ID: 1124183276

View in Genome Browser
Species Human (GRCh38)
Location 15:27498698-27498720
Sequence CAGCCTGGCCTCAAATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 517}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124183276_1124183279 -1 Left 1124183276 15:27498698-27498720 CCAGGCTATTTGAGGCCAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 517
Right 1124183279 15:27498720-27498742 GGTCTCAAACTCCTGACCTCAGG 0: 23620
1: 59671
2: 78635
3: 54766
4: 26318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124183276 Original CRISPR CAGCCTGGCCTCAAATAGCC TGG (reversed) Intronic
900843806 1:5079926-5079948 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
901259568 1:7861654-7861676 GAGCCTGGCCCCAGGTAGCCAGG + Intergenic
901370756 1:8795371-8795393 CAGGCTGGCCTCAAATTCCTGGG + Intronic
902118669 1:14142977-14142999 CATGCTGGCCTCAATTAGACAGG - Intergenic
903963027 1:27069136-27069158 CAGCCTGGTCTCAAACTGCCAGG - Intergenic
904143777 1:28373634-28373656 CAGCCTGGTCTCAAATTCCTTGG + Intronic
904228473 1:29045563-29045585 CAGGCTGGTCTCAAATTCCCAGG + Intronic
904730530 1:32587568-32587590 CAGCCTGGTCTCAAACTGCTGGG - Intronic
904805141 1:33125949-33125971 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
905874966 1:41426735-41426757 CAGCCAGGCCTCTAATAGAATGG - Intergenic
906989382 1:50721832-50721854 CAGCCTGGTCTCAAACACCTGGG + Intronic
907750614 1:57259556-57259578 CAGCAGGGCCTCAAATATTCTGG - Intronic
908368429 1:63453021-63453043 CAGTCTGGCCTCAAAAACTCTGG - Intronic
912988166 1:114455819-114455841 CAACCTGACCTCAAATTGCCTGG + Intronic
913027042 1:114854302-114854324 CTGCCTCTCCTAAAATAGCCGGG - Intergenic
913218853 1:116643532-116643554 CAGGCTGGCCTCAGATCACCAGG - Intronic
913659961 1:120998085-120998107 CAGGCTGGTCTCAAATTGCTGGG - Intergenic
914011319 1:143781236-143781258 CAGGCTGGTCTCAAATTGCTGGG - Intergenic
914166515 1:145179900-145179922 CAGGCTGGTCTCAAATTGCTGGG + Intergenic
914649941 1:149689875-149689897 CAGGCTGGTCTCAAATTGCTGGG - Intergenic
914821837 1:151110669-151110691 CAGCCTGGCCTCAAACTCCTGGG + Intronic
915606247 1:156953231-156953253 CAGCCTGGTCTCAAACTGCTGGG - Intronic
915738382 1:158099100-158099122 CACCCTGGCCTCAGAAATCCTGG + Intronic
916548885 1:165830821-165830843 CAGGCTGGCCTCAAACTCCCGGG - Intronic
916686672 1:167153465-167153487 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
917468323 1:175304318-175304340 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
918036974 1:180883174-180883196 CAGACTGGTCTCAAACTGCCGGG + Intronic
919561441 1:199125150-199125172 CAGCCTGGTCTCAAATGCCTGGG - Intergenic
919891901 1:201982014-201982036 CAGCCAGGCCTTAAATTGCGCGG + Intergenic
920082226 1:203383172-203383194 CAGCCTGGGCTCAATGAGTCAGG - Intergenic
921068772 1:211642078-211642100 CAGCCTGGTCTCAAATTCCTGGG + Intergenic
921157314 1:212448862-212448884 CAGACTGGCCTCAAACACCTGGG - Intergenic
922713483 1:227851948-227851970 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
922978952 1:229808850-229808872 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
923479890 1:234373958-234373980 CAGCGTGGGCTCAGAAAGCCCGG - Intronic
923565169 1:235071003-235071025 CAGGCTGGTCTCAAATGGCTGGG + Intergenic
924408818 1:243782031-243782053 CAGCCTGGTCTCAAATTCCTGGG + Intronic
924507278 1:244697675-244697697 CAGCATGGCCAAAAGTAGCCAGG - Intronic
924906950 1:248465194-248465216 CAGGCTGGTCTCAAATACCCAGG - Intergenic
1062927642 10:1328779-1328801 CAGCCTGGTCTCAAATCCCTGGG - Intronic
1063023383 10:2153441-2153463 CAGGCTGGCCTCAAACTCCCCGG - Intergenic
1063402686 10:5762063-5762085 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1063673976 10:8123390-8123412 CAGGCTGGACTCAAATTCCCGGG + Intergenic
1063770315 10:9189987-9190009 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1064107367 10:12511388-12511410 CAGGCTGGTCTCAAATTGCTGGG - Intronic
1064187242 10:13172996-13173018 CAGCCTGGCCTCAAACTCCTAGG - Intronic
1064388839 10:14923590-14923612 CAGGCTGGCCTCAAATCCCTGGG - Intronic
1064902503 10:20310525-20310547 CAGGCTGGCCTCAAATTCCTAGG - Intergenic
1065531738 10:26676758-26676780 CAGCCTGGCCTCAAACTCCTGGG - Intergenic
1066387371 10:34952617-34952639 CAGACTGGCCTCAAATTCCTGGG + Intergenic
1066656162 10:37701384-37701406 CAGCCTGACCCAAAATAGCCTGG - Intergenic
1067040650 10:42951640-42951662 CAGCCTGACCCAAAATAGCCTGG - Intergenic
1067939546 10:50642691-50642713 CAGACTGGCCTCAAATTCCTGGG - Intergenic
1068959332 10:62850866-62850888 AAGTCTGTCCCCAAATAGCCTGG - Intronic
1069475782 10:68730901-68730923 CAGGCTGCCCTCAAATTGCTGGG + Intronic
1069476432 10:68737292-68737314 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1070617329 10:77979021-77979043 CAGCCTGGCCTCAAACTCCTGGG + Intronic
1071477508 10:86037293-86037315 CATCCGGGCCTCAAAAAGCAGGG + Intronic
1071531821 10:86395639-86395661 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1071850169 10:89560563-89560585 CAGGCTGGCCTCAAATTCCCGGG - Intergenic
1072322576 10:94264915-94264937 CAGCCTGGCCTCAAACTTCTGGG - Intronic
1072721263 10:97782356-97782378 CAGCCTGGTCTCAGCCAGCCTGG - Intergenic
1072981130 10:100098504-100098526 CAGGCTGGCCTAAAATACCTGGG + Intergenic
1073148575 10:101296412-101296434 CAGACTGGCCTCAAATTCCTGGG + Intergenic
1073373229 10:103009479-103009501 CAGGCTGGTCTCAAATTCCCAGG - Intronic
1074024243 10:109617269-109617291 TACCCTGGCCTGAAATACCCTGG - Intergenic
1074185680 10:111098004-111098026 CTGCATGGCCTAATATAGCCTGG + Intergenic
1074357885 10:112802035-112802057 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1075509511 10:123059556-123059578 CAGGCTGGTCTCAAATTTCCTGG - Intergenic
1075540248 10:123306811-123306833 CCTCCTGGCCTCATCTAGCCTGG + Intergenic
1076321891 10:129589272-129589294 CAGCCAGGCCTCAAGCCGCCTGG + Intronic
1076639759 10:131906708-131906730 CAGGCTGGTCTCAAATTGCTGGG - Intronic
1076784853 10:132744774-132744796 CAGCCCGGCCTCATGAAGCCTGG - Intronic
1076836434 10:133023455-133023477 CAGGCTGGCCTCACATGACCAGG + Intergenic
1077420494 11:2447765-2447787 AAGCCTGGCCTTGAAGAGCCAGG + Intronic
1077689513 11:4328364-4328386 CAGGCTGGTCTCAAAAGGCCAGG - Intergenic
1078379142 11:10824057-10824079 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1078519170 11:12049688-12049710 TAGCCTGGGCTCAAATTGCTGGG + Intergenic
1079187445 11:18249730-18249752 CAGGCTGGCCTCAAATTTCTGGG - Intergenic
1080883696 11:36346167-36346189 CAGCCTGGGCTCAAATAATAAGG - Intronic
1081810995 11:45914058-45914080 AATCCTGGCCTCACATAGGCGGG - Intronic
1082943561 11:58734347-58734369 CAGCCTGGTCTCAAACTCCCAGG - Intergenic
1086967841 11:93048303-93048325 CAGCCTGGCCTCAAACACCTGGG + Intergenic
1087433133 11:98079088-98079110 CAGACTGGTCTCAAATTGCTGGG - Intergenic
1087656953 11:100935919-100935941 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1088196895 11:107284223-107284245 CAGGCTGGTCTCAAAACGCCTGG - Intergenic
1088631236 11:111775662-111775684 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1088684319 11:112272251-112272273 CTGCCTGGCCTGATATTGCCAGG + Intergenic
1089053980 11:115569799-115569821 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1089669175 11:120040580-120040602 CAGACTGGCCTCTACTTGCCAGG + Intergenic
1090095436 11:123738219-123738241 CAGGCTGGTCTCAAATACCTGGG + Intronic
1091764052 12:3106822-3106844 CAGCCTGGCGCTATATAGCCAGG - Intronic
1091795854 12:3297193-3297215 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1091952980 12:4610581-4610603 CTTCCTGGCCTCAAACTGCCTGG + Intronic
1092367188 12:7886415-7886437 CAGGCTGGTCTCAAATACCTGGG + Intronic
1092480051 12:8851614-8851636 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1092533272 12:9362868-9362890 CAGGCTGGTCTCAAATTGCTTGG + Intergenic
1093247645 12:16759878-16759900 CAGGCTGGTCTCAAATTGCTGGG + Intergenic
1095090802 12:38102512-38102534 CAGGCTGGTCTCAAATTGTCAGG + Intergenic
1095796691 12:46226834-46226856 CAGGCTGGTCTCAAACTGCCAGG + Intronic
1096381218 12:51159696-51159718 CAGGCTGGCCTCAAACTCCCAGG + Intronic
1096643662 12:53015478-53015500 CAGGCTGGTCTCAAGTATCCTGG - Intronic
1096757979 12:53815995-53816017 CAGGCTGGTCTCAAACTGCCGGG + Intergenic
1097708212 12:62890248-62890270 CAGGCTGGTCTCAAATACCTGGG - Intronic
1098519242 12:71417043-71417065 GAGCCTGCCCTGAAATAGGCTGG - Intronic
1100490606 12:95074253-95074275 CAGGCTGGCCTCAAACAACCGGG - Intergenic
1101919018 12:108917854-108917876 CAGGCTGGTCTCAAACATCCGGG + Intronic
1101957463 12:109223544-109223566 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1102094503 12:110226069-110226091 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1102647188 12:114411326-114411348 CAGCCAGGCCTCACAGAGCAAGG + Intergenic
1102948169 12:117008904-117008926 CAGCCTGGCCAAAATTAGCCAGG + Intronic
1102983053 12:117257649-117257671 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1103482461 12:121259870-121259892 CAGCCTGGCCTCAAATGCCTGGG - Intronic
1103585322 12:121949374-121949396 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1103596732 12:122028803-122028825 GAGCCTGGCATGTAATAGCCTGG + Intronic
1103654524 12:122459592-122459614 CAGGCTGGCCTCAAATTCCAGGG - Intergenic
1103697989 12:122832527-122832549 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1104176428 12:126337288-126337310 CAGCCTGGCCAAAATTAGCTGGG - Intergenic
1104764512 12:131317868-131317890 CAGCCTGGGCTCAAACCCCCGGG + Intergenic
1105385260 13:19923567-19923589 CAGCCTGGTCTCAAATTCCTGGG + Intergenic
1105401271 13:20098121-20098143 AAGCCTGGCCTCAAGCATCCTGG - Intergenic
1105481763 13:20784730-20784752 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1105504024 13:20994682-20994704 CAGTCTGGCCTCAAACTCCCGGG - Intronic
1105827896 13:24138800-24138822 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1106171207 13:27290168-27290190 CAGGCTGCCCTCAAATTCCCCGG + Intergenic
1106604295 13:31213377-31213399 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1107475809 13:40734688-40734710 CAGGCTGGCCTCAAACTGCTGGG - Intronic
1107502787 13:40997601-40997623 CAGGCTGGTCTCAAATTCCCAGG + Intronic
1110229832 13:73156327-73156349 CAGCCTGGCCTCAAACTCCTGGG + Intergenic
1112600475 13:100850641-100850663 CAGCCTGGTCTCAAAGTACCTGG + Intergenic
1113826219 13:113256109-113256131 CAGGCTGGCCTCAAACTCCCGGG - Intronic
1113828595 13:113276393-113276415 CAGCCTGGTCTCAAATTCCTGGG + Intergenic
1113913649 13:113857001-113857023 CAGCCAGCCCTCAGAGAGCCTGG - Intronic
1114496085 14:23133225-23133247 CAGACTGGCCTCAAACTTCCGGG - Intronic
1115218523 14:31036291-31036313 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1116287588 14:42992270-42992292 CAGACTGGTCTCAAATTGCTGGG + Intergenic
1116971510 14:51071126-51071148 CACCCTGGCCTCAAAGTGCTAGG - Intronic
1118011702 14:61616409-61616431 CAGCCTGGGCTCCAGGAGCCTGG + Intronic
1118697323 14:68397722-68397744 CAGCCTTGCCTCAGAAAGCCGGG + Intronic
1119024820 14:71144202-71144224 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1119395690 14:74324675-74324697 CAGGCTGGCCTCAAACTACCGGG - Intronic
1120359617 14:83481771-83481793 CAGGCTGGTCTCAAATACCTGGG + Intergenic
1120713621 14:87817820-87817842 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1120768697 14:88355796-88355818 CAGTCTGGTCTCAAACTGCCGGG + Intergenic
1120851117 14:89172294-89172316 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1120990148 14:90368366-90368388 CAGCCTGGCCTCAAAACTCCTGG + Intergenic
1122054201 14:99081517-99081539 CAGCGTGGCCCCAAAATGCCTGG - Intergenic
1122193539 14:100067530-100067552 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1122512057 14:102277100-102277122 CAGCCTGGTCTCAAATTCCTGGG + Intronic
1122576463 14:102746045-102746067 CAGCCTGGTCTCAAATTCCTGGG + Intergenic
1124183276 15:27498698-27498720 CAGCCTGGCCTCAAATAGCCTGG - Intronic
1124873631 15:33568639-33568661 CAGGCTGGTCTCAAATTGCTGGG + Intronic
1124908063 15:33890895-33890917 CAGGCTGGCCTCAAATTTCAGGG - Intronic
1125184002 15:36909990-36910012 CAGGCTGGCCTCAAACTGCGCGG - Intronic
1125358979 15:38846232-38846254 CAGCCTGGCCTCAATATTCCTGG + Intergenic
1125673315 15:41488728-41488750 CAGGCTGGCCTCAAATTCCTAGG + Intergenic
1126817856 15:52471542-52471564 CAGGCTGGCCTCAAGTTGCTGGG - Intronic
1127753722 15:62069370-62069392 CAGCCTGGTCTCAAATTCCTGGG - Exonic
1128318398 15:66675727-66675749 AAGCCTGGCCCCAGACAGCCTGG + Intronic
1128499943 15:68221060-68221082 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1128803587 15:70513904-70513926 CAGCCTGGGACCAAATAGCTGGG - Intergenic
1129359411 15:75015216-75015238 AACCGTGGCCTCAAACAGCCAGG - Intronic
1129433387 15:75518159-75518181 CAGCCTGGTCTCAAATTCCTGGG - Intronic
1129593566 15:76940252-76940274 CAGACTGGCCTCAAATTCCTGGG - Intronic
1130121859 15:81057031-81057053 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1130261774 15:82359941-82359963 CAGCCTGGTCTCAAACTCCCGGG + Intergenic
1130279460 15:82509070-82509092 CAGCCTGGTCTCAAACTCCCGGG - Intergenic
1130313817 15:82778058-82778080 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1130470839 15:84225259-84225281 CAGCCTGGTCTCAAACTCCCGGG - Intergenic
1130478328 15:84339827-84339849 CAGCCTGGTCTCAAACTCCCGGG - Intergenic
1130493437 15:84448303-84448325 CAGCCTGGTCTCAAACTCCCGGG + Intergenic
1130585161 15:85175008-85175030 CAGCCTGGTCTCAAACTCCCGGG - Intergenic
1130593128 15:85229886-85229908 CAGCCTGGTCTCAAACTCCCGGG - Intergenic
1130614083 15:85387533-85387555 CAGGCTGGCCTCAAACTCCCGGG + Intronic
1131161640 15:90108994-90109016 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1131207235 15:90460786-90460808 CAGCCTGGTCTCAAATTCCTGGG - Intronic
1132055383 15:98647882-98647904 CAGCCTGGCGTGAAAGTGCCCGG + Intergenic
1132105972 15:99062885-99062907 CAGCCTGGGCTCAAATCCCAGGG - Intergenic
1132513102 16:353561-353583 CAGCCTGGACTCACAGCGCCAGG + Intergenic
1132709956 16:1262063-1262085 CAGGCTGGCCTCAAACTCCCCGG + Intergenic
1132799022 16:1742384-1742406 CAGCCTGGCCTCGGACAGCCTGG - Intronic
1132848264 16:2010831-2010853 CAGGCTGGTCTCAAATTCCCAGG - Intronic
1133063287 16:3188985-3189007 CTGCCTGGCCTCAAGTGCCCAGG - Intergenic
1133392953 16:5423850-5423872 ATGCCTGGCCTCAATGAGCCTGG - Intergenic
1134261967 16:12658472-12658494 CAGGCTGGCCTCAAACTGCTGGG - Intergenic
1134502850 16:14782676-14782698 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1134577713 16:15346219-15346241 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1134724875 16:16411328-16411350 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1134942557 16:18300531-18300553 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1135208188 16:20499950-20499972 CAGCCTGTCCACACCTAGCCAGG - Intergenic
1135210711 16:20523750-20523772 CAGCCTGTCCACACCTAGCCAGG + Intergenic
1135268987 16:21052844-21052866 CAGCGTGGCCTTATATAGCAGGG + Intronic
1135432514 16:22397749-22397771 CAGCCTGGTCTCAAATTTCTGGG - Intronic
1135468221 16:22705632-22705654 CACTCTGGCATCAAATTGCCTGG - Intergenic
1135700083 16:24624692-24624714 CAGGCTGGCCTCAAACTTCCGGG + Intergenic
1136553488 16:30994371-30994393 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1137541230 16:49363349-49363371 CAGGCTGGCCTCAAAACTCCTGG + Intergenic
1138250623 16:55499205-55499227 CAGCTTGGAGTCACATAGCCAGG + Intronic
1138571690 16:57878163-57878185 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
1138644169 16:58411180-58411202 CAGGCTGGTCTCAAACACCCAGG - Intergenic
1138884796 16:61063612-61063634 CAGGCTGGCCTCAAATTTCTGGG - Intergenic
1139425860 16:66879734-66879756 CAGGCTGGTCTCAAACTGCCGGG - Intronic
1140685199 16:77426810-77426832 CAGGCTGGCCTCAAATTTCTGGG - Intronic
1140866141 16:79063991-79064013 CAACTTGTCCTCAAATGGCCTGG - Intronic
1141365994 16:83443658-83443680 CAGGCTGGCCTCAAATTCCCAGG - Intronic
1141588471 16:85050943-85050965 CAGGCTGGTCTCAAATACCTGGG - Intronic
1141626657 16:85264901-85264923 CTGCCTGGCCTCACACAGCTTGG - Intergenic
1141969221 16:87469121-87469143 CAGGCTGGTCTCAAATTGCCAGG + Intronic
1142620605 17:1163367-1163389 CAGCTTGGCCTCTAGGAGCCAGG + Intronic
1142638995 17:1274521-1274543 CAGGCTGGTCTCAAATACCTGGG + Intergenic
1142706833 17:1700545-1700567 CAGGCTGGTCTCAAATTGCTGGG - Intergenic
1142793874 17:2291660-2291682 CAGGCTGGCCTCAAAACACCTGG - Intronic
1143212635 17:5200015-5200037 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1144547230 17:16208638-16208660 CAGGCTGACCTCAAATTGCTGGG - Intronic
1145299147 17:21618726-21618748 CAGGCTGACCTCAAATTGCTGGG + Intergenic
1145351132 17:22084557-22084579 CAGGCTGACCTCAAATTGCTGGG - Intergenic
1145728144 17:27152899-27152921 CAGCCAGCCCTCAAATCACCAGG + Intergenic
1145899617 17:28481869-28481891 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1146008208 17:29175572-29175594 CAGCCTGGTCTCAAATTCCTGGG + Intronic
1146201553 17:30862978-30863000 CAGCCTGGCCTCAAACTCCTAGG - Intronic
1148023784 17:44571075-44571097 CAGACTGGCCTCAAATTCCTGGG - Intergenic
1148137815 17:45306530-45306552 CACCCAGGCCTGACATAGCCAGG + Intronic
1148244685 17:46022852-46022874 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1148639958 17:49180050-49180072 CAGGCTGGTCTCAAATACCTGGG + Intergenic
1148767174 17:50046202-50046224 CAGCCTGACCGCACAAAGCCAGG + Intergenic
1148790668 17:50170847-50170869 CAGGCTGGCCTCAAACTTCCAGG - Intronic
1149475064 17:56953902-56953924 CAGCTTGGCATCTAATAGCAAGG + Intronic
1149594010 17:57852764-57852786 CAGCCTGGGCAAAATTAGCCAGG + Intergenic
1149611659 17:57961996-57962018 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1150058042 17:62037742-62037764 CAGGCTGGTCTCAAATTGCTGGG - Intronic
1150161889 17:62905512-62905534 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1150176851 17:63066332-63066354 CAGGCTGGCCCCACATACCCAGG - Intronic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1150681774 17:67290437-67290459 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1151219543 17:72602326-72602348 CAGCTTGGCCTCAAATGCCTGGG - Intergenic
1151601083 17:75106540-75106562 CAGGCTGGCCTCAAACTCCCAGG - Intergenic
1151632017 17:75317453-75317475 CAGACTGGCCTCAAAACTCCTGG + Intergenic
1152525920 17:80888324-80888346 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1152577646 17:81149827-81149849 CAGCCCAGCCTCAAAATGCCCGG + Intronic
1152631675 17:81413385-81413407 CAGCCTCGCCTCAGATGTCCAGG - Intronic
1153170825 18:2314029-2314051 CAGGCTGGTCTCAAATACCTGGG - Intergenic
1153886020 18:9467424-9467446 CAGGCTGGCCTCAAACACCTAGG + Intergenic
1153889386 18:9498577-9498599 CAGGCTGGCCTCAAAACTCCTGG + Intronic
1154305286 18:13226229-13226251 CAGGCTGGTCTCAAATTCCCGGG + Intronic
1155611270 18:27670572-27670594 TAGTCTGGCTTCAAATAGCTTGG - Intergenic
1155863371 18:30932715-30932737 CAGCCTGGTCTCAAACACCTGGG - Intergenic
1158592313 18:58788281-58788303 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
1159586206 18:70286077-70286099 CAGGCTGGTCTCAAATTCCCTGG + Intergenic
1160937545 19:1604287-1604309 CAGGCTGGTCTCAAATTCCCAGG + Intronic
1161251593 19:3283558-3283580 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1161305859 19:3567457-3567479 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1161334897 19:3707793-3707815 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1161350399 19:3787971-3787993 CAGGCTGGCCTCAAATGCCTGGG + Intronic
1161621616 19:5300558-5300580 CAGGCTGGTCTCAAAAACCCAGG - Intronic
1162305194 19:9868415-9868437 CAGCCTGGTCTCAAATTCCTGGG + Intronic
1162747950 19:12809822-12809844 AAGCCTGGCCTCAAACTCCCAGG + Intronic
1163546382 19:17943449-17943471 CAGCCTTGCCCCGAAAAGCCCGG - Intronic
1163763759 19:19151040-19151062 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1165019769 19:32914480-32914502 CAGGCTGGTCTCAAATTTCCAGG + Intronic
1165162022 19:33822032-33822054 GAGCCTGGCCTCCAGTAACCAGG - Intergenic
1165464239 19:35963165-35963187 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1165478962 19:36050352-36050374 CAGGCTGGTCTCAAATTGCTGGG + Intronic
1166034895 19:40160990-40161012 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1166519023 19:43467090-43467112 CAGCCTGGTCTCAAAACCCCTGG - Intergenic
1166582425 19:43914055-43914077 CAGCCAGGCCTCAAATCTTCTGG - Exonic
1166684497 19:44788005-44788027 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1166944132 19:46386820-46386842 CAGGCTGGTCTCAAATTGCTGGG + Intronic
1167352622 19:48985245-48985267 CAGGCTGGTCTCAAATTCCCGGG + Intronic
1167949310 19:53013641-53013663 CACCCAGGTCTCAACTAGCCTGG + Intergenic
1168547618 19:57266640-57266662 CAGGCTGGTCTCAAATACCTGGG - Intergenic
926200905 2:10796452-10796474 CAGCCTGGACTCAAATTCCTAGG - Intronic
927767069 2:25820810-25820832 CAGGCTGGTCTCAAATTTCCGGG - Intronic
929758011 2:44784275-44784297 CAGGCTGGTCTCAAATACCTGGG - Intergenic
930069624 2:47355597-47355619 CAGGCTGGCCTCAAATTCCTGGG + Intronic
931305996 2:61028970-61028992 CAGGCTGGTCTCAAATACCTGGG - Intronic
932746334 2:74336854-74336876 CTTCCCTGCCTCAAATAGCCAGG + Intronic
932848361 2:75157556-75157578 CAGGCAGCCCTGAAATAGCCTGG + Intronic
933676358 2:85061095-85061117 CAGCCTGGTCTCAAATTCCTGGG + Intergenic
933849156 2:86351827-86351849 CAGCCTGGCCTCAAACCTCTAGG + Intergenic
934692409 2:96371900-96371922 CAGTCTCCCCTCACATAGCCAGG + Intronic
934733967 2:96678338-96678360 CAGCCTGGTCTCAAAACTCCTGG + Intergenic
937174404 2:119913577-119913599 CAGCCTGGCCTCAAACTCCTAGG - Intronic
938023881 2:127928063-127928085 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
938040651 2:128073263-128073285 CAGGCTGGCCTCAAACACCTGGG + Intergenic
938422800 2:131157438-131157460 CAGTCGGGCCTCCTATAGCCAGG + Intronic
938860458 2:135362697-135362719 CAGGCTGGCCTCAAATTCCTAGG + Intronic
939721510 2:145658559-145658581 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
940560985 2:155296475-155296497 CAGACTGGCCTCAAATTCCCGGG - Intergenic
940563066 2:155326220-155326242 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
940589252 2:155699835-155699857 CAGGCTGGCCTCAAACACCTGGG + Intergenic
941102336 2:161309947-161309969 CAGCCTGGCCAAGACTAGCCTGG + Intronic
941194857 2:162436897-162436919 CAGGCTGGTCTCAAATACCTGGG - Intronic
942122307 2:172790405-172790427 TAGCCTGGCATCTAATATCCAGG - Intronic
943272269 2:185821711-185821733 CAGGCTGGTCTCAAATTGTCGGG - Intronic
943905403 2:193493906-193493928 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
944285999 2:197950364-197950386 CAGCCAGACCTCTAATAACCAGG + Intronic
944453882 2:199873704-199873726 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
944666831 2:201965803-201965825 CAGGCTGGTCTCAAACATCCTGG - Intergenic
945060750 2:205906756-205906778 AAACCTGGCCACAAATTGCCAGG + Intergenic
946267452 2:218559094-218559116 CAGGCTGGTCTCAAATTCCCAGG - Intronic
946674500 2:222144486-222144508 CAGCCTGGCCTCATGGACCCCGG + Intergenic
947532699 2:230922912-230922934 CAGGCTGGCCTCAAATTTCTGGG + Intronic
948072639 2:235140209-235140231 AGGCCTGGCCTCATATAGTCAGG - Intergenic
948540133 2:238685381-238685403 CAGCCTGGCCTCTAATTCCTAGG - Intergenic
1169168758 20:3446955-3446977 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1169225296 20:3852738-3852760 CAGGCTGGCCTCGAACAGCTGGG + Intronic
1170240124 20:14155949-14155971 CAGACTGGTCTCAAATTCCCAGG - Intronic
1170997509 20:21377465-21377487 CAGGCTGGTCTCAAATTTCCTGG + Intronic
1171030429 20:21671585-21671607 CAGCCTGGTCTCAAATTCCTGGG + Intergenic
1171561379 20:26129534-26129556 CAGGCTGACCTCAAATTGCTGGG - Intergenic
1171890099 20:30703793-30703815 AAGGATGGCCTCAAATAACCAGG + Intergenic
1172270172 20:33650575-33650597 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1172569717 20:35960561-35960583 CAGGCTGGCCTCAAACTGCTGGG + Intronic
1172663439 20:36583069-36583091 CAGGCTGGCCTCAAAACACCTGG - Intronic
1172803985 20:37598255-37598277 CAGCCTGACCTCAATTAGCCCGG - Intergenic
1173539868 20:43843229-43843251 GAGCCTGGCCTAAATGAGCCTGG - Intergenic
1173604513 20:44322119-44322141 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1174253769 20:49238818-49238840 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1174345885 20:49929587-49929609 CAGGCTGGTCTCAAACCGCCAGG + Intergenic
1175830775 20:61964632-61964654 CAGACTGGTCTCAAACTGCCAGG + Intronic
1176039034 20:63054824-63054846 CACCCTGGCCAGAAACAGCCTGG + Intergenic
1176210443 20:63918303-63918325 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1177823586 21:26058723-26058745 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1179122610 21:38562405-38562427 CAGCCTGGCTTTAAAGAGGCTGG + Intronic
1179971331 21:44837856-44837878 CAGCTTGGCCCCAAACACCCTGG - Intergenic
1180229405 21:46417688-46417710 CAGCCTGGTCTCAAATTCCTGGG - Intronic
1180820155 22:18821594-18821616 CAGGCTGGCCTCAGATCACCAGG - Intergenic
1181206378 22:21256066-21256088 CAGGCTGGCCTCAGATCACCAGG - Intergenic
1181397563 22:22632881-22632903 CAGACTGGCCTCAAATGCCAGGG + Intergenic
1181705535 22:24647562-24647584 CAGACTGGCCTCAAATGCCAGGG + Intergenic
1182125415 22:27812154-27812176 CAGGCTGGTCTCAAATATCTGGG - Intergenic
1182585311 22:31341454-31341476 CAGCCCTGCCTCAGATATCCCGG + Intronic
1183441426 22:37825179-37825201 CCGCCTGGCCTCACACTGCCTGG + Exonic
1183916478 22:41124584-41124606 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1184091671 22:42296205-42296227 CAGCCTGGCCTCCCCGAGCCAGG + Intronic
1184599703 22:45535970-45535992 CAGGCTGGCCTCAAAAACCTGGG - Intronic
1184913823 22:47553366-47553388 CAGCCTGGCCTCAAACTCCTGGG + Intergenic
1185282306 22:49978437-49978459 CAGGCTGGTCTCAAATTGCTGGG + Intergenic
1185333916 22:50263151-50263173 CTGCCTGACCCCAAATGGCCTGG + Intergenic
1203220542 22_KI270731v1_random:39357-39379 CAGGCTGGCCTCAGATCACCAGG + Intergenic
1203270282 22_KI270734v1_random:47465-47487 CAGGCTGGCCTCAGATCACCAGG - Intergenic
950195306 3:11005363-11005385 CAGCCTGGGTTCAAAAATCCCGG + Intronic
950222971 3:11210579-11210601 CAGGCTGGCCTCAAACACCTGGG - Intronic
950390173 3:12690349-12690371 CAGACTGGTCTCAAATTTCCTGG + Intergenic
952901844 3:38116130-38116152 CAGCCTGCCCACAAACAGGCCGG + Intronic
953794521 3:45974166-45974188 CAGCTTGGCCTCAAATTCCTGGG - Intronic
954018445 3:47716897-47716919 CAGACTGGCCTCAAATTCCTGGG - Intronic
954262631 3:49450589-49450611 CAGCCTGGCCTCAAACTCCTGGG - Intergenic
954433112 3:50481783-50481805 CAGCCTGGTCTCAAATTTCTGGG - Intronic
954453717 3:50585695-50585717 CAGCTTGGCCCCAAATCACCTGG + Intergenic
954465476 3:50652075-50652097 CTGGCTGGCTTCCAATAGCCTGG + Intergenic
954552634 3:51494766-51494788 CAGGCTGGTCTCAAATTGCTGGG + Intronic
955064344 3:55521694-55521716 CAGCCCAGCCTCACATAGCAAGG - Intronic
955319890 3:57966782-57966804 CAGGCTGGTCTCAAACTGCCAGG - Intergenic
956138831 3:66125760-66125782 CAGCCTGGCCTCAAACTCCTAGG + Intergenic
957058703 3:75463884-75463906 CAGGCTGGTCTCAAATTCCCGGG + Intergenic
960662367 3:120074510-120074532 CAGCCTGACCAAAATTAGCCGGG - Intronic
961227792 3:125269155-125269177 CAGGCTGGTCTCAAATTGCTGGG - Intronic
963804441 3:149709183-149709205 CAGGCTGGCCTCAAATTCCTGGG + Intronic
964502862 3:157367719-157367741 CAGGCTGGCCTCAAACATCTGGG + Intronic
965170655 3:165259156-165259178 CAGCCTGGCCTCAAACTCCTGGG + Intergenic
966093497 3:176169999-176170021 GAGCCTGGCCTCAAATGTTCAGG - Intergenic
967066361 3:185920483-185920505 CAGGCTGGTCTCAAATTCCCGGG + Intronic
967640301 3:191854816-191854838 CAGGCTGGTCTCAAATTTCCAGG - Intergenic
967888146 3:194346994-194347016 CAGCCTGGCCTCAAGAAAGCAGG + Intronic
968129181 3:196182608-196182630 CAGCCTGGCCTCAAACTCCTGGG + Intergenic
968227003 3:196979098-196979120 CAGCCTGGCCTCCCAGATCCCGG - Intergenic
968328036 3:197838207-197838229 CAGGCCGGCCTCAAACTGCCGGG - Intronic
968522278 4:1039441-1039463 CCGCTTGGCCTCATACAGCCAGG - Intergenic
968596400 4:1488274-1488296 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
969668226 4:8574565-8574587 CAGGCTGGTCTCAAATTGCTGGG + Intronic
970420298 4:15899530-15899552 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
970582686 4:17487750-17487772 CAGGCTGGCCTCAAACACCTGGG - Intronic
971730277 4:30370327-30370349 GAGCCCGGCCTCAGATGGCCAGG + Intergenic
972074943 4:35075822-35075844 CAGGCTGGCCTCAAACTGCAGGG - Intergenic
972404908 4:38736272-38736294 TAGCCTAGCCTTAAAGAGCCAGG - Intergenic
974164543 4:58184883-58184905 CAGGCTGGCCTCAAATTTCTGGG - Intergenic
975155608 4:71068775-71068797 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
975775543 4:77782688-77782710 CAGCCTGGCCTCAAACTCCTGGG + Intronic
977306288 4:95327721-95327743 GAGCCTGGCCGCAGATGGCCGGG + Intronic
978387072 4:108186863-108186885 CAGCCTGGCCTCAAACTCCTGGG + Intergenic
980911469 4:138998353-138998375 CAGACTGGTCTCAAATACCTGGG + Intergenic
980951685 4:139385204-139385226 CAGACTGGCCTCAAATTCCTGGG - Intronic
981647978 4:147021225-147021247 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
982055452 4:151544864-151544886 CAGGCTGGTCTCAAATACCTGGG - Intronic
983972824 4:173895254-173895276 CAGGCTGGTCTCAAATTTCCTGG - Intergenic
985127930 4:186713895-186713917 CAGGCTGGTCTCAAACACCCAGG + Intronic
985383668 4:189422249-189422271 CAGACGGGCCTCAGATACCCTGG - Intergenic
985436355 4:189933316-189933338 CAGCCTTGCCTAGAATAACCTGG + Intergenic
985444014 4:190009887-190009909 CACCCCCGCCTAAAATAGCCAGG - Intergenic
986215570 5:5716080-5716102 CTGCCTCCCCTCAAATAGACTGG + Intergenic
986682226 5:10244481-10244503 CAGGCTGGTCTCAAATTCCCGGG - Intronic
987263054 5:16222724-16222746 AAGCCTGGTCTCAAATAGGGGGG + Intergenic
987911431 5:24151721-24151743 CAGCCTGGCCTTTAAAAGCTTGG - Intronic
989392190 5:40912567-40912589 CAGGCTGGCCTCAAATTCCTGGG + Intronic
991384298 5:66067898-66067920 CAGGCTGGCCTCAAATTCCTGGG - Intronic
992418100 5:76572356-76572378 CAGCCTGGCCAACATTAGCCAGG - Intronic
992418291 5:76574462-76574484 CAGCCTGGCCAACATTAGCCAGG - Intronic
992984850 5:82217760-82217782 CAGGCTGGCCTCAAATTCCTGGG - Intronic
993710706 5:91221854-91221876 CAGGCTGGCCTCAAACTGCTAGG - Intergenic
994191932 5:96878581-96878603 CAGGCTGGCCTCAAATTCCTGGG - Intronic
994296938 5:98101516-98101538 CAGGCTGGTCTCAAACAGCTGGG + Intergenic
996555818 5:124777974-124777996 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
997291950 5:132743265-132743287 CAGGCTGGTCTCAAACAGCTGGG + Intergenic
998496687 5:142596392-142596414 CAGACTGGCCTCAAATTCCTGGG - Intronic
998496706 5:142596530-142596552 CAGACTGGCCTCAAATTCCTGGG - Intronic
998880792 5:146642844-146642866 CAGGCTGGTCTCAAATTCCCAGG - Intronic
999183106 5:149684027-149684049 CACCTTGGCCTCACAAAGCCTGG + Intergenic
999216788 5:149942171-149942193 CAGCCTGGTCTCAAATTTCTGGG + Intronic
999758762 5:154684231-154684253 CAGGCTGGTCTCAAATTTCCTGG - Intergenic
999781149 5:154851527-154851549 CAGGCTGGTCTCAAATACCTGGG - Intronic
999927521 5:156395391-156395413 CAATCTGGCCTAAAATGGCCAGG - Intronic
1000039003 5:157471200-157471222 CAGCCTGGCCTCTTAGAACCTGG + Intronic
1000084006 5:157873217-157873239 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1000207690 5:159077948-159077970 CAGGCTGGTCTCAAATTCCCTGG + Intronic
1000428175 5:161116986-161117008 CAGGCTGGCCTCAAACTCCCAGG + Intergenic
1000552606 5:162685476-162685498 CAGCCTGGCCAAAATTAGCTGGG - Intergenic
1001295952 5:170499074-170499096 AAGTCTGGCCTCAAATAGACTGG - Intronic
1002906676 6:1454774-1454796 CACCTTGGCCTCAAAATGCCAGG - Intergenic
1003301307 6:4885202-4885224 CAGGCTGGCCTCAAACTGCTAGG + Intronic
1003681059 6:8257613-8257635 CAGGCTGGTCTCAAACTGCCGGG - Intergenic
1004498704 6:16189478-16189500 CAGCCTGGTCTCAAATTCCTAGG - Intergenic
1006235856 6:32631347-32631369 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1006766841 6:36513791-36513813 CAGGCTGGTCTCAAACTGCCTGG - Intronic
1006769410 6:36539792-36539814 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1006868398 6:37228183-37228205 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1006930502 6:37685089-37685111 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1006957882 6:37892379-37892401 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1007170178 6:39857130-39857152 TACCCTGGCCACAAATAGACAGG + Intronic
1007538964 6:42623345-42623367 CAGCCTGCCCTCAAATTCCTGGG + Intronic
1007750902 6:44070985-44071007 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1008101206 6:47393038-47393060 CAGGCTGGCCTCAAATTTCTAGG + Intergenic
1010007286 6:71010070-71010092 GCCCCTGGCCTCAAAGAGCCTGG - Intergenic
1011371616 6:86643044-86643066 CAGCCTGGTCTCAAACTCCCAGG + Intergenic
1011562250 6:88632170-88632192 CAGGCTGGTCTCAAACACCCGGG + Intronic
1015478559 6:133681317-133681339 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1015628693 6:135208589-135208611 CAGCCTGGCCTCAAACTCCTGGG + Intronic
1015990919 6:138942037-138942059 CAGCCTGGCCAAAATTAGCCAGG - Intronic
1017474539 6:154775692-154775714 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1018491109 6:164294493-164294515 CTGCCTGCCCACAATTAGCCTGG - Intergenic
1019511863 7:1421724-1421746 CAGCCTGGCCTCCCATGTCCTGG - Intergenic
1019716127 7:2540275-2540297 CAGGCTGGCCTCAAAAGTCCTGG + Intronic
1020050692 7:5079695-5079717 CAGGCTGGTCTCAAAATGCCTGG - Intergenic
1024124543 7:46279207-46279229 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1025138743 7:56444372-56444394 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1025197277 7:56942978-56943000 CAGGCTGGCCTCAAACTGCTGGG + Intergenic
1025276451 7:57585840-57585862 CAGGCTGACCTCAAATTGCTGGG + Intergenic
1025674672 7:63633961-63633983 CAGGCTGGCCTCAAACTGCTGGG - Intergenic
1026082395 7:67233479-67233501 CAGCCTGACTTAAAAAAGCCAGG - Intronic
1026161528 7:67873619-67873641 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1026197037 7:68182033-68182055 CAGCCTGGTCTCAAACTCCCGGG - Intergenic
1026400057 7:70000979-70001001 CTGCCTGGCAGCAAAAAGCCTGG + Intronic
1026457434 7:70584881-70584903 AAGCCTGGCCTCACCCAGCCAGG + Intronic
1026807730 7:73438358-73438380 CAGCTTGGCCTCAAACTGCGTGG - Intergenic
1028162808 7:87505172-87505194 CAGGCTGGTCTCAAAAATCCTGG + Intronic
1028928091 7:96382298-96382320 CAGGCTGGTCTCAAATTGCTGGG + Intergenic
1029085881 7:98011388-98011410 CAGCCTGGCCAACGATAGCCAGG - Intergenic
1029109675 7:98206544-98206566 CAGCCTGGCCTCCGAAAACCAGG - Exonic
1029642583 7:101830342-101830364 CCGACTGGCCTGAAACAGCCTGG + Intronic
1030168731 7:106580430-106580452 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1031410726 7:121437626-121437648 CAGGCTGGTCTCAAATACCTGGG - Intergenic
1031618695 7:123909990-123910012 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1034437993 7:151072211-151072233 CAGCCTGGCCTCAAATCCAGAGG - Intronic
1034519551 7:151608935-151608957 CAGCCTGGCCTCAAACTCCTTGG + Intronic
1034593926 7:152169797-152169819 CAGGCTGGCCTCAAACACCTGGG - Intronic
1034626339 7:152495811-152495833 CAGGCTGGCCTCAAAACTCCTGG - Intergenic
1034633835 7:152551654-152551676 CAGGCTGGTCTCAAAACGCCTGG - Intergenic
1034680247 7:152923073-152923095 CGGCCTGGGCTCGAATCGCCCGG - Intergenic
1035131682 7:156660557-156660579 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1036797037 8:11763775-11763797 CAGGCTGGCCTCAAATTCCTGGG + Exonic
1037592677 8:20326431-20326453 CAGACTGGTCTCAAATACCTGGG - Intergenic
1037626859 8:20615705-20615727 CAGCTTGGCCTCCCAAAGCCTGG + Intergenic
1038455439 8:27669530-27669552 CAGCCTGGCCTCAGAGAAGCCGG - Intronic
1038960124 8:32509302-32509324 CAGGCTGGTCTCAAATTCCCAGG + Intronic
1039057219 8:33546492-33546514 CAGGCTGGCCTCAAATGCCTGGG - Intergenic
1039183017 8:34887684-34887706 CAGGCTGGTCTCAAATTCCCAGG - Intergenic
1039305002 8:36251894-36251916 CAGGCTGGTCTCAAATTTCCTGG + Intergenic
1039835171 8:41250120-41250142 CTGCCTGGCCTCCCACAGCCGGG + Intergenic
1040433935 8:47371312-47371334 CAACCTGGGCTCAGACAGCCAGG + Intronic
1040925090 8:52672530-52672552 TAGCCTGGTCTCAGATTGCCGGG - Intronic
1041067451 8:54095793-54095815 CAGGCTGGTCTCAAACAGCTGGG + Intronic
1041308567 8:56489781-56489803 AAGGCTGGCCTCAAACTGCCAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042228956 8:66537844-66537866 CAGGCTGGTCTCAAATTCCCGGG + Intergenic
1043456288 8:80415635-80415657 CAGGCTGGCCTCAAATTCCTGGG + Intergenic
1043549088 8:81348715-81348737 CAGCCTTGTCTCACATCGCCAGG + Intergenic
1043969117 8:86510911-86510933 CAGGCTGGTCTCAAACATCCTGG - Intronic
1044334029 8:90955326-90955348 CAATCTTGCCTCAAATAGTCAGG + Intronic
1044382965 8:91555452-91555474 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1044823580 8:96176043-96176065 CAGGCTGGTCTCAAACACCCGGG + Intergenic
1046828345 8:118716643-118716665 AAGCCGGTCCTCAAAAAGCCTGG - Intergenic
1047101131 8:121676862-121676884 CAGTCTGGTCTCAAATTCCCAGG + Intergenic
1047867727 8:129045846-129045868 CAGGCTGGCCTCAAACCCCCAGG - Intergenic
1049854009 8:144850313-144850335 CAGCCTGGCCCCATGTAGCCAGG - Exonic
1051084477 9:13332162-13332184 CAGGCTGGCCTCAAAACTCCTGG - Intergenic
1051235316 9:14993162-14993184 AAGCCGGGCCTCAAAGCGCCCGG + Intergenic
1051659810 9:19415374-19415396 CAGCCTCTCCTCAAGTAGCTGGG - Intronic
1051672289 9:19523104-19523126 CAGTCTGGTCTCAAATGTCCAGG - Intronic
1051714984 9:19973125-19973147 CAGGCTGGCCTCAAACACCTGGG - Intergenic
1052287316 9:26800946-26800968 CAGCTTGGCCTAAAGCAGCCAGG - Intergenic
1052901210 9:33796273-33796295 AATCCAGGGCTCAAATAGCCAGG + Intronic
1055018453 9:71644210-71644232 CAGCCTGGTCTCAAACTCCCAGG - Intergenic
1055613169 9:78043951-78043973 CAGGGTGGCCTCAAACACCCAGG + Intergenic
1056887477 9:90457244-90457266 CAGCAGGGCCTCAAACAGCATGG - Intergenic
1057446952 9:95123089-95123111 CAGGCTGGTCTCAAACAGCTGGG - Intronic
1057885377 9:98825762-98825784 CAGGCTGGTCTCAAATTCCCGGG - Intronic
1058468954 9:105257439-105257461 CAGGCTGGCCTCAAATTCCTGGG + Intronic
1058574429 9:106384976-106384998 CAGCCTACCCTCCAAGAGCCTGG + Intergenic
1058728386 9:107825725-107825747 CAGGCTGGTCTCAAATTCCCGGG - Intergenic
1059485140 9:114621125-114621147 CAGCCTGGTCTCAAATTCCTGGG - Intronic
1059533783 9:115062394-115062416 CAGCCTGGTCTCAAACTCCCGGG - Intronic
1060955303 9:127634563-127634585 CAGGCTGGCCTCAAATACCTGGG - Intronic
1061092394 9:128434001-128434023 CTGCCTGGCCTCAGTTGGCCTGG - Intronic
1061149909 9:128822781-128822803 CAGCCTGGCCTCATCCAGGCGGG - Exonic
1061359510 9:130132093-130132115 CAGGCTGGTCTCAAATTGCTGGG + Intronic
1061677339 9:132225478-132225500 CAGTCTGGCCTCAAATTCCTGGG + Intronic
1061861650 9:133471526-133471548 CATCCTGGACTTAAAAAGCCAGG - Exonic
1062353171 9:136148950-136148972 CAGCCTGGCCTCAGCTGCCCTGG - Intergenic
1185558367 X:1039164-1039186 CAGCCTGGCCTCAAACTTCTAGG - Intergenic
1185936669 X:4264225-4264247 CAGACTGGGCTCAAAAATCCAGG - Intergenic
1186084945 X:5977430-5977452 CAGACTGGCCTCAAATTCCCAGG + Intronic
1186532744 X:10313833-10313855 CAGGCTGGCCTCAAACTCCCGGG - Intergenic
1186857608 X:13640761-13640783 CAGCCTAGCCTGAGAAAGCCTGG + Intergenic
1187149687 X:16670011-16670033 CAGCCTGGCCTCAAACTCCTGGG - Intronic
1187328122 X:18310658-18310680 CAGGCTGGACTCAAATCTCCTGG + Intronic
1187797404 X:23019338-23019360 CAGGCTGGCCTCAAACTGGCTGG + Intergenic
1188222679 X:27559688-27559710 CAGTCTGACCTCAACTAGTCAGG + Intergenic
1189342399 X:40214141-40214163 CAGGCTGGCCTCAAACTCCCGGG + Intergenic
1190954190 X:55175495-55175517 CAGGCTGGCCTCAAACTCCCAGG - Intronic
1192849714 X:74942276-74942298 CACCCTTGCCTCTCATAGCCAGG - Intergenic
1193479558 X:82010632-82010654 CAACCTGGCCACTAATAGTCAGG - Intergenic
1193900791 X:87174620-87174642 CAGGCTGGCCTCAAATGCCTGGG - Intergenic
1195007844 X:100704175-100704197 CAGCCTGGACTCAAATTCCTGGG + Intronic
1195373538 X:104203113-104203135 CAGCCTAGCCTCAAATGCCTGGG + Intergenic
1196016793 X:110948183-110948205 CAGCATGGCCTTTAATATCCTGG + Intronic
1197127211 X:122960626-122960648 CAGGCTGGCCTCAAATTCCTGGG - Intergenic
1197216717 X:123873382-123873404 CAGGCTGGCCTCAAACACCTGGG + Intronic
1199769588 X:150966052-150966074 CAGTTTGGCCTCAAATCGCCTGG - Intergenic
1200225579 X:154415390-154415412 CAGGCTGGCCTCAAATTCCTGGG - Intronic
1200838861 Y:7759819-7759841 CAGGCTGGTCTCAAATTCCCAGG + Intergenic
1200953152 Y:8919801-8919823 CAGGCTGGTCTCAAATTCCCAGG + Intergenic