGGAAAAGGG + Intergenic
1129437985 15:75557891-75557913 AGGTTGACTAAGAAAGAAAATGG + Intronic
1130237161 15:82146440-82146462 GTGTTGATTTAGAAAGAAAAAGG + Intronic
1130633989 15:85598981-85599003 GTGTTGACTACGAGGGTAATAGG - Intronic
1135891242 16:26359360-26359382 TTGTTCTCTAAGATGGAAAGTGG + Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1137999532 16:53260942-53260964 GTTTTGTCTTATATGGAAAAGGG - Intronic
1138012443 16:53395144-53395166 TGATTGGCTAAGATGGAAAAGGG - Intergenic
1138564489 16:57823027-57823049 GTTTAGACTATGATGGAAGAGGG + Intronic
1139942995 16:70619619-70619641 GTATTGATTAAGAAGGGAAAGGG + Intronic
1140161468 16:72499349-72499371 ATGTTCACAAAAATGGAAAAGGG - Intergenic
1140700532 16:77577359-77577381 GTGTTACCTTACATGGAAAAAGG - Intergenic
1142734205 17:1884636-1884658 CTGTTGACAATGATGGATAAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149224275 17:54450689-54450711 GTGTTCTCTAACATGTAAAATGG + Intergenic
1150442356 17:65201873-65201895 GTGTTCACTGAGCTGGGAAATGG + Intronic
1152765290 17:82134066-82134088 GTGTTACCTGAGATGTAAAATGG + Intronic
1153538884 18:6133841-6133863 CTGTTCACTAAGAGGCAAAATGG + Intronic
1155404636 18:25474361-25474383 GTGCTTACTACCATGGAAAATGG - Intergenic
1156644253 18:39140771-39140793 ATGTTCACTAAGAGGCAAAATGG + Intergenic
1156766307 18:40660717-40660739 AAGTTTACTAAGATAGAAAATGG + Intergenic
1159753644 18:72335593-72335615 GTGTTCATTATGAGGGAAAAAGG - Intergenic
1160036811 18:75309463-75309485 GTGTAGGACAAGATGGAAAAGGG - Intergenic
1161679007 19:5669679-5669701 GTGGTGGCTTAGATGGTAAAGGG + Intergenic
1163681745 19:18686709-18686731 GTGATGAGGAAGATGGGAAATGG - Intronic
1164252936 19:23499691-23499713 GAGTTTTCTATGATGGAAAATGG - Intergenic
1164788985 19:30959946-30959968 GTGTTGGCTCAAATTGAAAAAGG - Intergenic
924997433 2:375274-375296 ATGTTGACTAAGATAGACACTGG - Intergenic
926651618 2:15352754-15352776 ATGTTCACTAAGAGGCAAAATGG - Intronic
927085539 2:19671440-19671462 CTGCTGACTATGATGGTAAATGG - Intergenic
927391090 2:22596371-22596393 ATGTTGAATAAGATGGACATAGG + Intergenic
927708581 2:25311778-25311800 GTGTTTGCTCAGCTGGAAAATGG - Intronic
930475320 2:51874846-51874868 GAGTTAAGTAAAATGGAAAATGG + Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
933171433 2:79130222-79130244 GGGTTGATTGAAATGGAAAATGG - Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934772343 2:96915024-96915046 GTGTTTGCTGAGATGGAAAATGG + Intronic
936234227 2:110729950-110729972 TTGTTGACCAAAATTGAAAATGG - Intergenic
938982967 2:136544203-136544225 GTGGTGACTAAGAGATAAAAGGG - Intergenic
939080992 2:137661963-137661985 GTGCTCACTAAGAGGCAAAATGG - Intronic
940633543 2:156269013-156269035 GTGATAAATAAGATGGAAACTGG - Intergenic
941183416 2:162288980-162289002 TAGTTGCCTCAGATGGAAAAAGG - Intronic
941354225 2:164468833-164468855 GTGTCAACTAAGATGGCAGAGGG + Intergenic
941468454 2:165856972-165856994 GTGTTAACTTACATGGCAAAAGG + Intergenic
942360862 2:175170061-175170083 GTGAGAACAAAGATGGAAAAGGG - Intergenic
942476014 2:176321642-176321664 CTGTTGACTAGAATGTAAAAAGG - Intronic
942959776 2:181816501-181816523 GTGTTGATCAAGAATGAAAAAGG - Intergenic
944258866 2:197654484-197654506 GGCTTAAATAAGATGGAAAAGGG + Intronic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
944840581 2:203620156-203620178 GTGTTGAGTAATATGCAACATGG - Intergenic
945712242 2:213312592-213312614 GTGTTGAATACGAAGTAAAAAGG - Intronic
946213452 2:218165455-218165477 GTGTGGGGTAAGATGGAATATGG + Intronic
947150656 2:227111838-227111860 GTGTTGACTAAAATTGAGGAAGG + Intronic
1173917922 20:46723363-46723385 GTGGCTACTAAGATGGAAGAGGG - Intronic
1174743475 20:53039173-53039195 GTGTAGACCAAGAAGGAGAAGGG - Intronic
1175201827 20:57283370-57283392 TTGTTGTCTGAGATGGAAAAGGG + Intergenic
1177600583 21:23306344-23306366 GTGCTAACTATGAGGGAAAATGG - Intergenic
1177670282 21:24215802-24215824 GTGATGATTAAATTGGAAAAGGG - Intergenic
1177841162 21:26235476-26235498 GTCTTGACTAAGAAGGAAAGAGG - Intergenic
1178334017 21:31727925-31727947 GTGTTGTGAAAGATTGAAAAGGG - Intronic
1178509719 21:33194180-33194202 GGGTTGACTGAGAAGGGAAATGG + Intergenic
1179429828 21:41313349-41313371 GTGTTGAGTAAGATGGAGCAAGG - Intronic
1182161474 22:28126546-28126568 ATGTTGATTTAGATGGAAAAAGG + Intronic
1183941815 22:41300111-41300133 GGGCTGCCTAAGATGGTAAAGGG - Intergenic
1184030144 22:41888807-41888829 ATATTCAGTAAGATGGAAAAAGG + Intronic
949854351 3:8446903-8446925 TTGCTGACTAAAATGTAAAATGG - Intergenic
950484684 3:13266134-13266156 GTGTTTCCTCATATGGAAAATGG - Intergenic
952433158 3:33245908-33245930 GAGTTGAATAAGATTGAACATGG + Intergenic
953432855 3:42854071-42854093 TTGATGTCTAAGATGGAAGAGGG + Intronic
954396459 3:50295872-50295894 GTATTGACAAAGACGGAACATGG - Intronic
955223175 3:57039885-57039907 GTGTTACCTTACATGGAAAAAGG - Intronic
956568933 3:70672488-70672510 GTGGGGAGTAAGATAGAAAAAGG + Intergenic
957443304 3:80281506-80281528 GTGTTAACTTGGCTGGAAAATGG + Intergenic
957975624 3:87440415-87440437 GTGTCAACTAAAAAGGAAAAAGG - Intergenic
959219819 3:103502926-103502948 CTGTTGAGTATGTTGGAAAAAGG + Intergenic
959241033 3:103794202-103794224 GTGTTTACCAAGTTTGAAAATGG + Intergenic
959733923 3:109636039-109636061 CTGTTGACCAAGAAGGGAAATGG - Intergenic
960045210 3:113190550-113190572 TTTTTAACCAAGATGGAAAAGGG - Intergenic
963169800 3:142239519-142239541 GTGTTGCCTTACATGGAAGAAGG + Intergenic
963800883 3:149675051-149675073 GTTTGGACTAAGATGGTAGAAGG + Intronic
964551355 3:157888339-157888361 CTGTTGAGTAAGAGGGATAATGG - Intergenic
964781255 3:160340814-160340836 GTGTTACCTAATATGGCAAAAGG - Intronic
965153445 3:165013216-165013238 GAGGAGACTAACATGGAAAATGG - Intronic
967776226 3:193388810-193388832 GTGGTTACAAAGATGGAGAATGG + Intergenic
970091626 4:12414816-12414838 GTGTCGACTGAAAGGGAAAAGGG - Intergenic
970371931 4:15416686-15416708 GTCTTTCCTCAGATGGAAAAGGG - Intronic
970429842 4:15978621-15978643 GTGATGTCTCAGATGCAAAAGGG - Intronic
971544366 4:27866925-27866947 GAGTAGACAAAGAAGGAAAATGG - Intergenic
971654779 4:29330351-29330373 GACGTGACTCAGATGGAAAATGG - Intergenic
972769235 4:42180646-42180668 GTGTTAACTAGAAAGGAAAAGGG + Intergenic
974039186 4:56843342-56843364 GTGTGCACTAAGAGGCAAAATGG + Intergenic
979049758 4:115915785-115915807 GGGATGACTAAGACAGAAAATGG - Intergenic
979503473 4:121466878-121466900 ATGTTGAGTGAGAGGGAAAAAGG + Intergenic
981854364 4:149270190-149270212 GTGTTAAGAAAAATGGAAAATGG - Intergenic
983051474 4:163052667-163052689 ATGATAACTAAAATGGAAAATGG + Intergenic
983126926 4:163964707-163964729 GTGAAGACTACCATGGAAAAAGG - Intronic
983373603 4:166896695-166896717 GTATTTACAAACATGGAAAAAGG - Intronic
983793964 4:171836767-171836789 GTGATGGCTATGATGGAAGATGG + Intronic
984445486 4:179830839-179830861 GTGTGGGCTAAGAAAGAAAAGGG - Intergenic
985613231 5:902541-902563 GAGGTGACCAATATGGAAAAAGG - Intronic
985961029 5:3303429-3303451 GTGCTCATTAAGATGGAAACTGG - Intergenic
987678462 5:21105967-21105989 GTCTTTAGTAAAATGGAAAATGG - Intergenic
988119464 5:26942181-26942203 GTGTTGAGCAAAAGGGAAAAAGG + Intronic
989865877 5:46506182-46506204 TTGAGGACTATGATGGAAAAGGG + Intergenic
989867826 5:46540047-46540069 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989868319 5:46549041-46549063 TTGAGGACTATGATGGAAAAGGG + Intergenic
989869576 5:46570989-46571011 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989870116 5:46581223-46581245 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989870387 5:46586339-46586361 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989870525 5:46588896-46588918 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989870666 5:46591456-46591478 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989870803 5:46594016-46594038 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989871069 5:46598965-46598987 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989871206 5:46601524-46601546 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989871345 5:46604082-46604104 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989871758 5:46611757-46611779 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989872163 5:46619093-46619115 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989872302 5:46621652-46621674 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989872446 5:46624277-46624299 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989872587 5:46626938-46626960 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989872657 5:46628129-46628151 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989872800 5:46630688-46630710 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989873061 5:46635637-46635659 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989873341 5:46640755-46640777 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989873610 5:46645873-46645895 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989873751 5:46648432-46648454 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989873887 5:46650820-46650842 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989874294 5:46658495-46658517 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989874438 5:46661052-46661074 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989874837 5:46668726-46668748 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989874973 5:46671284-46671306 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875116 5:46673841-46673863 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875251 5:46676399-46676421 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875387 5:46678960-46678982 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875527 5:46681518-46681540 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875658 5:46684079-46684101 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875802 5:46686637-46686659 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989875943 5:46689195-46689217 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989876139 5:46693124-46693146 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989876277 5:46695684-46695706 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989876410 5:46698243-46698265 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989876548 5:46700800-46700822 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877081 5:46711038-46711060 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877356 5:46716154-46716176 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877370 5:46716495-46716517 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877494 5:46718711-46718733 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877636 5:46721271-46721293 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877771 5:46723829-46723851 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989877910 5:46726390-46726412 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878049 5:46728948-46728970 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878185 5:46731506-46731528 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878250 5:46732872-46732894 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878389 5:46735430-46735452 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878527 5:46737989-46738011 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878788 5:46742935-46742957 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989878925 5:46745495-46745517 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989879073 5:46748053-46748075 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989879212 5:46750611-46750633 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989879348 5:46753172-46753194 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989879621 5:46758295-46758317 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989879763 5:46760856-46760878 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989879894 5:46763244-46763266 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989880033 5:46765803-46765825 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989880440 5:46773477-46773499 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989880577 5:46776034-46776056 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989880714 5:46778592-46778614 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989880850 5:46781151-46781173 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989881123 5:46786274-46786296 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989881397 5:46791390-46791412 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989881539 5:46793948-46793970 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989881678 5:46796506-46796528 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989881874 5:46800696-46800718 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989882217 5:46807511-46807533 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989882576 5:46814669-46814691 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989882850 5:46819953-46819975 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989883353 5:46829839-46829861 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989883655 5:46835810-46835832 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989883922 5:46841095-46841117 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989884188 5:46846379-46846401 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989884450 5:46851660-46851682 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989884725 5:46857115-46857137 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989885477 5:46871772-46871794 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989886035 5:46882682-46882704 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989886750 5:46896657-46896679 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989887000 5:46901430-46901452 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989887550 5:46912169-46912191 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989887817 5:46917454-46917476 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989888026 5:46921543-46921565 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989888218 5:46925467-46925489 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989888427 5:46929557-46929579 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989888706 5:46935013-46935035 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989888925 5:46939272-46939294 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989889203 5:46944726-46944748 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989889480 5:46950181-46950203 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989889615 5:46952905-46952927 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989890118 5:46962799-46962821 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989890245 5:46965354-46965376 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989890437 5:46969274-46969296 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989891146 5:46983080-46983102 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989891512 5:46990407-46990429 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989891785 5:46995692-46995714 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989892364 5:47006942-47006964 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989892645 5:47012396-47012418 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989892860 5:47016487-47016509 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989893323 5:47025863-47025885 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989893469 5:47028590-47028612 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989894467 5:47047603-47047625 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989894938 5:47056636-47056658 TTGTTGCCTATGGTGGAAAAAGG + Intergenic
989895267 5:47062989-47063011 CTGTTGCCTATGGTGGAAAAAGG - Intergenic
989895474 5:47067080-47067102 CTGTTGCCTATGGTGGAAAAAGG - Intergenic
989895605 5:47074240-47074262 CTGTTGCCTATGGTGGAAAAAGG - Intergenic
989895875 5:47079561-47079583 CTGTTGCCTATGGTGGAAAAAGG - Intergenic
989897383 5:47109160-47109182 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989897551 5:47112227-47112249 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989897773 5:47116315-47116337 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989898294 5:47126029-47126051 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989898348 5:47127052-47127074 TTGTTGCCTATGTTGGAAAAAGG + Intergenic
989898949 5:47138297-47138319 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989899003 5:47139319-47139341 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989899176 5:47142385-47142407 TTGTGGTCTAAGATGGAAAAGGG + Intergenic
989899221 5:47143236-47143258 TTGTTGCCTATGTTGGAAAAAGG + Intergenic
989899394 5:47146303-47146325 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989899446 5:47147325-47147347 TTGTTGCCTATGTTGGAAAAAGG + Intergenic
989899616 5:47150393-47150415 TTGTGGTCTAAGATGGAAAAGGG + Intergenic
989899669 5:47151416-47151438 CTGTTGCCTATGGTGGAAAAAGG + Intergenic
989945029 5:50214084-50214106 TTGTTGTCTATGGTGGAAAAGGG - Intergenic
990793466 5:59511534-59511556 TTGTTGACTAATATGCACAATGG + Intronic
991210258 5:64096278-64096300 GTGTTGTCTTACATGGCAAAAGG - Intergenic
991934359 5:71787232-71787254 TCTTTGACTAAAATGGAAAATGG + Intergenic
994706290 5:103210608-103210630 TTGTTGACTATGAAAGAAAAGGG - Intronic
996103764 5:119473758-119473780 GTGTTTAGTAAGATGGGATAGGG + Intronic
996356845 5:122604884-122604906 ATGCTTACTAAGATGGGAAAGGG - Intergenic
996876127 5:128242436-128242458 CTGTTGACTAAGCTGGAATTCGG - Intergenic
998068270 5:139176476-139176498 GAGTGGACTAAGATAGAAATTGG - Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
1000954560 5:167527514-167527536 TTGTTGACTAAGGGGGACAAGGG - Intronic
1001129153 5:169049100-169049122 GTCTTGACTAACATGGGTAATGG - Intronic
1002070881 5:176678406-176678428 GTGATGACTAGGAAGGAAAGAGG + Intergenic
1003783912 6:9461503-9461525 ATGTTCACTAAGAGGCAAAATGG - Intergenic
1004102797 6:12631750-12631772 GTCTTGTGTAAGATGAAAAAAGG + Intergenic
1004312317 6:14556359-14556381 GAGCTGAACAAGATGGAAAAGGG - Intergenic
1004461014 6:15836062-15836084 GTGTTCACAGAGAAGGAAAAGGG - Intergenic
1005199258 6:23324787-23324809 TTGTTCACTTTGATGGAAAAAGG + Intergenic
1005684470 6:28239540-28239562 GTTTTGTATAATATGGAAAAGGG - Intergenic
1008626266 6:53319853-53319875 GTGTTTACAAAGATGACAAAGGG - Intronic
1008762447 6:54868891-54868913 GTCTCCACTAAGATGGTAAATGG + Intronic
1012370384 6:98498424-98498446 GTTTTCACTAAGAAGGAAACGGG - Intergenic
1013917182 6:115354817-115354839 GTGTTAACTAGGAAAGAAAAAGG - Intergenic
1014368529 6:120576006-120576028 GTAATGACATAGATGGAAAAGGG - Intergenic
1018628323 6:165801659-165801681 GTGTTGATTTAGCTTGAAAAGGG - Intronic
1020913089 7:14158237-14158259 GTGTTGTCTCAGATAGAAGAGGG - Intronic
1022014088 7:26333877-26333899 GTTTTGATTATGATGGGAAAAGG - Intronic
1022674630 7:32487555-32487577 GTGGTGCATAAGATGGGAAAGGG - Intronic
1024265235 7:47601287-47601309 GTGTTGACTGAAATTAAAAAGGG + Intergenic
1025969581 7:66309692-66309714 GTCTTTACTAACAGGGAAAAAGG - Intronic
1027150914 7:75733067-75733089 GTTTTTACTTAGCTGGAAAATGG - Intronic
1027419298 7:78004299-78004321 TTGTTGACTCAGATTAAAAACGG + Intergenic
1028103150 7:86846117-86846139 GTGTTGACAAAGAATGAGAAAGG - Intronic
1028465943 7:91151804-91151826 ATGGTCACTAAGATGGAGAAAGG + Intronic
1031790452 7:126095083-126095105 TTATGGACTAAGATGGAAAATGG - Intergenic
1031928546 7:127661666-127661688 CTGTTGACCAAAATGAAAAAAGG - Intronic
1032630962 7:133651491-133651513 TTGTTGACTATAATGGAAATAGG + Intronic
1033046099 7:137963270-137963292 GTGCTGACTAAGTGGGAACAGGG - Intronic
1033982100 7:147178100-147178122 GTGTTGCCTTACATGGCAAAAGG + Intronic
1035912595 8:3583978-3584000 GTGTTGACTCAGTTAGACAAAGG - Intronic
1036045851 8:5139591-5139613 GTGTTGACACAAATGGAAGATGG - Intergenic
1037457005 8:19073610-19073632 GTCTTGTCTGAGAGGGAAAAAGG + Intronic
1038399541 8:27272481-27272503 GTGTTGTCTGGGATGGAGAAAGG + Intergenic
1038503228 8:28062788-28062810 GTGTTTACTAACATGAGAAAAGG + Intronic
1040844867 8:51826653-51826675 TTGTTAACAAAGATTGAAAACGG + Intronic
1043005127 8:74809400-74809422 TTGTTCACTAAGAGGCAAAATGG + Intronic
1043059669 8:75484289-75484311 GTTTTCAGTAAAATGGAAAATGG + Intronic
1043605463 8:81993249-81993271 ATGATGACTAGGATGGGAAACGG - Intergenic
1044359627 8:91266775-91266797 GTGTTGAATAAAAGTGAAAATGG + Intronic
1045000390 8:97873103-97873125 GTGTTGCCTTACATGGCAAAAGG - Intronic
1045414250 8:101950905-101950927 GAGTTGACTCAGATGGCAATAGG + Intronic
1045702491 8:104882583-104882605 GTCTTGACTAACTTGGAAATTGG + Intronic
1046889167 8:119402108-119402130 GTGATGACAATGATGGAACATGG - Intergenic
1047002458 8:120586650-120586672 GTGTTGACTTACCTGGGAAAGGG - Intronic
1048777266 8:137961083-137961105 ATGTTGGCTAAAATGGAAACAGG + Intergenic
1053229740 9:36397660-36397682 GTGATGAAAAAGAAGGAAAAGGG + Intronic
1060367843 9:123037112-123037134 GTGTTCAGTGAGATGGAAGATGG + Intronic
1060672370 9:125481076-125481098 GTGAAAACTAAGATTGAAAAGGG + Intronic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1203355573 Un_KI270442v1:136711-136733 TTGTGGCCTATGATGGAAAAGGG - Intergenic
1203407580 Un_KI270538v1:57613-57635 GTGTTGCCTATGGTGGAAAAAGG - Intergenic
1203407827 Un_KI270538v1:62414-62436 GTGTTGCCTATGGTGGAAAAAGG - Intergenic
1203408884 Un_KI270538v1:76459-76481 TTGTTGCCTATGGTGGAAAAAGG - Intergenic
1185531098 X:819845-819867 GTGTAGACGCAGATGGACAAGGG - Intergenic
1186281444 X:7997488-7997510 GTGTTGACACAGTTGTAAAAAGG - Intergenic
1186356084 X:8792036-8792058 ATGTTGACTTAGTTGGCAAAAGG + Intronic
1188557078 X:31424541-31424563 GTGCTTACAAAGATGGAAGATGG + Intronic
1188793259 X:34431222-34431244 TTATTGACTAAGAAGGTAAAGGG + Intergenic
1188877633 X:35450413-35450435 TTGTTGACTGAAATGAAAAATGG - Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1189753064 X:44242670-44242692 GTGTTGACTGAGATAGGAGAGGG - Intronic
1189780407 X:44508445-44508467 GTGTTCACTAAGAGGCAAAATGG - Intergenic
1192118048 X:68430131-68430153 GTGTTGAGGAAAAAGGAAAAAGG - Intronic
1192302440 X:69919206-69919228 GTGATGACTAAGGGGGAAGAGGG + Intronic
1193470341 X:81893526-81893548 GGGTTGAGTATGGTGGAAAAAGG + Intergenic
1194408359 X:93526497-93526519 ATGTTGCCTTACATGGAAAAAGG + Intergenic
1194913094 X:99671344-99671366 GTGTTTAATAAAATGGCAAATGG + Intergenic
1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG + Intronic
1197026092 X:121751453-121751475 GTGATGAGTAAGAGGGAAAGAGG + Intergenic
1197108941 X:122749355-122749377 GTTTTGTCTATGATAGAAAAAGG - Intergenic
1199507414 X:148579908-148579930 GTGTGTACTAAGAGTGAAAAAGG + Intronic
1199768339 X:150956979-150957001 ATGTTGCCTTATATGGAAAAAGG - Intergenic
1201492417 Y:14556815-14556837 GTGTGGTCTTACATGGAAAAGGG - Intronic
1201925735 Y:19285628-19285650 GCTTTCACTAAGATGAAAAAGGG + Intergenic