ID: 1124186010

View in Genome Browser
Species Human (GRCh38)
Location 15:27530173-27530195
Sequence CAATTGGAACAGCTTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124186010_1124186015 12 Left 1124186010 15:27530173-27530195 CCTGGGGCAAGCTGTTCCAATTG 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1124186015 15:27530208-27530230 TTCCTAACATGTCAAATGCAAGG 0: 1
1: 0
2: 2
3: 21
4: 215
1124186010_1124186017 18 Left 1124186010 15:27530173-27530195 CCTGGGGCAAGCTGTTCCAATTG 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1124186017 15:27530214-27530236 ACATGTCAAATGCAAGGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124186010 Original CRISPR CAATTGGAACAGCTTGCCCC AGG (reversed) Intronic
904497504 1:30895472-30895494 GAAGTGGAACAGCTTCCCCGGGG - Intronic
907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG + Intronic
907588976 1:55647581-55647603 CCATTGGAACAGCAGGCCCAGGG - Intergenic
907929818 1:58988928-58988950 CAAAGGGAACAGCATGTCCCAGG - Intergenic
911727561 1:101258065-101258087 CATTTGGTACTGCTTGCCCTGGG + Intergenic
912749124 1:112270868-112270890 GAAGAGGGACAGCTTGCCCCTGG - Intergenic
918075283 1:181166299-181166321 CTATTGGAACAGCAGGCCCGCGG + Intergenic
924662622 1:246035547-246035569 TAATTGGAACATCTTGTCACAGG + Intronic
1068831208 10:61497346-61497368 CAAGTGGAACAGTTTTGCCCAGG + Intergenic
1070791816 10:79194105-79194127 CCACTGGCACCGCTTGCCCCAGG + Intronic
1072636670 10:97182762-97182784 CAGATGGACCAGCTTGTCCCTGG - Intronic
1075712338 10:124537430-124537452 CCAATGGCACAGCTTGCTCCGGG - Intronic
1076488939 10:130843391-130843413 CACTTGGTACAGATTCCCCCAGG - Intergenic
1078129122 11:8597593-8597615 CAATTAGTACAGTTTGTCCCAGG + Intergenic
1091560227 12:1606543-1606565 AAGTTGGAACAGCTTGCCTGGGG + Intronic
1093436425 12:19140018-19140040 TAATTGGAAGACCTTGCCACTGG - Intronic
1097137050 12:56865679-56865701 CAATTTGAACAGCCTGGGCCAGG + Intergenic
1100178069 12:92053232-92053254 CAACTGGAACAGTTTCCCCAGGG - Intronic
1100278513 12:93095021-93095043 CAAAGGGAACACCTTGTCCCTGG + Intergenic
1102228114 12:111243695-111243717 CAACTGTCACAGCTTGGCCCTGG + Intronic
1104198741 12:126567137-126567159 CACTTGGAGCAGCCGGCCCCAGG + Intergenic
1105332737 13:19433126-19433148 CGTTGTGAACAGCTTGCCCCAGG - Intronic
1105878951 13:24586653-24586675 CGTTGTGAACAGCTTGCCCCAGG + Intergenic
1105920887 13:24962397-24962419 CGTTGTGAACAGCTTGCCCCAGG - Intergenic
1106692423 13:32132605-32132627 CAAATGGTACAGCTTGGCCCTGG + Intronic
1107408111 13:40134132-40134154 CTGTTTGTACAGCTTGCCCCTGG + Intergenic
1108626077 13:52229995-52230017 CACTGTGAACAGCTTGCCCTAGG - Intergenic
1108659986 13:52576484-52576506 CACTGTGAACAGCTTGCCCTAGG + Intergenic
1115197533 14:30817463-30817485 CAATCGCAACAGCCTTCCCCTGG + Intergenic
1119526709 14:75328572-75328594 AAATTGCAGCAGCCTGCCCCAGG + Intergenic
1119811168 14:77520840-77520862 GAATTGGAGCACCGTGCCCCAGG - Intronic
1122737160 14:103849402-103849424 CATTTGGATCACCTTACCCCGGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG + Intergenic
1128390599 15:67180160-67180182 CAGTTGGAAGAGGTTGGCCCAGG + Intronic
1130901573 15:88210628-88210650 CACCTGGAGCAACTTGCCCCTGG + Intronic
1131141562 15:89980656-89980678 CAAATGAAACAGCTTTTCCCAGG + Intergenic
1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG + Intronic
1133368044 16:5226504-5226526 AAACTGGAGCAGCTTGCCCAAGG + Intergenic
1137495466 16:48965850-48965872 CAATTGGACAAGCTTCCCCTTGG - Intergenic
1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG + Intergenic
1138410571 16:56836481-56836503 CAAGTGGAATTGCTTGCCCTGGG - Intronic
1142360303 16:89623028-89623050 CAATTGGAAGAACTGGCCCCAGG + Intronic
1144762884 17:17717328-17717350 CCATGGGAACAGCTGGGCCCAGG - Intronic
1144767143 17:17739021-17739043 CAGTGGGAACAGCCTGCCCAAGG + Intronic
1145395876 17:22494511-22494533 CAATAAGAAAAGCTTGCTCCAGG + Intergenic
1147323782 17:39660767-39660789 CTTTTGGAACAGGTCGCCCCAGG - Intronic
1151186616 17:72369465-72369487 CAAAGGGACCAGATTGCCCCTGG + Intergenic
1151229730 17:72675671-72675693 CAATTGGGACATCTGGCGCCGGG - Intronic
1151479665 17:74362526-74362548 CACCTGGCTCAGCTTGCCCCTGG - Intergenic
1155113643 18:22741994-22742016 CAATTACATCAGCTTGCTCCAGG - Intergenic
1155546070 18:26916911-26916933 CAATTGGAACAGCCAGCCTTAGG + Exonic
1156786636 18:40923092-40923114 GAAAAGGAAGAGCTTGCCCCAGG - Intergenic
1156857306 18:41797236-41797258 CAACTGGAAGAGATAGCCCCAGG + Intergenic
1161801969 19:6421366-6421388 CACTTGGCACTGCCTGCCCCGGG + Intronic
1164721788 19:30437915-30437937 CAGTGAGAACAGCTTGCCCCTGG - Intronic
927987952 2:27426699-27426721 CAATTGGAACACCTGGCCCAGGG - Intergenic
929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG + Intergenic
930599056 2:53423403-53423425 CAATTGGAACAGTCAGCCCCAGG + Intergenic
931192562 2:60019414-60019436 CATTTGGAGCAGCATTCCCCAGG - Intergenic
940220541 2:151346753-151346775 CACTTGGAACATTTTGGCCCTGG + Intergenic
940698523 2:157011878-157011900 CAATTGGAACTGGTGGCCACTGG + Intergenic
947432457 2:230043197-230043219 CAACAGGAGCAGCTTGCTCCAGG + Intronic
1169150932 20:3288791-3288813 CAGCTGGAACAGGTTGGCCCAGG - Intronic
1173180681 20:40804283-40804305 GCATGGGAACAGCTTCCCCCGGG - Intergenic
1175274551 20:57759251-57759273 CAATGGCTACAACTTGCCCCAGG + Intergenic
1179497293 21:41780724-41780746 CAATTGGAATAGCTCCCCTCTGG - Intergenic
1180985058 22:19899190-19899212 CTGTTCAAACAGCTTGCCCCAGG + Intronic
949867274 3:8556635-8556657 CAATTGCAACGGCTTTGCCCGGG - Intronic
955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG + Intergenic
957616930 3:82541799-82541821 CCTCTGCAACAGCTTGCCCCTGG - Intergenic
959800367 3:110487109-110487131 GAATTAGACCAGCTTGACCCAGG + Intergenic
961661592 3:128471578-128471600 CAAAGGGAACAGCATGCACCAGG + Intergenic
962748752 3:138417429-138417451 GAATTGGAATAACTTGCCCAAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968743467 4:2343712-2343734 CAGGTGGCACAGCTTGCCCAAGG + Intronic
968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG + Intronic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
978056403 4:104273662-104273684 CACTTTGATCAGCTTGCCCCAGG + Intergenic
979987674 4:127335179-127335201 CAATTGGAACTGCCTAGCCCAGG + Intergenic
980694538 4:136337788-136337810 CAATTGGTACAGTTGGCCCAGGG - Intergenic
984910803 4:184672740-184672762 CAGTTGGACCAGCTTCCTCCAGG + Intronic
987066296 5:14293141-14293163 CACTCGGAACAGCTGGACCCTGG + Intronic
994144893 5:96383826-96383848 CTATTGCAACAGAGTGCCCCTGG - Intergenic
996902321 5:128556564-128556586 CAATGAGAACAGCTGGACCCAGG + Intronic
1000812969 5:165885580-165885602 TGCTTGGAACAGCTTACCCCAGG - Intergenic
1000948143 5:167447643-167447665 CACATGGAACTGCTTCCCCCTGG + Intronic
1001204487 5:169749590-169749612 CAGTTGAAACAGCTTCCTCCAGG + Intronic
1004691294 6:17994409-17994431 CAATTTAAGCAGCTTGCCCAAGG + Intergenic
1006334655 6:33414339-33414361 GAATTGGGACAGTTTGCTCCTGG + Exonic
1006533149 6:34674582-34674604 GAATTGAAACAGATTGCCTCTGG + Intronic
1006922714 6:37637166-37637188 CAAGTGGAACAGCTGTCTCCAGG + Exonic
1007744393 6:44034555-44034577 GAATTGCAACAGCTGGCCACGGG + Intergenic
1013835849 6:114334263-114334285 GAATTGGAAAAGCTTGCCACGGG - Intronic
1016612631 6:146009719-146009741 CAATTGGAATCTCTTGCCTCAGG + Intergenic
1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG + Intronic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1019011520 6:168847219-168847241 CAAGAGAAACAGCTGGCCCCCGG - Intergenic
1019011590 6:168847552-168847574 CAAGAGAAACAGCTGGCCCCCGG - Intergenic
1022528783 7:31054155-31054177 CAGTTGGAAGAGCTGGCCCAGGG - Intronic
1022673184 7:32475144-32475166 AAATTGGAACAGCTTGCCTCAGG - Intergenic
1023648146 7:42340772-42340794 CCATTGCAATAGCTTCCCCCAGG - Intergenic
1026213151 7:68324514-68324536 CAATAGGAGCACCTTCCCCCAGG + Intergenic
1027713821 7:81643645-81643667 TAATTGGTATAGCTTGCACCTGG - Intergenic
1035911258 8:3569104-3569126 CAATTGGAACAGCTCATACCAGG - Intronic
1039901168 8:41753511-41753533 CAACTGGGACAGCGTGCCCCTGG - Intronic
1041043686 8:53871639-53871661 TAATTACAACAGCTTGTCCCTGG + Intronic
1041103170 8:54417048-54417070 CAAATGCAAAAGCTGGCCCCTGG - Intergenic
1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG + Intergenic
1045274702 8:100692539-100692561 CAATTTGAACGGGTTCCCCCTGG + Intronic
1050091742 9:2022042-2022064 CAACTGGAACTTCTTGCTCCAGG - Intronic
1050920603 9:11196965-11196987 CACTTGGAGCAGCTGGCCCCGGG + Intergenic
1060470139 9:123941839-123941861 CAAGAGGAACGGCTTGTCCCTGG - Intergenic
1060579638 9:124733313-124733335 GAATTGGCAGAGCTTGACCCAGG - Exonic
1186798243 X:13067063-13067085 CAGTTGGAACTGTTTGACCCTGG + Intergenic
1187207723 X:17198695-17198717 CAATTGGAACAAGTTTGCCCTGG + Intergenic
1187854706 X:23625584-23625606 AAATTGAAACAGTTTTCCCCTGG - Intergenic
1190622106 X:52297717-52297739 CAATTGGAACACATGGACCCAGG + Intergenic
1194741150 X:97575793-97575815 CAATTGGATGAGCATACCCCTGG + Intronic
1195755046 X:108191827-108191849 GAAATGGTACAGCTGGCCCCAGG - Intronic
1200125659 X:153813041-153813063 CAATTGGAATTGCTTGGCCAGGG - Intronic