ID: 1124184074

View in Genome Browser
Species Human (GRCh38)
Location 15:27506564-27506586
Sequence ATTCTTTTCTGGGGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 7, 2: 42, 3: 191, 4: 587}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124184074_1124184081 -3 Left 1124184074 15:27506564-27506586 CCCTAGAGCCCCCAGAAAAGAAT 0: 1
1: 7
2: 42
3: 191
4: 587
Right 1124184081 15:27506584-27506606 AATGCAGCCCTGCTGGTATATGG 0: 1
1: 0
2: 0
3: 6
4: 118
1124184074_1124184080 -10 Left 1124184074 15:27506564-27506586 CCCTAGAGCCCCCAGAAAAGAAT 0: 1
1: 7
2: 42
3: 191
4: 587
Right 1124184080 15:27506577-27506599 AGAAAAGAATGCAGCCCTGCTGG 0: 1
1: 4
2: 17
3: 39
4: 387
1124184074_1124184084 22 Left 1124184074 15:27506564-27506586 CCCTAGAGCCCCCAGAAAAGAAT 0: 1
1: 7
2: 42
3: 191
4: 587
Right 1124184084 15:27506609-27506631 TTCACCCTTTTGTGACCCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124184074 Original CRISPR ATTCTTTTCTGGGGGCTCTA GGG (reversed) Intronic
900247213 1:1642321-1642343 AGTCTTTTCTGGGGGATGTTTGG - Intronic
900258437 1:1709453-1709475 AGTCTTTTCTGGGGGATGTTTGG - Intronic
900566088 1:3332483-3332505 ATTTTGTTTTGGGGGCTTTATGG + Intronic
900910267 1:5592419-5592441 GCTCTTTTCTGGAGGCTCTAAGG - Intergenic
901751975 1:11415839-11415861 ACACCTTTCTGGAGGCTCTAGGG + Intergenic
902116551 1:14126002-14126024 ATTCCTTACTAGGGCCTCTAAGG - Intergenic
902540963 1:17154419-17154441 ATTCCTTTCAGGAGGCTCTGGGG + Intergenic
903331339 1:22598542-22598564 TTTCTTTGCTGGGTGCTCTTAGG + Intronic
903688716 1:25153763-25153785 ATGCCTTTCTGTGGGCCCTAGGG + Intergenic
903757340 1:25671848-25671870 ATTCCTTTCTGGAGGTTCTAGGG + Intronic
904746681 1:32715785-32715807 ATTCTGTTCTTGCGGCTCCAAGG - Intergenic
904955388 1:34279362-34279384 ACTCTTTTCAGGGGTCTTTATGG + Intergenic
904966166 1:34375554-34375576 ATTTTTTTGTGGTTGCTCTATGG + Intergenic
905316765 1:37086961-37086983 ATTCTCATCTGGAGGCTCGAAGG - Intergenic
905531195 1:38680170-38680192 ATTTCTTTCTGGAGGCTCCAGGG - Intergenic
905909952 1:41646894-41646916 ATTGCTTTCTGGAGGCTCCAGGG + Intronic
906908536 1:49921640-49921662 GTGGTTTTCTGGGGGCTCTCTGG - Intronic
907380028 1:54079470-54079492 ATTCCTTTCTGGAGGCTCTAGGG + Intronic
908107060 1:60855880-60855902 TTTCTTGACTGGGTGCTCTAAGG + Intergenic
908117510 1:60954347-60954369 ATTCTTCCCTGGGAACTCTATGG + Intronic
908295670 1:62710324-62710346 ATTCTTTTTTGGGGGTTGCAGGG + Intergenic
908450037 1:64244995-64245017 ATTCTATTTTGGGAGTTCTAAGG + Intronic
908633756 1:66139226-66139248 CTTCCTTTCTGGAGGTTCTAAGG + Intronic
908850243 1:68368555-68368577 GCTCTTATCTGGGGGCTCTAGGG + Intergenic
909102712 1:71369897-71369919 CTTCCTTTCTGGGGGCTCTGGGG + Intergenic
909107073 1:71424847-71424869 GTTCTTATCTGTAGGCTCTAGGG - Intronic
909868992 1:80714787-80714809 ATTCCTTTCTGGAGGTTCTGTGG + Intergenic
910030680 1:82718276-82718298 ATTCCTCTCTGGAGGCTCTCTGG - Intergenic
910053086 1:82999249-82999271 ATTTCTTTCTGGAGGCTCTAAGG + Intergenic
910157820 1:84240294-84240316 ATTTCTTTCTGTAGGCTCTAGGG + Intergenic
910766797 1:90790162-90790184 ATTCCTTTCTGGAGACTCTAGGG - Intergenic
910802444 1:91159659-91159681 ATTCCTTTCTGGAGGCTTCAGGG - Intergenic
911249529 1:95559120-95559142 AATCCTTTCTGGGGGTTTTATGG + Intergenic
912069074 1:105785309-105785331 GTTCCTTTCTGGAGGCTCTAGGG - Intergenic
913192135 1:116421812-116421834 ACTTTTTTCTGGAGGCTCTAGGG - Intergenic
913570827 1:120118684-120118706 GTTCTTTTCTGGGGACTGTTTGG - Intergenic
914291632 1:146279660-146279682 GTTCTTTTCTGGGGACTGTTTGG - Intergenic
914394035 1:147247746-147247768 ATTCCTTTCTGGAGGCTCTAGGG + Intronic
914552676 1:148730443-148730465 GTTCTTTTCTGGGGACTGTTTGG - Intergenic
914931564 1:151938829-151938851 GTTCCTTTCTGGAGGCTCCATGG + Intergenic
914934003 1:151961996-151962018 ATTCCCCTCTGGAGGCTCTAGGG + Intergenic
916949316 1:169762827-169762849 GTTCCTTTCTGGAGGTTCTAGGG - Intronic
917637845 1:176954435-176954457 AATTCTTTCTGGAGGCTCTAGGG - Intronic
917781856 1:178405636-178405658 ATTCCTTTCTGAAGGCTCTAGGG - Intronic
918110059 1:181447724-181447746 GTTCCTTTCTGGAGGCTCTCAGG + Intronic
918153833 1:181823807-181823829 ATTCTTTTCTGGAAGCCCTAGGG - Intergenic
918270862 1:182897840-182897862 ATTCCTTTTTGGATGCTCTAGGG - Intergenic
918405128 1:184204564-184204586 GTTCCTTTCTGGAGTCTCTAGGG - Intergenic
919572583 1:199267555-199267577 TTTCTTAACTGGAGGCTCTAGGG - Intergenic
919723107 1:200862028-200862050 CTTATTGTGTGGGGGCTCTAGGG - Intergenic
920083057 1:203390580-203390602 ATTCCTTTCTGGAGGCTGTAGGG - Intergenic
920089950 1:203445353-203445375 AGTTTCTTCTGGAGGCTCTAGGG - Intergenic
920235419 1:204500143-204500165 GTTCCTTCCTGGAGGCTCTAGGG - Intergenic
920447846 1:206033400-206033422 ATTCCTTTCTGGAGGCTGGAGGG + Intergenic
921668951 1:217905515-217905537 ATTCCTTTCTGGAGGCTGGAGGG - Intergenic
921907171 1:220507376-220507398 ATGCTTTTATGTGGGATCTAGGG - Intergenic
922403097 1:225281195-225281217 ATTACTTTCTGGAGGCTCTAAGG + Intronic
922613702 1:226948186-226948208 GTTCATTTCTGGAGGCTCAAGGG + Intronic
922654114 1:227365918-227365940 GTTCCTTTCTGGAGGCTCAAGGG + Intergenic
923032959 1:230264285-230264307 ATTCTTGACTGTGGGCACTAAGG + Intronic
923033177 1:230265769-230265791 ATTCTTAACTGTGGGCACTAAGG + Intronic
923038152 1:230300096-230300118 AGTCCTTTCTGGAGGCTCTGAGG + Intergenic
924252784 1:242152126-242152148 ACTCATTTCTGGAGGCTCTAGGG + Intronic
1063275492 10:4562782-4562804 CTTCTTTTCTCCGGGCTCTTTGG + Intergenic
1063758800 10:9047838-9047860 ATTCCTGTGTGGAGGCTCTAGGG + Intergenic
1063811859 10:9720313-9720335 ATTCCTTTCTGGAGACTCTGGGG - Intergenic
1065117632 10:22497908-22497930 ACCCATTTCTGGGGGGTCTAGGG - Intergenic
1065313521 10:24439617-24439639 ATTCTTTTCTGGAGGCCCTAGGG + Intronic
1065434180 10:25690376-25690398 CTTCCTTTCTGGAGACTCTAGGG + Intergenic
1065859625 10:29861118-29861140 ATTCCTTTCTGGAGGTTCTAGGG - Intergenic
1066146642 10:32565452-32565474 ATTCTTATCTTGGGTATCTATGG + Intronic
1068424923 10:56847437-56847459 ATTATATTCTCGTGGCTCTAGGG - Intergenic
1068451441 10:57194660-57194682 ATTCTTTTCTGGAAACTCTGGGG - Intergenic
1068633370 10:59321393-59321415 ATTCCTTTCTAGAGGCTCTAGGG - Intronic
1068765530 10:60759153-60759175 ATTCCTTTCTGCAGACTCTAGGG + Intergenic
1068783582 10:60945666-60945688 ACTATTTTCTGGGGTCTCTGGGG - Intronic
1068941948 10:62689181-62689203 GATCTTATCTGGAGGCTCTAGGG - Intergenic
1069321481 10:67176899-67176921 ATTATTTTCTGGAGTCTCTAGGG - Intronic
1069502409 10:68965870-68965892 TTTCTTTCCTTGGGGCTCAAGGG + Intronic
1070207314 10:74276621-74276643 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
1070470483 10:76774430-76774452 AATCTTTTCTGGAGGCTCTAGGG - Intergenic
1070472434 10:76796088-76796110 GTTTGTTTCTGGAGGCTCTAGGG - Intergenic
1070509806 10:77150475-77150497 GTTCTTTTCTGGGAGCTGTTAGG + Intronic
1071352896 10:84764266-84764288 TTTTTGTTCTGTGGGCTCTAGGG - Intergenic
1071909631 10:90216837-90216859 GTTCCTTTCTGGAGGCTCTTGGG - Intergenic
1071927588 10:90428497-90428519 ATTTCCTTCTGGAGGCTCTAGGG + Intergenic
1072863555 10:99032720-99032742 ATTCCATTCTGGAAGCTCTAAGG + Intronic
1072911902 10:99509584-99509606 AAGCTTTTCTGGATGCTCTAGGG - Intergenic
1073612584 10:104959050-104959072 TTTCCTTTCTGGAGGCTCTAGGG - Intronic
1074570704 10:114621636-114621658 AATCTTCTATGGGGGTTCTAAGG - Intronic
1075039156 10:119093975-119093997 ATTCCTCTCTGGAGGCTCTGGGG - Intergenic
1076292455 10:129357213-129357235 GTTCCTTTCTGGAGACTCTAAGG - Intergenic
1076738409 10:132468740-132468762 AGTCTTTTCTGGGGCCTCTTGGG + Intergenic
1077944544 11:6880852-6880874 ATTATTTTCTGAAGGCTCTAGGG - Intergenic
1078010696 11:7570902-7570924 AGTTTGTTCTGGGGGCTATATGG + Intronic
1078565361 11:12409685-12409707 ATTCCGTTCTGAGGGCTCTAGGG - Intronic
1078801656 11:14650852-14650874 AATACTTTCTGGGAGCTCTAGGG - Intronic
1078859335 11:15232881-15232903 CATTTATTCTGGGGGCTCTAGGG - Intronic
1078919268 11:15813180-15813202 ATTCCTTTCTGGAGACTCTGGGG + Intergenic
1079085150 11:17439902-17439924 CTTGTCTTCTGGGGGCTCTGGGG + Intronic
1079087020 11:17453766-17453788 ATTCTCTCCTGAGAGCTCTACGG - Intronic
1079150832 11:17897301-17897323 ATTCTTACCTGGAGACTCTAGGG - Intronic
1079986586 11:27206540-27206562 ATTCCTTTCTGGAGGTTCTGTGG - Intergenic
1080291058 11:30671784-30671806 ATTCCTTTCTGGAGGTTCTAGGG - Intergenic
1080769890 11:35330818-35330840 ATTCTTTTCTGGAGGCTCGGAGG - Intronic
1080898537 11:36466319-36466341 ATTCCTTTCTGGAAGCTTTAAGG + Intergenic
1080940521 11:36912944-36912966 GCTCCTTTCTGGAGGCTCTAGGG + Intergenic
1081188312 11:40072472-40072494 TTTGCTTTCTGGAGGCTCTAAGG - Intergenic
1081258022 11:40921496-40921518 ATTCTCTTCTTGGTGATCTAAGG - Intronic
1081375401 11:42352317-42352339 ATTCCTTTCTGGGGGCTCTAAGG - Intergenic
1082664893 11:55963492-55963514 GTTCTTGTCTGGAGGCTCTGGGG - Intergenic
1082916527 11:58444181-58444203 TTCCTTTTCTGGGGGCTCCACGG - Intergenic
1083987935 11:66229063-66229085 ATTCTTTAGTGGGGCCTCTGAGG - Intronic
1085275390 11:75295339-75295361 ATTCATTTCTGGAGGCTCAAGGG + Intronic
1086594429 11:88554137-88554159 ATTCCTTTCTGGAGGCTGTAGGG + Intronic
1087110377 11:94460176-94460198 CTTCCTTTTTGGAGGCTCTAAGG - Intronic
1088037235 11:105332812-105332834 ATTCTTTTCTAGAGACTCTAGGG + Intergenic
1088247856 11:107836674-107836696 ATTCTTTTCTGGAGGTTTTAGGG - Intronic
1088982650 11:114877412-114877434 ATTCTTCTCTGGGGACTGGAGGG - Intergenic
1089420374 11:118328359-118328381 ATTCCTTTTTGGAGGCTTTAGGG - Intergenic
1089949511 11:122512159-122512181 CTTTTTTTCTGGGCTCTCTAGGG + Intergenic
1090741631 11:129667243-129667265 AATGTTTCCTGGGGCCTCTAAGG - Intergenic
1091941422 12:4486987-4487009 TTTCTTTTCTAGAGGCTCTAAGG - Intergenic
1092486900 12:8909829-8909851 GTTCTTTTCTGGAAGCTCTGGGG + Intergenic
1092587530 12:9914750-9914772 ATTTTTTTCTAGGGGTTTTATGG - Intronic
1092845343 12:12579805-12579827 ATTCTTTTCTGGAGGCTCTAGGG + Intergenic
1092863980 12:12743924-12743946 ATTTGTTTCTGGAGGCTCTGGGG - Intronic
1092916415 12:13193473-13193495 TTTCTTTTCTGTGGGCTGTAGGG + Intergenic
1092940210 12:13401106-13401128 ATTTCTTCCTGGAGGCTCTAGGG - Intergenic
1093280260 12:17185619-17185641 GTTCCTATCTGGAGGCTCTAAGG - Intergenic
1093335597 12:17901165-17901187 TTTTTTTTCTGGGGTTTCTATGG + Intergenic
1093364648 12:18278238-18278260 ATTCCTTTCTGGAGGCTCCAAGG + Intronic
1093847082 12:23985835-23985857 ATTCTTTTCTGGAAGTTCTTGGG + Intergenic
1094750742 12:33404306-33404328 ATTCTTTTCTGGAGGCTCTTGGG - Intronic
1095482150 12:42647884-42647906 ATTCCTTTCTGGAGGCATTAGGG + Intergenic
1095536466 12:43254183-43254205 ATTTCTTTCTGGAGACTCTAAGG - Intergenic
1095672772 12:44879203-44879225 ATTCTTTTCTGGAGGCTCTAAGG - Intronic
1096872425 12:54601732-54601754 GTTCCTTTCTGGAGTCTCTAGGG - Intergenic
1097009901 12:55945550-55945572 GTTCTTTTCTAGAGGCTCTAGGG + Intronic
1097166635 12:57089605-57089627 ATTCTTTGCAGGGGGCTCTTAGG - Intronic
1097309381 12:58101970-58101992 TTTCCTTTCTGGAGGCTCTCAGG + Intergenic
1097527714 12:60759222-60759244 ATTCCTTTCTGGAGGCTCTTGGG + Intergenic
1097601430 12:61697595-61697617 TTTCTCTTCTGGATGCTCTAGGG - Intergenic
1097785866 12:63758267-63758289 ACTCTTATCTGGAGGCTCTGGGG + Intergenic
1098132572 12:67365797-67365819 ATTGCTTTCTGGGGACTCTAAGG + Intergenic
1098571874 12:71997070-71997092 GTTCCTTTATGGGGGCTCTGGGG + Intronic
1098998971 12:77154522-77154544 ATTCTTTACTGGGGGTACTGAGG - Intergenic
1099391643 12:82087824-82087846 TTTATTTTCTGGAGGCTCTGGGG - Intergenic
1099443495 12:82726229-82726251 ATTCCTATCTGAGGGGTCTAGGG - Intronic
1099761679 12:86930096-86930118 ATTTTTTTCTGGGATTTCTAAGG + Intergenic
1099842032 12:87977846-87977868 GTTCTTTTCTGAGGGCTGTGAGG - Intergenic
1099980705 12:89598690-89598712 GTTCCATTCAGGGGGCTCTAAGG - Intronic
1100043620 12:90351459-90351481 ATTCCTTTTTGGAGGCTTTAGGG - Intergenic
1100379658 12:94049733-94049755 ATTCTCATCTGGAGGCTCAATGG + Intergenic
1100648409 12:96557094-96557116 ATTCCTTTCTGGAGGCTCTGGGG + Intronic
1100924193 12:99525011-99525033 TTTCCTTTCTGGAGGCTCTAGGG - Intronic
1100966650 12:100020719-100020741 ACTCCTTTCTGGAGGCCCTAGGG - Intergenic
1101757523 12:107632735-107632757 GTTCCTTTCTGGGGGCTTTGGGG + Intronic
1102386742 12:112516396-112516418 CTTTCCTTCTGGGGGCTCTAGGG + Intergenic
1102447796 12:113016969-113016991 CTTCCTTTCTGGAGGCTCTGGGG - Intergenic
1102490252 12:113286260-113286282 ATTCTTTTCTGTGGGCATTGTGG - Intronic
1102542282 12:113630094-113630116 ATTCCTTCCTGGAGGCTCTAGGG + Intergenic
1102596247 12:113994663-113994685 AGTCTCTTCTGAGGGCTCTGTGG - Intergenic
1102617507 12:114167387-114167409 ATTCTCATCTGAAGGCTCTAGGG - Intergenic
1104457784 12:128929560-128929582 ATGCTTTTTTGGGGTCCCTAGGG - Intronic
1104688513 12:130806580-130806602 ACTCTTTTCAGGGGTGTCTATGG - Intronic
1104844954 12:131841973-131841995 ATTCTGATCTAGGGGCTCTGGGG - Intronic
1106062437 13:26307496-26307518 ATTCTTCTCTGGAGTCCCTAGGG - Intronic
1106258152 13:28040340-28040362 CTTTTTTTCTGGTGCCTCTAGGG - Intronic
1106399280 13:29412869-29412891 ATTCATTTCTGGAGGCTCTGGGG + Intronic
1106454742 13:29917218-29917240 TTCCTTTTTGGGGGGCTCTAAGG - Intergenic
1106670638 13:31900970-31900992 ATTCCTTTCTGGAGACTCTCGGG + Intergenic
1106844194 13:33720107-33720129 GTGTTTTTCTGGAGGCTCTAGGG + Intergenic
1107101077 13:36593225-36593247 ACTCTTTTCTGTGGGCCCCATGG + Intergenic
1107543360 13:41413941-41413963 GTCCTTTTCTGGAGGCTCTAGGG + Intergenic
1107815498 13:44240884-44240906 GTTCCTTTCTGGGGGCCCCAGGG - Intergenic
1108033089 13:46257291-46257313 ATTGCTATCTGGAGGCTCTAGGG - Intronic
1109562536 13:64071418-64071440 ATTTTTTTCTGGAGGTTGTAGGG + Intergenic
1109932747 13:69236579-69236601 ATTCCTTTCTGGAGGCTTTTGGG + Intergenic
1110614580 13:77527188-77527210 ATTTCCTTCTGGAGGCTCTAAGG - Intergenic
1111732839 13:92098788-92098810 ATTGTTTTGTGGCGGCTCTAAGG - Intronic
1111882715 13:93978214-93978236 ATTCCTCTCTGGAGGCTTTAGGG - Intronic
1112781286 13:102903795-102903817 ATTTTATTCTGGGATCTCTAGGG - Intergenic
1112841561 13:103585395-103585417 ATTCTTTCCTGGTGGCTCTAGGG - Intergenic
1113057484 13:106285041-106285063 ATTCCTTTCTGGAGGACCTAGGG + Intergenic
1113242032 13:108348730-108348752 ATTCTCTTCTGGGTGCTGTCAGG + Intergenic
1113472431 13:110556414-110556436 ATTCCTTTCTGGAGGCTGAAGGG - Intronic
1114202470 14:20535436-20535458 ATTCTTATCTGGAGGCTGTGGGG + Intergenic
1114575129 14:23706195-23706217 ATTCTTTCGTGGGGGCCCTTTGG + Intergenic
1114835582 14:26199460-26199482 TTTCTTTTCTGGAGGCACTGGGG - Intergenic
1116704213 14:48276073-48276095 ATTCCTTCCTGGAAGCTCTAGGG + Intergenic
1116802312 14:49455639-49455661 ATTCCTTTTTGGGGGTTCTAGGG - Intergenic
1117254880 14:53967704-53967726 CATCTTTTCTGGAGGCTCTAGGG + Intergenic
1118519158 14:66561855-66561877 ATTTCTTTCTGGGGGCTCGCAGG + Intronic
1119076463 14:71645034-71645056 TGTCCTTTCCGGGGGCTCTAAGG + Intronic
1119141530 14:72271779-72271801 ATTCCTTTCTGGAGGCTCTAGGG + Intronic
1119149251 14:72343231-72343253 GTTTCTTTCTGGAGGCTCTAAGG + Intronic
1119676896 14:76562570-76562592 CTTCTCTCCTGGGGCCTCTATGG - Intergenic
1119867762 14:77988361-77988383 ATTCCTTTCTGGAGGCTCCAGGG - Intergenic
1120007334 14:79374268-79374290 AGTCTTTTCTGGGGTCCCTTTGG - Intronic
1120125361 14:80735740-80735762 CTTCCTTTCTGGAGGCTCTGGGG + Intronic
1120139812 14:80916174-80916196 GTTCCTCTCTGGAGGCTCTAAGG - Intronic
1120186032 14:81394792-81394814 GTTCCTTTCTGGAAGCTCTAGGG - Intronic
1120212177 14:81644070-81644092 ATTCCTTTCTGGAGGAACTAAGG - Intergenic
1120357197 14:83449803-83449825 ATTCCTTTCTGGAGGCTCTACGG - Intergenic
1120688785 14:87569191-87569213 TTTCCCTTCTGGAGGCTCTAGGG - Intergenic
1120690923 14:87591495-87591517 ATTCTTTTTTGAAGGTTCTAGGG - Intergenic
1121182519 14:91940164-91940186 GTGCTCTTCTGGAGGCTCTAAGG - Intronic
1124184074 15:27506564-27506586 ATTCTTTTCTGGGGGCTCTAGGG - Intronic
1124206990 15:27729535-27729557 ATTTCTTTCTGGAGGCTGTAAGG + Intergenic
1124229259 15:27928541-27928563 GTTCCTGTCTGGAGGCTCTAGGG + Intronic
1125425259 15:39542406-39542428 ATTCCTTTCTGGAGGTTCTTGGG + Intergenic
1126051837 15:44693320-44693342 ACTCCTTTCTGGAGACTCTATGG + Intronic
1126739144 15:51760296-51760318 ATTCCTTTCTGAAGGCCCTAGGG + Intronic
1126819391 15:52487087-52487109 ATTATTTCCTGGGGGATGTATGG + Intronic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1128012376 15:64310159-64310181 ATTCTTATCTGGGTGCTTTCTGG + Intronic
1128625712 15:69200864-69200886 GTTCCTTTCTGGAGGCTGTAGGG + Intronic
1130219463 15:82006974-82006996 GTTCCTTTCTGGAGGCTCTAGGG - Intergenic
1130620860 15:85460849-85460871 ATTCCTTTCAGGAGGCTCTATGG - Intronic
1130893853 15:88155389-88155411 ATTTCTTTCTGGAGGCTCTAAGG - Intronic
1130915022 15:88298296-88298318 GTTCCTTTCTGGAGGCTCCATGG - Intergenic
1131737206 15:95346517-95346539 ATTCCTTTCTGGAGGCTCTAAGG - Intergenic
1132049764 15:98597417-98597439 ATTCTTTCCTGGGGTCCCTCTGG - Intergenic
1133532443 16:6667501-6667523 AATATTTTCTGGGGTCACTATGG + Intronic
1133585764 16:7193340-7193362 GTTCTTTTCTGGAGGTTCTAGGG - Intronic
1133630949 16:7621045-7621067 ATTCTTATCTAGGGGGTCTGGGG - Intronic
1133902333 16:9988850-9988872 GTTCTGTTCTGGGGGATCTTGGG - Intronic
1135100338 16:19599673-19599695 ATTCTTTTCCAGTAGCTCTAAGG + Intronic
1135121532 16:19770462-19770484 ATTCTTTTCTGGAGTTTCTAGGG + Intronic
1135545390 16:23362525-23362547 AGTCTTTTCTGGAGGCTCACTGG + Intronic
1135925073 16:26686790-26686812 GTTCCTTTCTGGAGGCTCTGAGG + Intergenic
1136489240 16:30594930-30594952 TTCCTTTTCTAGAGGCTCTAGGG - Intergenic
1137330492 16:47490545-47490567 CCTCTTTTCTGGAGGCTCCAGGG + Intronic
1137583296 16:49647694-49647716 ATTCCTTTCTGGATGCTCTTAGG - Intronic
1137952395 16:52796108-52796130 ATTCCTTTCTGGAGCTTCTAGGG - Intergenic
1138718364 16:59049689-59049711 ATTTTCTTCTGAGTGCTCTAGGG + Intergenic
1138829911 16:60362493-60362515 ATTCTCTTCTGGAGGTTCTGGGG - Intergenic
1138876789 16:60961205-60961227 ATTCCTTTCCGGAGGCTTTAGGG + Intergenic
1139017180 16:62704253-62704275 ATTCTTTTCTGGAAGCTCCAAGG - Intergenic
1139287277 16:65826879-65826901 GTTTTTTTCTGGAGGCTGTAAGG + Intergenic
1140023564 16:71262572-71262594 GTTCCTTTCTGGAGGTTCTAGGG - Intergenic
1140642342 16:76990891-76990913 ATTCCTTTCTGGAGGCTGCAAGG + Intergenic
1140772336 16:78216493-78216515 ATTTCTTTCTGGAGGCTCTGGGG + Intronic
1141035877 16:80625204-80625226 ATTCCTTTGTGGAGGCGCTAAGG + Intronic
1141235671 16:82213651-82213673 CTCCCTTTCTGGGGGCACTAGGG - Intergenic
1141304349 16:82847342-82847364 ATTCTTTTCTGGAGTCTCATGGG + Intronic
1141480174 16:84301156-84301178 GTTCCTTTGTGGAGGCTCTAAGG - Intronic
1141747540 16:85935864-85935886 GTTCCTTTCTGGAGGCTTTAGGG - Intergenic
1143365266 17:6404172-6404194 ATTCCTTTCTGGAAGCTCTAGGG + Intronic
1144153671 17:12476111-12476133 GTTCCTTTCTGGAGGCCCTAGGG - Intergenic
1144171560 17:12664288-12664310 GTTAGTTTCTGGAGGCTCTAGGG - Intergenic
1146015742 17:29232119-29232141 TTTTTTTTCTGGAGGCTCTAGGG - Intergenic
1147130241 17:38403395-38403417 ATGCTTTCCTGGGGGCCCTGGGG - Exonic
1147501421 17:40967818-40967840 AATCCTTTATGGAGGCTCTAGGG + Intergenic
1147567518 17:41546856-41546878 CTTTTTTTCTAGGGGCTCTACGG - Intergenic
1147594482 17:41707923-41707945 ATTTCTTTCTGGAGGCTCTAGGG + Intergenic
1149069005 17:52517600-52517622 GTTTCTTTCTGGAGGCTCTAGGG - Intergenic
1149303861 17:55330248-55330270 ATTCTATTTTAGGGGCTATAAGG - Intergenic
1149337307 17:55649253-55649275 ATTCCTTTCTGGAGGCTATAGGG + Intergenic
1149383196 17:56114982-56115004 ATTTATTTCTGGAGGCTTTAGGG - Intronic
1149588222 17:57807951-57807973 GTTCCTTTCTGGAGGCTCTGGGG - Intergenic
1150640902 17:66948732-66948754 GTTCCTTCCTGGGGGCTCTCAGG + Intergenic
1150828285 17:68495835-68495857 ATCCTTTTCTGAAGGCTCTGGGG + Intergenic
1151223271 17:72629732-72629754 GTGCTTTTCTGGAGGCTCCAGGG + Intergenic
1151332537 17:73419187-73419209 ATTCCATTCTGGTGGCTCTCAGG + Exonic
1152172591 17:78762842-78762864 GTTTCTTTCTGGAGGCTCTAGGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153433720 18:5046750-5046772 TTTCTTTTCTGGGGCTTCAATGG - Intergenic
1153592335 18:6686838-6686860 ATTCGTTTCTGGAGACTTTAGGG + Intergenic
1153599731 18:6768577-6768599 ATCCTTTTCTGGGGGGTCAGGGG + Intronic
1153902022 18:9625714-9625736 ATTCCTTTCTGGAAGCCCTAGGG + Intergenic
1153902219 18:9627782-9627804 ATTCTTTTCTGGAAGCCCTAGGG + Intergenic
1154391187 18:13937523-13937545 AATCCTTTCTGAGAGCTCTAGGG + Intergenic
1155745240 18:29348419-29348441 ATTCTTTTCTGGAGGAGCTAAGG + Intergenic
1155878193 18:31112274-31112296 GTTCCTTTCTGAAGGCTCTACGG - Intergenic
1155907236 18:31467021-31467043 AATCTTTTTTGGGTGCACTATGG - Intronic
1156259332 18:35430075-35430097 CTTCCTTTCTGGAGGCTCTAGGG + Intergenic
1156299362 18:35822437-35822459 ATTCCTTTCTGGAGGATCTACGG + Intergenic
1157015423 18:43706694-43706716 GTTCTTTTCTGGAGACTGTAAGG - Intergenic
1157328019 18:46682909-46682931 ATTCCTTTCTGGAGGCTCTCAGG - Intronic
1157521751 18:48350241-48350263 ATTCCTTCCTGGAGGCTCTAGGG + Intronic
1157556617 18:48617060-48617082 ATTCTTAGCTGGAGGCTCTGGGG + Intronic
1158318430 18:56237464-56237486 GTTCCTTTCTGGGGGCCCTTGGG - Intergenic
1158769336 18:60495749-60495771 ATTGTTTTGAGTGGGCTCTAAGG + Intergenic
1158973193 18:62687307-62687329 ATTCATTTCTGGAGGCTGTAGGG + Intergenic
1159124609 18:64208400-64208422 GTTCATTTCTGGAGGCTCTGGGG - Intergenic
1159597516 18:70396393-70396415 GTTCATTTCTGGGGGCTATAGGG + Intergenic
1159871831 18:73767274-73767296 ATTCCTTTCTGGAAGCTTTAGGG + Intergenic
1160058470 18:75508559-75508581 ATTCTTTTCTGCCTGCTCTTGGG - Intergenic
1160118862 18:76109120-76109142 TTTTTTTTCTGGGGGGTGTAGGG - Intergenic
1160829543 19:1097069-1097091 ATTCTTTTTGGGGGGCTGTCAGG + Intergenic
1160905117 19:1448285-1448307 ATTTTTTTCTGGAGGCTGGAAGG - Intronic
1161313161 19:3606284-3606306 ATTCTGTCCGGGGGGCTCTCTGG - Intronic
1161458497 19:4382060-4382082 ACTCTATTCTGGGGGTTCTGGGG + Intronic
1161836567 19:6651328-6651350 ATTTTTTTCTGGGAGTTCTAGGG - Intergenic
1162356538 19:10188947-10188969 ATTCCTTTCTGGGGGCTCCAGGG - Intronic
1163406389 19:17125797-17125819 GTTCTTTTCTGGTTGCTCAAGGG - Intronic
1163420714 19:17212204-17212226 ATCCTCTTCTAGGGGCTCCAGGG - Exonic
1164797781 19:31048320-31048342 ATTCCTCTCTGGAGGCTCTAGGG - Intergenic
1165320540 19:35082380-35082402 ATTTCTTTCTGGAGGCTCTAGGG + Intergenic
1165602384 19:37065637-37065659 ATTATTTTCTAGAGGCTCTAGGG - Intronic
1165606817 19:37112900-37112922 ATTTTTTTGTGGGGGCTCCCTGG + Intronic
1165715406 19:38042153-38042175 GTTCTTTTCTGGGAGTTTTATGG + Intronic
1166071481 19:40390492-40390514 ATTCTGTTCTGAGGGCACTGGGG + Intergenic
1166394980 19:42433048-42433070 ATTTTCTTCTCGGGGCTCTCAGG + Exonic
1167215221 19:48160081-48160103 GTTCATTTCTGGGGGCTCTGGGG - Intronic
1167476201 19:49702719-49702741 ACTCTTTCCTGGGGGTACTAGGG + Intronic
1168547694 19:57267409-57267431 ATTCATTTCTGGGGTTTTTATGG + Intergenic
925335802 2:3098423-3098445 AGACTTGTCTGGGGGCTCAAGGG - Intergenic
925435394 2:3833001-3833023 ATTCCTTTCTGGAGGCTCTGGGG + Intronic
925992320 2:9263457-9263479 AGACTTTTCTGGGAGCTCTGGGG - Intronic
926311064 2:11676706-11676728 ATTCCCTTCTGGGAGCTCTAGGG + Intergenic
926845118 2:17128144-17128166 ATTCCTTTCTGGAGGCTCTAAGG - Intergenic
926993718 2:18710148-18710170 ATTCCTGTCTGGGGGCTCTGAGG + Intergenic
927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG + Intergenic
927710279 2:25321229-25321251 ATTCTTTTCTGGAAACTCTAAGG + Intronic
928350528 2:30548902-30548924 ATTCCTTTCTAAGGGATCTAGGG - Intronic
928487257 2:31745263-31745285 ACTCTTATCTGGAGGCCCTAGGG - Intergenic
928807048 2:35171442-35171464 ATTCTTTTCTGGAGGCTCCAGGG - Intergenic
928970765 2:37026257-37026279 GTTCCTTTCTAGAGGCTCTAGGG - Intronic
929349725 2:40935539-40935561 ATTCTCATCTGGAGGCTCTAGGG - Intergenic
929636999 2:43533549-43533571 ATTCTTTTTTTGTGGCTGTATGG - Intronic
929801305 2:45105551-45105573 GCTCCTTTCTGGAGGCTCTAGGG - Intergenic
930105463 2:47635622-47635644 ATTCTTTTCTTGTGGGTATAGGG + Intergenic
930688616 2:54335790-54335812 AGTTCTTTCTGTGGGCTCTAAGG + Intronic
931049470 2:58394461-58394483 ATTCATTTCTGGAGGCTTTAAGG - Intergenic
931480999 2:62639809-62639831 GTTCCTTTCTGGAGGCTCTAGGG + Intergenic
931500278 2:62857091-62857113 ATTCCTTTCTGGAGCCTATAGGG - Intronic
932831253 2:74992244-74992266 ATTCCTTTCTGGAGGCTTTGCGG - Intergenic
933019251 2:77170440-77170462 GTTACTTTCTGGGGACTCTATGG - Intronic
933211965 2:79580488-79580510 ATTTTTTTCTGGAGGCTCTAGGG - Intronic
933244358 2:79958585-79958607 ATTCCTTTCTGGGTGCTTTAGGG - Intronic
933728828 2:85441906-85441928 ATTTTTTTCAGGGGGCTTTCTGG + Intergenic
933814182 2:86052530-86052552 ATTCTTTTCTGTGTCCTCTCGGG - Intronic
935082379 2:99810787-99810809 GTTCTGTTCTGGAGGCTCTAGGG + Intronic
935313805 2:101811463-101811485 TTTCTTTTATGCTGGCTCTACGG + Intronic
935435872 2:103031558-103031580 GTTCTTTTCTGGAGGATCTGGGG + Intergenic
935734970 2:106099292-106099314 ATACTTGTGTGGGGGCTTTAAGG + Intronic
935933417 2:108154621-108154643 ACCCTTTCCTGTGGGCTCTAAGG + Intergenic
936157379 2:110057261-110057283 CTTCTGGTCTGGAGGCTCTAAGG + Intergenic
936187313 2:110314183-110314205 CTTCTGGTCTGGAGGCTCTAAGG - Intergenic
937157597 2:119731979-119732001 ATTCTTTTCTGGAGATTCTAGGG - Intergenic
937800985 2:126079982-126080004 AGTGGTTTCTAGGGGCTCTAGGG + Intergenic
938121693 2:128638568-128638590 ATTTCTTTCTGGAGGCTCTGGGG - Intergenic
938173409 2:129102947-129102969 ATTCCTTCCTGGAGGCCCTAGGG + Intergenic
938728635 2:134129138-134129160 ATTCCTTTCTGGAGGCTTGAAGG + Intronic
939314788 2:140533934-140533956 ATTCGTTTCTGAGAGCTCTGTGG - Intronic
939439677 2:142230475-142230497 ATCCCTTTCTGGAGGTTCTAGGG + Intergenic
939478315 2:142715339-142715361 ATTCTTTTCTGGAGACTCTAGGG + Intergenic
940546631 2:155096957-155096979 ATTCCTTTCTGTGAGTTCTAGGG - Intergenic
940595829 2:155791472-155791494 CTTCTTTTCCGGAGGCTCAAGGG + Intergenic
941646942 2:168050674-168050696 ATTCCTTTCTGGAGGCCCTTGGG - Intronic
941857837 2:170248543-170248565 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
942359452 2:175156709-175156731 ATTCCTTTTTGGAGTCTCTAGGG - Intronic
942377391 2:175351880-175351902 GTTCTCTTTTGGAGGCTCTAGGG + Intergenic
942438781 2:176009591-176009613 GTTCCTTTCTGGAGGCTCTAAGG - Intergenic
942856038 2:180549750-180549772 ATTCTTTTTAGTGGACTCTAGGG + Intergenic
943069406 2:183123153-183123175 ATTTTCTTCTGGAGGCTCCAGGG - Intronic
943396853 2:187349221-187349243 ATTTTTGTCTGAGGGCACTAGGG + Intronic
943458980 2:188146085-188146107 ATTCTTTCCTGAAGGCCCTAGGG + Intergenic
943976533 2:194485558-194485580 ATTCTTTCCTGAAGGTTCTAGGG - Intergenic
944944605 2:204669018-204669040 ATTCCTTTCTGGAGGCTCCAAGG - Intronic
945061784 2:205915733-205915755 ATTCCTTTCTGGAGGCTCTAGGG + Intergenic
945180203 2:207083933-207083955 TTTTTGTTCTGGAGGCTCTAGGG - Intronic
945217100 2:207445323-207445345 ATTCTTTTTTGGAGGCTCTGGGG + Intergenic
945322039 2:208435713-208435735 ATTCCTCTCTGGAGGCTCTGAGG - Intronic
945838984 2:214866273-214866295 GTTCTCTTCTGGGGGCTTTGGGG - Intergenic
945932283 2:215866977-215866999 GTTCCTTTCTGGAGGCTCCAGGG + Intergenic
946001801 2:216488608-216488630 CAGCTTTTCTGTGGGCTCTATGG + Intergenic
946038535 2:216764281-216764303 GTTCCTTTCTGAAGGCTCTAGGG + Intergenic
946055065 2:216893819-216893841 ATTCCTTTCTGAAGGCTCTAGGG - Intergenic
946086584 2:217179516-217179538 ATTATTTTCTGGAGGCTCTATGG - Intergenic
946317907 2:218930491-218930513 ATGGTTTGCTGGGGGCTCTAGGG - Intergenic
946792738 2:223317960-223317982 GTTTCTTTCTGGAGGCTCTAGGG + Intergenic
946805257 2:223464838-223464860 ATTGCATTCTGGAGGCTCTAGGG + Intergenic
946807020 2:223481164-223481186 ATTCCTTTCTGGAGGCTGTGGGG - Intergenic
946959903 2:224973556-224973578 ATTCCTTTCTCGGGGTGCTAGGG - Intronic
946989569 2:225312902-225312924 TTTTTTTTCTGGAAGCTCTAGGG - Intergenic
947819276 2:233059336-233059358 AGTCATTTCTGAGGGCTCTGCGG - Intergenic
948324495 2:237102583-237102605 ATATTTTTCTGTAGGCTCTAGGG + Intergenic
948972744 2:241441837-241441859 CTTCTTTGCTGGAGGCTCTGAGG + Intronic
1169508289 20:6237015-6237037 ATTATTTTCTGAGATCTCTAGGG + Intergenic
1169524920 20:6413861-6413883 ATTCCTTTCTGGAGGCTCTAAGG - Intergenic
1169582839 20:7044390-7044412 GATCCTTTCTGGAGGCTCTAGGG - Intergenic
1170120848 20:12910133-12910155 ATTCTTTTCTGGAGGCTCTGGGG + Intergenic
1170192266 20:13656045-13656067 GTTCCTTTCTGGAGGCTCTAAGG - Intergenic
1170633827 20:18087941-18087963 ATTCCTCTCTGCAGGCTCTAAGG + Intergenic
1170747432 20:19113056-19113078 ATTCTTGTCTGAAGGCTCTGGGG + Intergenic
1170902285 20:20476585-20476607 TTTTTTTTCTGGAGGCTTTATGG - Intronic
1171067999 20:22037641-22037663 ATACATTTTTGGGGGCTCTGTGG + Intergenic
1171179387 20:23081408-23081430 ATTCTTGTTTGGGGGATCTTGGG - Exonic
1172419835 20:34806724-34806746 ATTTATTTCTGGGTTCTCTATGG + Intronic
1172886643 20:38235637-38235659 ATTCTTTCCTGGAGGCTCTAAGG - Intronic
1172888678 20:38248371-38248393 TTTCTCTTCTGGAGGCTCTAGGG - Intronic
1173129516 20:40376653-40376675 ATTTCTTTCTAGAGGCTCTAGGG - Intergenic
1173409575 20:42797911-42797933 ATTCTTTTCTGGAGGCTCTAGGG - Intronic
1173470940 20:43323148-43323170 CATCTTTTCTGGAAGCTCTAGGG - Intergenic
1173914622 20:46697754-46697776 GTTCCTTTCTGGGGGCTTTAGGG + Intergenic
1174517431 20:51103336-51103358 GTTCCTTCCTGGAGGCTCTAGGG - Intergenic
1175056072 20:56199430-56199452 TTTATTTTTTGGAGGCTCTAGGG - Intergenic
1175153283 20:56952169-56952191 GTTCTTTTCTGGAGGTTCTAGGG - Intergenic
1175157812 20:56984135-56984157 GTTCTGTTTTGGGAGCTCTAAGG - Intergenic
1175274656 20:57759962-57759984 ATTCCTTTCTGGGATCTCCAGGG + Intergenic
1176878192 21:14156478-14156500 ATTCCTTTCTGGAGGCTCAGGGG - Intronic
1176896537 21:14384918-14384940 ATTCCTTTCTGGATGTTCTAGGG + Intergenic
1177383197 21:20372152-20372174 ATCCCTTTCTGGGGTCTCTAGGG - Intergenic
1177453774 21:21307559-21307581 GATCTTTTCTGGAGGCTCTGAGG + Intronic
1177583508 21:23058994-23059016 CTTCTTTTCTGGAGGCTTTAGGG - Intergenic
1178046949 21:28705742-28705764 GTTCCTTTCTGGAGACTCTAAGG + Intergenic
1178792502 21:35713237-35713259 ATTCCTTTCTGGAGGCTTTAGGG + Intronic
1179240104 21:39582283-39582305 TTTCCTTTCTGGACGCTCTAGGG - Intronic
1179252583 21:39684898-39684920 ATTCCTTTCTGGAAGCTCTGGGG + Intergenic
1179268113 21:39823708-39823730 ATTCCTTTTGGGAGGCTCTAGGG - Intergenic
1181911726 22:26243803-26243825 TTTCTTCTCTGGGGGCTTAATGG - Intronic
1182194289 22:28498709-28498731 GGACTTTTCTGGGGGCTCTTTGG - Intronic
1182960328 22:34466228-34466250 ATTTCTTTCTGGAGGCCCTAGGG + Intergenic
1184337919 22:43865766-43865788 ATTCCTTTCTGGAGGATCCAGGG + Intergenic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
949436326 3:4033409-4033431 ATTCCTTTCTGGAGGCTCTAGGG - Intronic
949510193 3:4760647-4760669 GCTCCTTTCTGGAGGCTCTAGGG + Intronic
951018559 3:17756918-17756940 GTTCCTTTCTGGAGGCTCTACGG + Intronic
951018725 3:17758675-17758697 TTTGTTTTCTGTGGGCTTTAGGG - Intronic
951051239 3:18096491-18096513 TTTTCTTTCTGGAGGCTCTAGGG + Intronic
951489225 3:23250075-23250097 ATGCTGTTCTGGGAGCTTTATGG + Intronic
951704558 3:25530470-25530492 ATTCCTTTTTGGAGGCTCTAGGG + Intronic
951994075 3:28707483-28707505 ATTCTTTTCTGGAGGCCCTAGGG + Intergenic
952082157 3:29772177-29772199 GTTTATTTCTGGAGGCTCTAGGG - Intronic
952920877 3:38283018-38283040 CTTCCTTTCTGGAGGCTCTAGGG + Intronic
953285106 3:41598937-41598959 ACTCCTTTCTGGAGGCTCCAGGG + Intronic
953291211 3:41665361-41665383 ATTCTTTGCTTGGGGTTCTTGGG - Intronic
955325605 3:58007713-58007735 ATTCCCTTCTGGAGGCTGTAGGG - Intergenic
955413744 3:58673187-58673209 ATTCCTTTCTGGGGGCTCCTGGG + Intergenic
955463219 3:59208451-59208473 ATTCCTTTCTGGAGACTCTAGGG - Intergenic
955598561 3:60618942-60618964 ATTCCTTTTTGGGGCCTTTAGGG - Intronic
955598606 3:60619705-60619727 ATTATTTTCTAGGAGTTCTATGG - Intronic
955605054 3:60692614-60692636 ATTCCTTTCTGAGGTCTCTAAGG - Intronic
955689308 3:61575235-61575257 ATTGATTTCTGGGGAGTCTAGGG + Intronic
955846663 3:63170595-63170617 GTTCCTTTCTGGAAGCTCTAGGG + Intergenic
956876409 3:73468294-73468316 ATTCTTTTCTGGAGGCTCTAAGG - Intronic
957129018 3:76199419-76199441 ATTCCTTTCTGGAAGCTCTAGGG - Intronic
957144251 3:76402578-76402600 ATTATTTTCTGGAGGGTCTAAGG + Intronic
957250239 3:77763495-77763517 ATTGCTTTCTAGAGGCTCTATGG + Intergenic
957276361 3:78095183-78095205 GTTCCATTCTGGGTGCTCTAGGG - Intergenic
957399505 3:79690486-79690508 GTTCTTATCTGTGGGCTCTAGGG - Intronic
958271492 3:91505196-91505218 ATTCCTTACTGGAGGCTCTGGGG - Intergenic
958553107 3:95641941-95641963 ATTCGTTTCTGGAGGCACTAGGG + Intergenic
958997578 3:100922701-100922723 ATTCCTTTCTGGAGGCTCTGAGG - Intronic
959016841 3:101144297-101144319 ATTCCTTTCTGGAAGCTCTAGGG - Intergenic
959848664 3:111063043-111063065 ATTCCTTTCTGGAGGCTCTAAGG + Intergenic
959965923 3:112354789-112354811 ATTCCTTTCTGGAGGCTCTAGGG + Intronic
960448456 3:117777370-117777392 ATTTTTTTCTGGGTGCTGTGGGG - Intergenic
961027470 3:123571651-123571673 TTTCTTATCTGGAGGCTCCAGGG - Intronic
961990183 3:131181359-131181381 CTTCCTTTCTGGGGGATCCAAGG - Intronic
962446428 3:135469969-135469991 GTTCTTTCCTGGAGGCTGTAGGG - Intergenic
962889989 3:139663106-139663128 GTTCCTTTCTGGAGGCTCTGGGG + Intronic
963204484 3:142618505-142618527 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
963565093 3:146919433-146919455 CTTCCTTTCAGGAGGCTCTAGGG + Intergenic
963625712 3:147670065-147670087 ATTCCTTTCTGGAGGCTCTAAGG + Intergenic
963665488 3:148180620-148180642 GTTCCTTTCTGGAGGTTCTAGGG + Intergenic
964506062 3:157400894-157400916 AATCTTTTGTGTGGGCTCAAGGG + Intronic
964615845 3:158664349-158664371 TTTCCTTTCTGGAGGCTCTATGG + Intronic
964654902 3:159055526-159055548 ATTCCTTTCTAGAGGCTCTACGG + Intronic
965701956 3:171467239-171467261 ATTCCTTTCTGGAGGCTCCCGGG - Intergenic
966323445 3:178727711-178727733 ATTCCTTCCTAGAGGCTCTAAGG - Intronic
966988834 3:185207653-185207675 ACTCTTTTCTGGAGGCTCTAGGG - Intronic
967311728 3:188112546-188112568 ATTCCTTTCTGGAGGCTATAGGG + Intergenic
968024192 3:195425170-195425192 ATTTTTATATGAGGGCTCTAAGG - Intronic
968024413 3:195427231-195427253 ATTCTTTTCTGGAAGGTCTAGGG - Intronic
968926618 4:3551729-3551751 AGTCTGTTCTGTGGGCTCTGTGG + Intergenic
969065318 4:4474785-4474807 GTTCTTTTCTGGAGGCTCTAAGG - Intronic
969143299 4:5099054-5099076 AGTTCTTTCTGGAGGCTCTAGGG + Intronic
969212852 4:5701041-5701063 GCTCTTTTCTGGAGGCTCCAGGG + Intronic
970268874 4:14321363-14321385 ATTCCTTTCTGGAGGTTTTAGGG + Intergenic
970272958 4:14367082-14367104 GTTCATTTCTGGAGGCTCTAGGG + Intergenic
970282665 4:14475157-14475179 ATTCTCTTCTGGAGGCTCTGTGG - Intergenic
970421368 4:15908441-15908463 ATTCCTTTCTGGAGGCTCCAGGG - Intergenic
970486167 4:16526765-16526787 ATTCCTCTCTGGAGGCTCTCAGG - Intronic
970493364 4:16599238-16599260 ATTCCTTTCTGGAGGTTCTCAGG + Intronic
970764409 4:19530359-19530381 ATTCTTTTCTGGGCATTCTAGGG + Intergenic
970782543 4:19755762-19755784 CTTTTTTTCTGGAGGATCTAGGG - Intergenic
970858758 4:20677925-20677947 ATTCCTTTCTGGAGGTTCTCAGG - Intergenic
971574107 4:28252209-28252231 GCTCCTTTCTGGAGGCTCTACGG + Intergenic
972035392 4:34513521-34513543 ATTCTTATCTGGAGGATCTCGGG - Intergenic
972059836 4:34855399-34855421 TTTTTTTTCTGGAGCCTCTATGG - Intergenic
972102458 4:35439176-35439198 ATTTTCTTCTGGGGGCAATAGGG + Intergenic
972170982 4:36344852-36344874 ATTGTTTACTGTAGGCTCTATGG - Intronic
972233290 4:37099937-37099959 ATTCCTTTCTGAAGGCTCTAGGG - Intergenic
972266043 4:37460940-37460962 ATTCTCTTCTGGGGTTTTTATGG + Intronic
972763693 4:42131940-42131962 ACTCTTGACTGGGGGCTCTCTGG + Intronic
973915927 4:55635238-55635260 ATCATTTTCTGGGTTCTCTAAGG - Intronic
974214204 4:58824021-58824043 ATTCCCTTCTGGAGGCTGTAAGG + Intergenic
974781862 4:66562507-66562529 ATTCTTTTCCAGAGGCTCTTGGG + Intergenic
974857215 4:67475471-67475493 ATTTCTTTCTGGAGGCTGTAAGG - Intronic
975075496 4:70202895-70202917 CTTCTCTTCTGGGAGCTCTGGGG - Exonic
975634959 4:76439101-76439123 GTTCCTTGCTGGAGGCTCTAGGG + Intronic
975658161 4:76662173-76662195 GCTCTTATCTGGAGGCTCTAGGG + Intronic
975785195 4:77880215-77880237 TTTATTTTCTGGAGGCTCTAGGG + Intronic
976140681 4:81988495-81988517 ATTCTTTTTTGGAGGATGTAGGG - Intronic
976141750 4:82000288-82000310 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
976325791 4:83770194-83770216 ATTCTTTTCGTGGGGCTGGAGGG + Intergenic
976664234 4:87572895-87572917 ATGCTTTTCTGGAGGATCTGAGG + Intergenic
977382859 4:96298823-96298845 ATTCTTTTCTGGAGATTCTAGGG - Intergenic
977532259 4:98214238-98214260 TGTCTTTTCTGGAGGTTCTAGGG + Intergenic
977535536 4:98252636-98252658 ATTTCTTTCTGGAGGCTTTAGGG - Intergenic
977659818 4:99570883-99570905 ATCCCTTTCTGGAGGCTTTAGGG - Intronic
977677613 4:99765208-99765230 ATTTCTTTCTAGAGGCTCTAGGG + Intergenic
978103789 4:104876348-104876370 GTTCCTTTCTGGAGGCTCTGGGG - Intergenic
978221627 4:106282974-106282996 TTTCTTTTCTTGTGGCTCTGGGG - Intronic
978719408 4:111889787-111889809 ATTCCTTACTGGAGGCTCTGGGG - Intergenic
979079339 4:116313792-116313814 CTTTTCTTCTGGAGGCTCTAGGG - Intergenic
979202413 4:117994136-117994158 ATTCATTTCTGAAGGCTTTAGGG + Intergenic
979208026 4:118064831-118064853 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
979719502 4:123882422-123882444 ATTTTTTTCTGGAGGCTTGATGG - Intergenic
980696054 4:136356884-136356906 AATTTTTTCTGGAGGCTGTATGG - Intergenic
980847891 4:138345674-138345696 ATTCTTTTCTGGAGGTTCTAGGG - Intergenic
980849614 4:138365319-138365341 TATCCTTTCTGGAGGCTCTAGGG + Intergenic
981268596 4:142817585-142817607 ATTCTTTTCTGAGGCCTGTGTGG - Intronic
981421013 4:144550332-144550354 ATTCCTTTCTGGAGGATCTGGGG - Intergenic
981452442 4:144914034-144914056 ATTCCTTTCTGGAGGCTCTAAGG + Intergenic
981561039 4:146048698-146048720 GTTCCCTTCTAGGGGCTCTAAGG + Intergenic
981701387 4:147610707-147610729 ATTCCTTTCTGGAGGTTGTAGGG - Intergenic
982276921 4:153645339-153645361 ATTCCTTTCTGGAGGCTCTAGGG + Intergenic
983572800 4:169228389-169228411 TTTTTTTTCTGGAGGTTCTAGGG + Intronic
983598101 4:169493212-169493234 CTTCTTTTCTGGGTGCTTTTAGG - Intronic
983636703 4:169905230-169905252 TTTATTTTCTGCGGGCTCTAAGG - Intergenic
984052084 4:174876827-174876849 ATTCTTTTCTGGAGTCTGTAGGG + Intronic
984402325 4:179282289-179282311 ATCCCTTCCTGGGGGCTCTCAGG - Intergenic
984862375 4:184252447-184252469 GTTTCTTTCTGGGGGCTCTAGGG - Intergenic
985213043 4:187615747-187615769 GTTCCTTTCTGGAGGCTCTAGGG - Intergenic
985227764 4:187781046-187781068 ATGCTTTTTGGGGGGCTCTCAGG - Intergenic
985294420 4:188419818-188419840 ACTATTTTATGGGAGCTCTATGG - Intergenic
985561875 5:592121-592143 ATAATCTCCTGGGGGCTCTAGGG - Intergenic
985856665 5:2433486-2433508 ATTCTTTTCTGAGTGCTCACGGG + Intergenic
986216858 5:5727307-5727329 GTTCCTTCCTGGAGGCTCTAAGG - Intergenic
986366494 5:7037881-7037903 ATTCCTTTATGGAGGCTCTCAGG + Intergenic
986367888 5:7053195-7053217 ATTTCTTTCTGGAGGCTCTAGGG + Intergenic
986796364 5:11216556-11216578 GTTCCTTTCTGGAGCCTCTAGGG - Intronic
986833292 5:11606242-11606264 ATTTCTTTCTGGAGGTTCTAGGG - Intronic
987505949 5:18772399-18772421 GTTCTTATCTGGGGACTCTAGGG - Intergenic
987960488 5:24802359-24802381 ATTCCTTTCTGGAGCTTCTAGGG + Intergenic
988175683 5:27721666-27721688 ATTTATTTCTGGAGGCTCTAGGG - Intergenic
988589179 5:32534200-32534222 TTTTTTTTCTGGGAGCTCTAGGG + Intronic
988722650 5:33893307-33893329 ATTCATTTCTGAAGACTCTAGGG + Intergenic
988995049 5:36706648-36706670 GTTCCTTTCTGGAGACTCTACGG - Intergenic
989038190 5:37197499-37197521 ATTCCTTTCTAGAGGCACTAGGG - Intronic
989080428 5:37614143-37614165 GTTCCTTTCTGGAGGCTCCAGGG + Intronic
989114518 5:37939463-37939485 ATTCCTTTCTGGAGGCTCTAGGG + Intergenic
989576192 5:42990880-42990902 ATCCTTTTCTGGGGGATCCTAGG - Intergenic
990255592 5:53965531-53965553 ACTCTCTTCTGTGGTCTCTAAGG - Intronic
990335683 5:54769962-54769984 ATTCCATTCTGGAGGCTCTAGGG - Intergenic
990605597 5:57406780-57406802 GTTCCTTTCTGGGGGCTCTAGGG + Intergenic
990659875 5:58001465-58001487 ATTCCTTTCTGGAGGTTCCAGGG + Intergenic
991156495 5:63442709-63442731 TCTCTTATCTGGCGGCTCTAGGG + Intergenic
992151848 5:73912223-73912245 ATTGTTTTCTGGGGGATATGAGG + Intronic
992467752 5:77023952-77023974 ATTTTTTTCTTGGGCCTCCAGGG + Intergenic
992596810 5:78355627-78355649 GTTCCTTTCTGGAGGCTCGAGGG + Intergenic
992737331 5:79735602-79735624 ATTCATTTCTGAGGTGTCTAGGG + Exonic
992754632 5:79892729-79892751 CTTCATTTCTGGAGGCTCTAGGG - Intergenic
994339551 5:98610249-98610271 ATTCCTTTCTGTTGGCTCTTTGG + Intergenic
994626826 5:102230453-102230475 ATTCATTTCTGGAGGCTCTGGGG - Intergenic
994776831 5:104045508-104045530 ATCCTTTTCTGTGGTCTCCAAGG + Intergenic
994797681 5:104325907-104325929 TTTCCTTTCTGGGGGCTCTTGGG + Intergenic
995387124 5:111600375-111600397 ATTCTTTTCTGGAGGCCTTAGGG + Intergenic
995627770 5:114098023-114098045 GTTCACTTCTGGAGGCTCTAGGG + Intergenic
995774402 5:115710296-115710318 ATTTCTTTCTGGAGACTCTAAGG + Intergenic
995856695 5:116600345-116600367 CATTCTTTCTGGGGGCTCTAGGG + Intergenic
996140122 5:119896873-119896895 ATTCATTTCTGAAGGCTCTAGGG + Intergenic
996950033 5:129114818-129114840 GTTCTTTTCCGGAGGCTGTACGG + Intergenic
997178552 5:131804040-131804062 ATTCTTTTCTGGAGGCTTTTAGG + Intergenic
997274886 5:132577114-132577136 GTTCCTTTCTGGAGGCTCTAAGG + Intronic
997588367 5:135057928-135057950 GCTCTTTTCTGGGGGCTCTGCGG + Intronic
998620008 5:143783225-143783247 AATCCTTTCTGGATGCTCTAGGG - Intergenic
998629444 5:143882100-143882122 TTTCTTTTCTGGGGTGTGTAGGG + Intergenic
998699764 5:144684784-144684806 ATTCCTTTCTGTTGGCTCTAGGG + Intergenic
998773684 5:145574273-145574295 ATTAATTTCTGGAGTCTCTAGGG - Intronic
998877814 5:146618345-146618367 GCTCCTTTCTGGAGGCTCTAGGG - Intronic
999005570 5:147973700-147973722 CTTCTTTTCTGGAGCCTCTGGGG + Intergenic
999063155 5:148656475-148656497 CTTCCTTTCTGGAGGCTTTAGGG - Intronic
999555166 5:152733554-152733576 GTTCCTTTCTGGAGGCTCTAGGG + Intergenic
1000816051 5:165923058-165923080 ATTCCTTTCTGGAGGTTCTAAGG - Intergenic
1000895151 5:166846383-166846405 GTTCCATTCTGGAGGCTCTAAGG + Intergenic
1000911881 5:167032070-167032092 ATCCTTTTCTGGGTTCTCTGTGG - Intergenic
1001162200 5:169329957-169329979 CCTCCTTTCTGGAGGCTCTAGGG + Intergenic
1002824089 6:757011-757033 CTTCGTTTCTGGAGGATCTAGGG - Intergenic
1003410928 6:5862408-5862430 GTTCCTTTCTAGGGGCTCTGGGG - Intergenic
1003699267 6:8444193-8444215 ATCACTTTCTAGGGGCTCTAGGG + Intergenic
1003858378 6:10298923-10298945 CCTCTTTTCTGGGAGCTCTTAGG - Intergenic
1004579554 6:16936118-16936140 ATTCTTTTCATGTGGCTCTTTGG - Intergenic
1004740934 6:18460173-18460195 ATTTCTTTCTGGAGGCTTTAGGG + Intronic
1004955741 6:20725856-20725878 ATTCTTATCTAAGGGATCTAGGG + Intronic
1005022805 6:21433796-21433818 ATTCCTTTCTGGAGCCTCCAGGG - Intergenic
1005494750 6:26378577-26378599 ATTCCTTTCTGGAGTCTCTAAGG + Intergenic
1005503978 6:26453995-26454017 ATTCCTTTCTGGAGTCTCTAAGG + Intergenic
1007010772 6:38415436-38415458 ATTCCTTTCTAGAGGCTCTAAGG - Intronic
1007246240 6:40465219-40465241 ATTCCTTTCAGGGGGCTCTAGGG - Intronic
1007277701 6:40687571-40687593 ATTCTTTCTTGGAGGCTTTAAGG - Intergenic
1007472637 6:42100691-42100713 AGTCTTTTGTGGGGGCTTTATGG - Intergenic
1007852000 6:44812221-44812243 GTTTTTTTCTGGAGGCTATAGGG + Intronic
1008141689 6:47839379-47839401 ATTCCTTTTTAGAGGCTCTAGGG + Intergenic
1008176650 6:48276204-48276226 ATTCCTTTCTGGAGGCTCTGGGG - Intergenic
1008375022 6:50781691-50781713 GATCCTTTCTGGAGGCTCTAGGG + Intergenic
1009533365 6:64849630-64849652 GATCTTTTCTGGAGGCTCTGGGG + Intronic
1010719630 6:79268160-79268182 TTTCCTTTCTGGAGGCTCAAGGG - Intergenic
1010813962 6:80333007-80333029 ATTCCTTTTTGGGGGAGCTAGGG - Intronic
1010953631 6:82066364-82066386 ATGCCTTTCTGGAGGCTCTAGGG + Intergenic
1011724717 6:90198483-90198505 TTTCTTCTCTGGGGCCTATAGGG + Intronic
1011816591 6:91198461-91198483 ATTCTTTCCTGGAAGTTCTAGGG + Intergenic
1011823950 6:91284521-91284543 ATTTCTTTCTGGAGGCTCTAGGG - Intergenic
1011936438 6:92784427-92784449 ATTCTCTTCTGAAGACTCTAGGG - Intergenic
1012847026 6:104403425-104403447 ATTCCTTTCTGGAGACTCTAAGG + Intergenic
1013069220 6:106713615-106713637 ATTTTTTTCTGTGGGCTCATAGG + Intergenic
1013439837 6:110152610-110152632 TTTCTTTTCTGTTGGCTCTGGGG - Intronic
1014005753 6:116415989-116416011 ATTTTATTCTGGAAGCTCTAGGG + Intronic
1014483982 6:121976307-121976329 ATTCCTTTCTAGAGGCTCTGAGG - Intergenic
1014649144 6:124013916-124013938 ATTCCTTTCTGGAGATTCTATGG - Intronic
1015028472 6:128566495-128566517 GTTCCTTTCTAGAGGCTCTAGGG + Intergenic
1015070362 6:129086831-129086853 ATTTCTTTCTGGAGGCTCTAAGG + Intronic
1015124421 6:129737005-129737027 ATTTTTTTCTGGAAGCTCTAGGG - Intergenic
1015145129 6:129976923-129976945 GTTGTTTTCTGGGGGTTCTCAGG - Intergenic
1015207506 6:130656635-130656657 ATTCCCTTCTGAAGGCTCTAGGG + Intergenic
1015617337 6:135091253-135091275 GTTCCTTTCTGGAGGCCCTAGGG - Intronic
1015684774 6:135847613-135847635 ATTATTTTCTGGAGGTTCCAGGG + Intergenic
1015700290 6:136028542-136028564 ATTTCTTTCTGGAGGCTCTAAGG + Intronic
1016373406 6:143396972-143396994 ATTCTTTAGTGGGGACTCTCTGG + Intergenic
1016488479 6:144569951-144569973 ATTTATTTCTGGAGGGTCTAGGG - Intronic
1017533571 6:155322304-155322326 CTTCCTTTCTGGAGGCTCTAGGG - Intergenic
1017591182 6:155979503-155979525 GTTCTTATCTGGAGGCTCTCGGG - Intergenic
1017655172 6:156620660-156620682 ATTCCCTTCTGGAGGCTCTAGGG - Intergenic
1017714360 6:157198206-157198228 ATTCTTTTCTGGAGCCTTTTAGG + Intronic
1018602535 6:165560404-165560426 GTTCTCTTCTGGAGGCTCTGGGG - Intronic
1019031758 6:169019404-169019426 ATTCTTCTCTGGGGCCACTCAGG - Intergenic
1020572027 7:9875690-9875712 GTTCCTATCTGGAGGCTCTAGGG + Intergenic
1020707133 7:11559195-11559217 ATTTCTTTCTGGAGGCTCTAGGG - Intronic
1020744479 7:12064658-12064680 ATTCCTTTCTGGAGGCTTTTAGG - Intergenic
1020923407 7:14294038-14294060 ATTTCTTTCTGGAGGCTCAATGG + Intronic
1020958355 7:14771557-14771579 ATTCTTTTCTATGGGGTCTAGGG + Intronic
1020999475 7:15310818-15310840 GTTCCTTTCTGGTGGCACTAAGG + Intronic
1021147372 7:17105976-17105998 GTAGTTTTCTGGGGGCTCTTGGG - Intergenic
1021160313 7:17264507-17264529 ATTCCTTTTTGGAGGCTCTAGGG - Intergenic
1021261652 7:18466033-18466055 GTTCTTTGCTGGAGGCTATAAGG + Intronic
1021574231 7:22093043-22093065 ATTCCTTTCTGGAAGCTCTGGGG + Intergenic
1021790999 7:24205397-24205419 ATTCTTTTGTGTGTGGTCTATGG - Intergenic
1022609539 7:31855195-31855217 TTTCCTTTCTGGTGGCTCTGGGG + Intronic
1023109221 7:36793189-36793211 ATCCCTTTCTGGAGGCTCTCTGG - Intergenic
1023115596 7:36858827-36858849 GTTCCTTTCTGGAGGCTCTAGGG - Intronic
1023803696 7:43856182-43856204 ATTCCTTTCTAGAGGCTCTAGGG - Intergenic
1024370737 7:48580858-48580880 ATTCCTTTCTGGGTGGTCTTAGG + Intronic
1024595698 7:50934927-50934949 ATTTTTTTCTGGGTGCTTTTAGG + Intergenic
1025066806 7:55864075-55864097 ATTCTTTTGCGGGGGGCCTATGG + Intergenic
1026993272 7:74599921-74599943 ATTCTTTCCTGGGCTCTTTAAGG - Intronic
1027342509 7:77224234-77224256 ATTCCTTTCTGGAGGCTCCAGGG + Intronic
1027724063 7:81780954-81780976 GTTCATTTCTGGTGGCTCTAGGG - Intergenic
1028005704 7:85564142-85564164 GTTCTTTTCTAGAGTCTCTAGGG - Intergenic
1028148693 7:87346926-87346948 ATTCTTTTCTGGAGGCTCTAGGG + Intronic
1028478516 7:91277970-91277992 GTTTCTTTCTGGGGGCTCTAAGG + Intergenic
1029946518 7:104539071-104539093 ATTACTTTTTGGAGGCTCTAGGG - Intronic
1030305980 7:108019191-108019213 ATTCCTTCCAGGAGGCTCTAAGG + Intergenic
1030552778 7:110985141-110985163 GTTCCTTTCTGGAGGCTCTAGGG - Intronic
1030716162 7:112809890-112809912 ATTCTTTTCTAGATGCTCTAGGG - Intergenic
1030866777 7:114709983-114710005 ATATCTTTCTGGAGGCTCTAAGG + Intergenic
1031489268 7:122367835-122367857 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
1031593499 7:123621643-123621665 ATTTTTTTCTTGGCCCTCTAAGG - Intronic
1031849161 7:126842800-126842822 ATTCTTTTCTGAAGGCTCTAGGG - Intronic
1032603048 7:133320306-133320328 GTTCCTTTTTGGAGGCTCTAGGG + Intronic
1032755747 7:134889227-134889249 ATTCCTTCCTGGAGGCTCCAGGG + Intronic
1033068578 7:138180338-138180360 GTTCTTCCCTGGAGGCTCTAGGG - Intergenic
1033183579 7:139204275-139204297 ATTCCTTTCTGGAAACTCTAGGG - Intergenic
1033230658 7:139594933-139594955 ATTTCTTTCTGGGGGCCTTAGGG + Intronic
1033266445 7:139891167-139891189 ATCCTTTTATGGGACCTCTACGG + Intronic
1033464094 7:141575349-141575371 GTTATTTTCTGGGAGCTCTAAGG + Intronic
1033765356 7:144483441-144483463 GATCCTTTCTGGAGGCTCTAGGG - Intronic
1034695681 7:153051230-153051252 ATTTCTTTCTGGAGGCTCTGGGG - Intergenic
1034923370 7:155101724-155101746 ATGCCTTTCTGGAGGCTCTGGGG + Intergenic
1035425013 7:158764842-158764864 CTTCTTTTCAGGGTGTTCTAAGG - Exonic
1036493105 8:9245948-9245970 ATGCTATTCTGGGTGCTATACGG + Intergenic
1036527586 8:9549435-9549457 GTTATTTTCTGGGGGCTCTAGGG + Intergenic
1037551809 8:19981688-19981710 TGTCTATTCTGGAGGCTCTAGGG + Intergenic
1038055471 8:23853769-23853791 TTTTTTTTCTAGGGGCTCTCTGG + Intronic
1038118038 8:24579892-24579914 TTTCTTTTCTGGAGGCTCTAGGG - Intergenic
1038790962 8:30667928-30667950 ATAATTTTCTGTGGGCTCTGGGG - Intergenic
1039101472 8:33946538-33946560 ATTCCCTTCTGGAGGCTCCAGGG + Intergenic
1039817476 8:41107226-41107248 ATTCTTTCCTGAAGGCTCTAGGG - Intergenic
1040883040 8:52229335-52229357 ATTCCATTCTGGAGGCTCCAAGG + Intronic
1041649899 8:60292008-60292030 ATTTTTATCTGTGGTCTCTAAGG - Intergenic
1041860344 8:62505901-62505923 ATTCTTTTATGGTGACTCAAAGG + Intronic
1042057494 8:64781457-64781479 ATTCCTTTCTGGAGGCTCCAGGG + Intronic
1042835596 8:73076795-73076817 AGGCCTTTCTGGAGGCTCTAGGG - Intronic
1042875523 8:73437477-73437499 GTTCCTTTCTGGAGGCTCTAGGG - Intronic
1042879939 8:73476187-73476209 ATTCTGTTCTGGGTGCTCTGAGG - Intronic
1043611539 8:82069033-82069055 GTTCCTTTCTGGAGGCCCTAGGG - Intergenic
1043615584 8:82120910-82120932 ATGCCTTTCTGGGGGCTGTAGGG + Intergenic
1043632773 8:82357322-82357344 ATGCCTTTCTAAGGGCTCTAAGG + Intergenic
1043812527 8:84758961-84758983 ATTCCTTTCTGGAGGCTCCAGGG + Intronic
1043876704 8:85493753-85493775 TTTCTATTTTGGGGGCTATATGG - Intergenic
1044243184 8:89911070-89911092 GTTGCTTTCTGGAGGCTCTAGGG + Intronic
1044361516 8:91290415-91290437 TTTCTTTCTTGGGGGCTCTAGGG + Intronic
1044999903 8:97869733-97869755 ATTTTGTTCTTGGGTCTCTATGG + Intronic
1045435880 8:102163372-102163394 TTTGTTTTCTGGAGGCTCTAGGG + Intergenic
1045635203 8:104178195-104178217 ATTCCTTTCTGGTGGCTCTAGGG + Intronic
1045640073 8:104239878-104239900 GTTCTTGTCTGGAGGTTCTAGGG + Intronic
1045799317 8:106083500-106083522 ATACTTTCCTGGGGGCTTAATGG - Intergenic
1046124275 8:109884720-109884742 ATTCTTTTCTGGAGGCCCTACGG + Intergenic
1046314917 8:112487231-112487253 ATTCTGTCCTGGGAGCTCTGAGG + Intronic
1046374361 8:113357026-113357048 TTTCATTTCTGGGAGGTCTAAGG - Intronic
1046461554 8:114543676-114543698 ATCCTTCTCTGGGGTATCTATGG + Intergenic
1046746764 8:117884277-117884299 ATTCTTCTTTGGGGGCTTTTGGG - Intronic
1047089330 8:121556376-121556398 ATTTCTTTTTGGAGGCTCTAGGG - Intergenic
1047243380 8:123115633-123115655 ATTCCTTTCTAGAGGCTCTGGGG + Intronic
1047286729 8:123493689-123493711 GTTCCCTTCTGGGAGCTCTAGGG + Intergenic
1047408422 8:124604483-124604505 TTCCTTTTTTGGGGGCTTTATGG - Intronic
1047449358 8:124949878-124949900 ATTGCTTCCTGGAGGCTCTAAGG - Intergenic
1047568760 8:126074476-126074498 ATTCTTTTCTGGAGGCTTGAGGG + Intergenic
1047978383 8:130154204-130154226 AGTTTTTTCTCGGGGCTCTGAGG - Intronic
1048247959 8:132830107-132830129 ATTTTTCTCTGGAGGCTCTTAGG + Intronic
1048285565 8:133138603-133138625 AATCCTTTCTGGAGCCTCTAAGG - Intergenic
1048663300 8:136632090-136632112 ATTCTTGTCTGGAGCCTCTGAGG + Intergenic
1050071188 9:1816184-1816206 ATACTATTCTGAGTGCTCTATGG + Intergenic
1050313537 9:4377408-4377430 GTTGTTTGCTGGGGGCTCTCAGG + Intergenic
1050764426 9:9114590-9114612 ATTCATTCCTGGGGACTTTATGG + Intronic
1051022093 9:12556753-12556775 TTTTTTTTCTGGGGGCCCTTTGG + Intergenic
1051741756 9:20259170-20259192 AATTTTTCCTGGAGGCTCTAGGG - Intergenic
1052017067 9:23481675-23481697 GTTCTTTTCTGGAGGCTGTAAGG + Intergenic
1052060781 9:23958677-23958699 CTTCCTTTCTGGAGGCTCTAGGG - Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1053442742 9:38129474-38129496 GTTCCTCTCTGGGGGCTCTTAGG + Intergenic
1053801537 9:41767111-41767133 AGTCTGTTCTGTGGGCTCTGTGG + Intergenic
1054143662 9:61547715-61547737 AGTCTGTTCTGTGGGCTCTGTGG - Intergenic
1054189968 9:61979265-61979287 AGTCTGTTCTGTGGGCTCTGTGG + Intergenic
1054463438 9:65479050-65479072 AGTCTGTTCTGTGGGCTCTGTGG - Intergenic
1054648546 9:67609326-67609348 AGTCTGTTCTGTGGGCTCTGTGG - Intergenic
1055159228 9:73104744-73104766 ATTCTTTTCTGGAGGCTGTCAGG - Intergenic
1055196521 9:73600858-73600880 CTACATTTCTGGAGGCTCTAGGG + Intergenic
1055228518 9:74031145-74031167 ATTCCCTTCTGGAAGCTCTAGGG + Intergenic
1055501772 9:76908613-76908635 ATTCTTTTTTAGAGGCTCTAGGG + Intergenic
1055817119 9:80219850-80219872 ATTCATTTCTGAAGGCTCGAGGG + Intergenic
1056032089 9:82563425-82563447 ATTCTTTGCAGAGTGCTCTAAGG + Intergenic
1056707101 9:88960437-88960459 GTTCCTTTCTGGAGGCTCTAGGG - Intergenic
1056914745 9:90736194-90736216 ATTCCTCTCTGGAGTCTCTAGGG - Intergenic
1057301902 9:93891420-93891442 AATCATTTCAGTGGGCTCTAGGG + Intergenic
1057978768 9:99636515-99636537 ATTTCTTTCTGAAGGCTCTAGGG + Intergenic
1058095615 9:100856984-100857006 ATTTTTTTCTGGAGGCTCTAGGG + Intergenic
1058474381 9:105317007-105317029 ATTTTTTTCTTGAGGTTCTAGGG + Intronic
1058543364 9:106035324-106035346 ATTCATTTCTTGGTGGTCTACGG + Intergenic
1059013965 9:110493857-110493879 GTTCCTTTCTGGAGGCTCTGAGG + Intronic
1059046406 9:110873317-110873339 ATATTTTTCTGGAGGCTATATGG - Exonic
1059765007 9:117375830-117375852 ATTCCCTTCTGGAGGCTCTTGGG + Intronic
1060060844 9:120458176-120458198 AGTCCTTTCTGGGGGCTCCCAGG + Intronic
1060203888 9:121670426-121670448 GTTCTTTTCTAAAGGCTCTAGGG + Intronic
1060249954 9:121978356-121978378 GTTCTTTTCTGGGGTCCCAAGGG + Intronic
1060351507 9:122865018-122865040 GTTCTTTTCTGGCACCTCTATGG + Intronic
1061559085 9:131391237-131391259 ATTTTCTTCTGGAGGCTTTAGGG + Intergenic
1061751800 9:132783311-132783333 ATTCCTTCCTGGAGGCTCTAGGG - Intronic
1185561230 X:1061964-1061986 AGTTCTTTCTGGAGGCTCTAAGG + Intergenic
1185808994 X:3087667-3087689 AGTTTCTTCTGGAGGCTCTAGGG + Intronic
1185924116 X:4127566-4127588 AGTTCTTTCTGGAGGCTCTAGGG + Intergenic
1186081189 X:5934558-5934580 ATTCCTTTCTGGGTGCTGTAGGG - Intronic
1186206756 X:7208834-7208856 TTTCTTTTCTGGAGGCTCTAGGG + Intergenic
1186280790 X:7990558-7990580 ATTCCTTTCTGGAGGCTTTAGGG - Intergenic
1186331830 X:8542615-8542637 ACTCCTTTCTGGAGGCTCCAGGG + Intronic
1186421062 X:9426847-9426869 ACTCCTTTCTGGAGACTCTAGGG - Intergenic
1186528385 X:10270534-10270556 ATTCCTTTCTGAAGGCTCTGAGG - Intergenic
1186676056 X:11818566-11818588 ATTCCTTTCTGGAGGCTCTAGGG - Intergenic
1187123606 X:16433005-16433027 ATTCCTTTCCGTAGGCTCTAGGG - Intergenic
1187410139 X:19044121-19044143 ATTCTTTTCTGGAAACTCTAGGG + Intronic
1187607197 X:20898534-20898556 ATTTCTTTCTGGAAGCTCTAGGG + Intergenic
1187909698 X:24100042-24100064 ATTCTTTTCTGGGTGCTCTAGGG + Intergenic
1187959557 X:24555474-24555496 GTTCCTGTCTGGAGGCTCTAGGG - Intergenic
1188099242 X:26062434-26062456 GTTCCTTTAGGGGGGCTCTAGGG - Intergenic
1188400212 X:29735132-29735154 ATCCCTTTCTGGAGGCTCCAGGG + Intronic
1188480413 X:30631191-30631213 ATTCCTTTCTGGAAGCTCTAAGG - Intergenic
1188649231 X:32610795-32610817 TTGCTTTTGTGGGGACTCTAAGG + Intronic
1188828427 X:34865869-34865891 GTTTTTTTCTGGGGACTCCAGGG + Intergenic
1188897222 X:35684345-35684367 ATTTCTTTCTGGAGGCACTAAGG - Intergenic
1188915931 X:35910947-35910969 ACTCCTTTCTGGTGGCTCTAGGG + Intergenic
1189273994 X:39771615-39771637 ATTCTTTCCTTGGGGTTCTGGGG - Intergenic
1189790179 X:44596330-44596352 GTTCTTTTCTGGAGGCCCTAGGG + Intergenic
1190381275 X:49841682-49841704 GTTCCTTTCTAGAGGCTCTAGGG + Intergenic
1190479411 X:50861048-50861070 ATGCTTTTCTGGGGACTTTGAGG + Intergenic
1190493373 X:51004362-51004384 ATTCCTTTCTGCAGGCTCTGGGG - Intergenic
1191102456 X:56746580-56746602 ATTCCTTTCTAGAGGCTCTGGGG + Intergenic
1191967645 X:66777494-66777516 GTTATTTTCTGGAGGTTCTAGGG - Intergenic
1192250962 X:69413206-69413228 ATTCTTTGTTGGGGTCTCTGGGG - Intergenic
1192574822 X:72235216-72235238 GTTCCTTTCTGGAGGCTCTAGGG + Intronic
1192607076 X:72529506-72529528 CATTTTTTCTGGAGGCTCTAGGG - Intronic
1192810600 X:74543814-74543836 ATTCCTTTCTGCAGGCTCTGGGG - Intergenic
1192851749 X:74963852-74963874 ATTCCTTTCTGGAAACTCTAAGG + Intergenic
1193079982 X:77397301-77397323 ATTCATTTCTGGAGGCTCAAGGG + Intergenic
1193267586 X:79490799-79490821 ATTCTTTTCTGGTTGTTTTATGG - Intergenic
1193856214 X:86606568-86606590 ATTTTTTTCTGAGTGCTTTAAGG + Intronic
1193986359 X:88245667-88245689 CTTCCTTTCTGGTGGCTCTGGGG + Intergenic
1193992843 X:88329528-88329550 ACTCATTTCTGGAAGCTCTAAGG - Intergenic
1194024764 X:88737936-88737958 ATTCTTTTCTAGAGGCTTTGTGG - Intergenic
1194039340 X:88920348-88920370 GTTCTTATTTGGAGGCTCTAGGG - Intergenic
1194454985 X:94092539-94092561 GTTTTTTTGTGGGGGCTGTAGGG - Intergenic
1194564696 X:95470271-95470293 ATTCACTTCTGGTGGCTCTGGGG - Intergenic
1195026523 X:100883049-100883071 ATTCCTTTCTGGAGGCTCTGGGG - Intergenic
1195271548 X:103236292-103236314 ATTTCTTTCTGGGGGCTCTAGGG - Intergenic
1195376739 X:104235006-104235028 ATTCACTTCTGGAGGCTCTTGGG + Intergenic
1195433461 X:104815325-104815347 ATTCTTTTCTGGAAACTCTAGGG + Intronic
1195622761 X:106973843-106973865 ATTCCTTTCTGGAGGCTCTAGGG - Intronic
1195815610 X:108883184-108883206 ATTTCTTCCTGGGGGCTCCAGGG + Intergenic
1196076308 X:111580687-111580709 ATTGTTTTGTGGAGTCTCTAGGG + Intergenic
1196297834 X:114019297-114019319 ATTCCTTTCTGAAGGCTATAGGG + Intergenic
1196595433 X:117540626-117540648 ATTCCTTTTTGGAGGTTCTAGGG + Intergenic
1196596428 X:117551089-117551111 ATTCCCTTCTGGAAGCTCTATGG - Intergenic
1196611331 X:117718019-117718041 GTTCTTTTCTGTAGGCTCTAAGG - Intergenic
1196636206 X:118005719-118005741 GTTCCTTTCTGGAGGCTGTAGGG - Intronic
1197006704 X:121511073-121511095 ATTCGTTTCTGAAGGCTATAGGG + Intergenic
1197339698 X:125251508-125251530 GTACCTTTCTGGAGGCTCTAGGG + Intergenic
1197409929 X:126104054-126104076 ATACCTTTCTGGAGACTCTAAGG - Intergenic
1197895720 X:131312318-131312340 ATTCCATTCTGGCGGCTTTAAGG + Intronic
1197974692 X:132154173-132154195 ATTCCTTTCTCAAGGCTCTATGG - Intergenic
1198168213 X:134078174-134078196 CTTCTTTTCTGGGTGCTTTCAGG - Intergenic
1198910684 X:141610224-141610246 GTTCTTTTCTTGAGACTCTAGGG + Intronic
1199287853 X:146073824-146073846 ATTCCTTCCTGGGGACTCCAGGG - Intergenic
1199361990 X:146931629-146931651 CCTCCTTTCTGGTGGCTCTAAGG + Intergenic
1199402503 X:147415525-147415547 ATTTTTTTCTGGAAGCTCTAGGG + Intergenic
1199437918 X:147834168-147834190 TGTTTTTTCTGGAGGCTCTAGGG - Intergenic
1199527049 X:148804353-148804375 TGTGTTTTCTGGGGGCTCCAAGG - Intronic
1199539826 X:148946576-148946598 ATTCCTTTCTGAAGGTTCTAAGG + Intronic
1199611002 X:149613541-149613563 ATTCCTTTCTGGAGCCTCCAGGG - Intronic
1199933759 X:152551402-152551424 GTTCTTTTCTGGAGGATTTAGGG - Intergenic
1200766120 Y:7082328-7082350 ATTCCTTACTGTGGGCTCTGAGG + Intronic
1201430784 Y:13900003-13900025 ACTCCTTTCTGGAGGCTCCAGGG - Intergenic
1201513907 Y:14795975-14795997 ATTCCTCTCTGGGGGCTGGAGGG + Intronic
1201578632 Y:15487979-15488001 CTTCTTTTCTGGAGGCTTTAGGG + Intergenic
1202051093 Y:20781530-20781552 ATTCTTTTGTGGAAGCTCTGGGG + Intergenic