ID: 1124186015

View in Genome Browser
Species Human (GRCh38)
Location 15:27530208-27530230
Sequence TTCCTAACATGTCAAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124186010_1124186015 12 Left 1124186010 15:27530173-27530195 CCTGGGGCAAGCTGTTCCAATTG 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1124186015 15:27530208-27530230 TTCCTAACATGTCAAATGCAAGG 0: 1
1: 0
2: 2
3: 21
4: 215
1124186011_1124186015 -4 Left 1124186011 15:27530189-27530211 CCAATTGCTCTGTGCCCCTTTCC 0: 1
1: 0
2: 3
3: 34
4: 331
Right 1124186015 15:27530208-27530230 TTCCTAACATGTCAAATGCAAGG 0: 1
1: 0
2: 2
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124186015 Original CRISPR TTCCTAACATGTCAAATGCA AGG Intronic
901912212 1:12468677-12468699 TTACTAACTTGTCAAATGGAGGG + Intronic
902292884 1:15446761-15446783 TTCCCCACCTGTCTAATGCAGGG - Intronic
903055748 1:20634816-20634838 GCCCTAACCTGTAAAATGCAGGG - Intronic
905850940 1:41274369-41274391 TTCCTAGAATGTCATATACATGG + Intergenic
905948477 1:41924497-41924519 TACCTCACAAGTCACATGCAAGG + Intronic
906409939 1:45570210-45570232 TTCCCAACGTGCCTAATGCAAGG - Intergenic
906814013 1:48859139-48859161 TGACTAACATGGCAAATGCTAGG + Intronic
907866409 1:58403630-58403652 TTCCTCATGTGTAAAATGCAAGG + Intronic
907914396 1:58855351-58855373 TTCCCAAGATTTCAAAGGCATGG + Intergenic
909143703 1:71900160-71900182 TTCCTCACATGATAAATGCGAGG + Intronic
909457897 1:75870492-75870514 ATCCCCACATGTCAAAGGCAGGG + Intronic
910082927 1:83363443-83363465 ATCCTAGCATGACAAATTCAAGG + Intergenic
912084223 1:105978805-105978827 TTTAAAACATGTCAAATTCATGG - Intergenic
912358529 1:109075106-109075128 TTATTAAAATATCAAATGCAAGG - Intronic
916338824 1:163705143-163705165 TTCTTGACATTTCATATGCATGG + Intergenic
916760313 1:167810465-167810487 GTCCTCACATGTCAAAAGGATGG - Intronic
917512612 1:175680816-175680838 TTTATACCATGGCAAATGCAAGG - Intronic
918172938 1:182015368-182015390 TTCCTAAAATTTCACATGCAGGG + Intergenic
919592480 1:199521758-199521780 TGCCTGACAAGTCAAATGCTAGG - Intergenic
921136197 1:212261405-212261427 TTCAAAACATGTTAAATGCCTGG + Intergenic
923347112 1:233065522-233065544 TTTATAACATGTAAAATCCAGGG - Intronic
924382773 1:243479648-243479670 TTCCTCACATGTGAAATGAGAGG - Intronic
1063780161 10:9313614-9313636 TGCCTAACAATTGAAATGCATGG - Intergenic
1063821878 10:9845598-9845620 GACCTAACATGCCAAATGCAGGG - Intergenic
1065681608 10:28239471-28239493 ATCCTAATATGACAAATGCATGG + Intronic
1071250331 10:83811775-83811797 TTTCCACCATGGCAAATGCAGGG + Intergenic
1071718265 10:88118445-88118467 TTTTTAACATGTCAGATACAAGG + Intergenic
1073757994 10:106601668-106601690 TTGCTCACATGTCATATCCATGG + Intronic
1075007535 10:118841525-118841547 TTCCTAATCTGTGAAATGGATGG - Intergenic
1078017642 11:7628854-7628876 TTCCTCATCTGTAAAATGCAGGG - Intronic
1078818899 11:14856036-14856058 ATCCTCACATGTCAAGGGCAGGG + Intronic
1079648440 11:22896007-22896029 TTCCCCACATGTCAAGAGCAGGG - Intergenic
1080241004 11:30127268-30127290 GTCCTAGCATGGCAAATGCTTGG + Intergenic
1080369468 11:31618425-31618447 TTCCTCACATGGCAAAAGAATGG + Intronic
1081230098 11:40575493-40575515 TTCCTAACATTTTAAAAGTAGGG - Intronic
1081634223 11:44710171-44710193 TTCCTGACAGATCAAATGTAGGG + Intergenic
1082024260 11:47560505-47560527 TTCCAAACATTTCATATACATGG - Intronic
1083848211 11:65349076-65349098 TTCCTAACATTTCAACTTAAAGG + Intronic
1086172412 11:83851222-83851244 TTCCTAACATGTCACATTCTGGG - Intronic
1095595963 12:43958769-43958791 TTCCTAAAGTGTAAAATGCATGG + Intronic
1098302942 12:69072577-69072599 TTCGTAACATTTCAAAAACAGGG + Intergenic
1099072392 12:78061893-78061915 TTCCTACTATGTCAAATTTAAGG - Intronic
1099176130 12:79424510-79424532 TTCCTACAATTTGAAATGCATGG + Intronic
1099285416 12:80709590-80709612 TTCCTTACATGCCAATTGAAAGG + Intergenic
1100472146 12:94903106-94903128 TTCCTAAAATGTCAGTTGGATGG + Intronic
1102444056 12:112987786-112987808 TTCCTACCAGGTCAAAATCAAGG + Intronic
1105655489 13:22432880-22432902 TTCCAAATAAGGCAAATGCATGG + Intergenic
1107028479 13:35826990-35827012 TCCCGAAAATGTCAAATGTATGG + Intronic
1116409338 14:44602963-44602985 TTCTTACCCTGTTAAATGCACGG + Intergenic
1116614030 14:47111003-47111025 TTTCTAACATCTCCAATGCCTGG - Intronic
1118838762 14:69495485-69495507 TTCTGACCATGTAAAATGCAGGG + Intronic
1121313151 14:92945962-92945984 TTCCCAACATGTAAACTGCAGGG + Intronic
1121530652 14:94650313-94650335 TTCCTCAATTGTCGAATGCAAGG - Intergenic
1121805194 14:96812930-96812952 TTCCTTACCTGTAAAATGAAAGG - Intronic
1123228376 15:17073363-17073385 TTTCCAAACTGTCAAATGCAAGG + Intergenic
1124186015 15:27530208-27530230 TTCCTAACATGTCAAATGCAAGG + Intronic
1124433336 15:29626280-29626302 ATCCCGACATGTCAAAGGCAGGG + Intergenic
1125332190 15:38593322-38593344 TTCCTTATATGTAAAATGAAAGG + Intergenic
1126901422 15:53318583-53318605 TTTCCAAAATGTCAAATGAATGG - Intergenic
1127011931 15:54640943-54640965 TTCTTAACATGCCTAATCCAAGG - Intergenic
1127522761 15:59759464-59759486 TTCCTAACTTGTGAACTGCGTGG + Intergenic
1128106503 15:65049485-65049507 TTCCCCACATGTCAAAGGCTGGG - Intronic
1131362292 15:91803836-91803858 TACCTAACATGATAAAGGCAGGG - Intergenic
1131566799 15:93493148-93493170 TTATCAACATGTCACATGCACGG - Intergenic
1131708474 15:95024917-95024939 TGCCTACTATGTAAAATGCATGG + Intergenic
1132741825 16:1417771-1417793 TTCCTAAGATGACAAATGGCTGG - Intergenic
1133844349 16:9440128-9440150 TTCCTCACAAGCCAAATGGATGG + Intergenic
1134490362 16:14691543-14691565 TTTCCTACATGTCCAATGCAGGG - Intronic
1134495743 16:14730660-14730682 TTTCCTACATGTCCAATGCAGGG - Intronic
1134501289 16:14770971-14770993 TTTCCTACATGTCCAATGCAGGG - Intronic
1134579292 16:15358063-15358085 TTTCCTACATGTCCAATGCAGGG + Intergenic
1134671659 16:16060236-16060258 TTCCAAGCATGTCAAATACTGGG + Intronic
1134723290 16:16399491-16399513 TTTCCTACATGTCCAATGCAGGG - Intergenic
1134944138 16:18312379-18312401 TTTCCTACATGTCCAATGCAGGG + Intergenic
1135534677 16:23284099-23284121 TCCCTAACATTTCTAATGCAAGG - Intronic
1137718939 16:50616266-50616288 TTACTAACAATTCAATTGCATGG - Intronic
1139911726 16:70401357-70401379 TTCCAGACATGTCAAAACCAGGG - Intronic
1140575791 16:76167012-76167034 TTCCTATGATATGAAATGCAGGG - Intergenic
1141746259 16:85928639-85928661 TTCAGAACATTTCAACTGCAAGG + Intergenic
1144063744 17:11605999-11606021 TTCCTAGGATCTCAAAGGCAGGG - Intronic
1148627780 17:49083192-49083214 TTCCTAGCATATGAAAGGCATGG - Intergenic
1154503275 18:15006976-15006998 TTCCTGACATGTGACAAGCATGG - Intergenic
1155800464 18:30095692-30095714 TTCCTATCATGTTACATCCAGGG + Intergenic
1156661179 18:39348400-39348422 TTCCTACCATCTGAAATGCTTGG - Intergenic
1157163509 18:45336819-45336841 TTCCTCACAGCCCAAATGCATGG + Intronic
1157720795 18:49922630-49922652 TTGCTAAGATGGCAAATGCCAGG + Intronic
1158179681 18:54700056-54700078 ATCCCCACATGTCAAAGGCAGGG + Intergenic
1159829711 18:73260613-73260635 TTACTAACATGAAAAATGGAAGG - Intronic
1160049658 18:75421020-75421042 TTCATAACGTGTGAAGTGCATGG + Intronic
1166528294 19:43526844-43526866 TTCCTAACATCCCAAAATCAGGG + Intronic
926334060 2:11850106-11850128 TTCCTAATGTGTCCACTGCAGGG - Intergenic
926515847 2:13844819-13844841 TTCCTAACAGCCCAAATTCAAGG - Intergenic
926519313 2:13890393-13890415 TTCCTAACACTTTAACTGCAGGG - Intergenic
927443478 2:23137338-23137360 TTCCTCACATCACAGATGCAGGG + Intergenic
930127522 2:47814083-47814105 TTCCTAACATGTAAACTAAATGG + Intronic
930402921 2:50913649-50913671 TTTCAAACAGGTAAAATGCAGGG - Intronic
930618203 2:53616017-53616039 TTCCTAAGATGGCATATGCCTGG - Intronic
932160109 2:69452114-69452136 TTCCTAATCTGTAAAATGCAGGG + Intergenic
933586290 2:84182719-84182741 TTCCTCACATATCATTTGCATGG - Intergenic
934687370 2:96331549-96331571 TTCCTCACATGTAAAATGGAGGG - Intergenic
935940509 2:108233183-108233205 ATCCTCACATGTCAAGGGCAGGG + Intergenic
937156891 2:119725992-119726014 TTCCTCACATATGAAATGGATGG + Intergenic
937800424 2:126075509-126075531 TTCTTCACATGACAAAAGCAAGG + Intergenic
938502453 2:131837137-131837159 TTCCTGACATGTGACAAGCATGG - Intergenic
939478518 2:142717497-142717519 TTCCCAAAAGGTCAAATTCAGGG + Intergenic
939749171 2:146019957-146019979 TTCTTAACATGGCAACAGCAAGG + Intergenic
940201920 2:151161381-151161403 TCCCTTGCATTTCAAATGCACGG - Intergenic
940402375 2:153262403-153262425 TTCCTAACAACTCAAAAGGAGGG + Intergenic
940964439 2:159821911-159821933 TGCCTCACCTGTGAAATGCAAGG + Intronic
941959716 2:171241551-171241573 TTCCTAGCATGTCATAGGCCTGG - Intergenic
943600035 2:189906068-189906090 TTCCTGACATATTAAATGCTTGG - Intronic
944335873 2:198533549-198533571 TTCTTATTTTGTCAAATGCATGG - Intronic
946440372 2:219690234-219690256 TTGCCAACATGTGAAATGCGCGG - Intergenic
946755590 2:222943640-222943662 GTCCTAAAATGTCAGATGCCAGG + Exonic
947818219 2:233052198-233052220 TTCCTAAAAGTTCAAACGCAAGG + Intergenic
948094247 2:235321021-235321043 TCCCTGACATCTCAAATACACGG + Intergenic
1168996833 20:2139504-2139526 ATCGTTACATGTCAAAAGCAGGG + Intronic
1171446699 20:25209421-25209443 TTCTTAAAAGGTAAAATGCAGGG + Intronic
1171501626 20:25598129-25598151 TTTCTAAAATGTCATATGAATGG + Intergenic
1173165774 20:40686382-40686404 TTCCTACTATCTCAAAAGCAGGG + Exonic
1173327972 20:42050861-42050883 TTACTGACATGTCAAAAGCAGGG + Intergenic
1174891819 20:54403377-54403399 GTCCTAAGATGTCAAATGAATGG - Intergenic
1176069679 20:63219575-63219597 TTCCCAACACGTGAGATGCAAGG - Intergenic
1177004933 21:15660348-15660370 TTCCCAACATTTAAAATGCGTGG + Intergenic
1177187720 21:17816797-17816819 TTCCTTAAATGTAAAATACAGGG + Intronic
1177908699 21:27002900-27002922 ATCCTCACATGTCAAGGGCAGGG - Intergenic
1177909031 21:27008041-27008063 ATCCTCACATGTCAAGGGCAGGG + Intergenic
1178015572 21:28342496-28342518 TGACTAGCATGTCAAATTCATGG - Intergenic
1183250544 22:36727100-36727122 TTGCTCACCTGTCAAATGGAAGG - Intergenic
1184734283 22:46388929-46388951 TTCCTTACCTGTCAAATGGGTGG + Intronic
951229400 3:20159594-20159616 TTCCCAAAAAGGCAAATGCAGGG + Intergenic
951792282 3:26499386-26499408 TTCCTAACATATGAAAAGTAGGG - Intergenic
951905963 3:27707807-27707829 TTTCAAAAATGTCAAAAGCATGG - Intergenic
952609986 3:35197134-35197156 TTGCTAACATGTCCTATGTATGG + Intergenic
956857898 3:73294085-73294107 TTCCTCATCTATCAAATGCAAGG - Intergenic
957271458 3:78035669-78035691 TTCCTTAAATGTTAAATGAATGG + Intergenic
958969119 3:100591808-100591830 TTCATATCCTGTAAAATGCATGG + Intergenic
960094687 3:113677908-113677930 TTCCAAACATGACAAATGAGAGG + Intronic
961156087 3:124680916-124680938 TGCCTATCCTGTGAAATGCAAGG - Intronic
961459303 3:127040080-127040102 TTTCTATCATTTCTAATGCAGGG - Intergenic
962945750 3:140167767-140167789 TTTCTAAAATGTCATATGAATGG + Intronic
963208442 3:142660931-142660953 TTTTTATCATTTCAAATGCAAGG + Intronic
963961559 3:151314826-151314848 TTCCTCACAGGTAAAATGAAGGG - Intronic
966080911 3:175999093-175999115 TTCCAAACATTTCAAAAGGAGGG + Intergenic
966638372 3:182160688-182160710 ATCCTATCAGGTCAAATGAAAGG + Intergenic
966819026 3:183910576-183910598 TTCCTCGCCTGTCAAATGCAGGG - Intergenic
967424379 3:189309482-189309504 TTCCAAGCTTGTCGAATGCAGGG + Intronic
969185801 4:5473473-5473495 TTCCTAACCTGTGAAATGGGGGG - Intronic
969969345 4:11029490-11029512 TTCCTACGTTGTCAAATGTAAGG - Intergenic
972562608 4:40241997-40242019 TTCCTGACATGTGTCATGCAGGG - Intronic
977118103 4:93059158-93059180 TTGATAACATTTGAAATGCATGG + Intronic
980164466 4:129208523-129208545 TTCCTTACATGGCAAATGCAGGG - Intergenic
980271046 4:130583920-130583942 GTCCTCACATGTAAAATGGAAGG + Intergenic
981775082 4:148357809-148357831 TTCCTGGCATGTTAAAAGCAAGG + Intronic
981990345 4:150912199-150912221 TTCCTAACAGGTCATATACCTGG - Intronic
982460347 4:155662469-155662491 ATCCTCACATGTCAAAGGCAGGG - Intergenic
982538048 4:156630999-156631021 TTCCTAATAGGTAAAGTGCATGG + Intergenic
982832835 4:160085694-160085716 GTCCTCACATTTCAAATTCAAGG + Intergenic
983332995 4:166355302-166355324 TTCCTCAAATACCAAATGCAAGG - Intergenic
983994151 4:174160467-174160489 ATCCCCACATGTCAAAGGCAGGG - Intergenic
985956349 5:3268819-3268841 TTACTAACTTCTGAAATGCATGG - Intergenic
988074579 5:26336720-26336742 TTCCCAACATGAAAAATGCTGGG - Intergenic
990283752 5:54278981-54279003 TTCCTAATATGTAAAATATAAGG + Intronic
990993618 5:61709244-61709266 TTCCTTATCTGTCAAATGAAAGG + Intronic
990998125 5:61753906-61753928 TTCCTAAAGAGACAAATGCATGG - Intergenic
991283557 5:64943390-64943412 TTCCTTGCATTTCAAAGGCAAGG + Intronic
992047635 5:72910740-72910762 TTTCAAAAATTTCAAATGCATGG + Exonic
994970049 5:106725283-106725305 TTGCTAGAATGTGAAATGCAAGG + Intergenic
995068447 5:107889873-107889895 TTCCAAAAATGTCAAAAACAAGG + Intronic
995148660 5:108816147-108816169 TTCCTAATATGTCAATTGTGTGG - Intronic
996184000 5:120454583-120454605 CTGCCAATATGTCAAATGCATGG + Intergenic
996226828 5:121009497-121009519 TTCCTAACAGGAAAAATACAGGG + Intergenic
996790471 5:127288993-127289015 TTTCTAACATTTCATATGAATGG - Intergenic
998429594 5:142059626-142059648 TTCCTCATCTGTTAAATGCATGG - Intergenic
1000957482 5:167560043-167560065 TGCCTCACTTCTCAAATGCATGG + Intronic
1001061031 5:168488868-168488890 GTCCTAAGTTGTCTAATGCAGGG - Intronic
1002991078 6:2239511-2239533 TTCTTAACTTGTCAAGTGAAAGG - Intronic
1005453339 6:25994923-25994945 TTCCTAAAATTTCATATGAATGG + Intergenic
1005664319 6:28035588-28035610 TTCCTAATCTATCAAATGAAAGG - Intergenic
1005834504 6:29697819-29697841 TTCATAAAATAACAAATGCATGG - Intergenic
1007337597 6:41164737-41164759 TTCCTAAAATGTCATAGACATGG + Intergenic
1007973464 6:46076440-46076462 TTCCTTACAAGAGAAATGCAAGG + Intronic
1009665763 6:66676567-66676589 TTCCAAACATATCAAAGGCAAGG + Intergenic
1009694973 6:67090572-67090594 TTCCAAACATATGAAATGCTGGG - Intergenic
1012293651 6:97492265-97492287 ATCCTAACACGTCAAATACTAGG - Intergenic
1013218063 6:108048628-108048650 CTCCTAACATGGCAATAGCAGGG - Intronic
1013703472 6:112802406-112802428 TTTCTAGCATGTTAAATGCTTGG - Intergenic
1015054783 6:128887359-128887381 TTCATAACAGATAAAATGCATGG + Intronic
1015507042 6:133999562-133999584 TTCCTCACATGTCAAACTCAGGG - Intronic
1015586236 6:134779336-134779358 TTCTTGACATGGCAAATTCAGGG - Intergenic
1015656322 6:135523275-135523297 TTCCTAATATGTCAAGTTAAAGG - Intergenic
1021417975 7:20410388-20410410 TTCCTCACATGTCCAGTGCAGGG - Exonic
1022864534 7:34404223-34404245 GTGCTCACTTGTCAAATGCAGGG - Intergenic
1023137385 7:37065910-37065932 ATCCCCACATGTCAAAGGCAGGG + Intronic
1024758563 7:52566585-52566607 GTCCTAACATGGAAAATGGAAGG + Intergenic
1026128834 7:67603755-67603777 TTCCTAATCTGTAAAATGCATGG - Intergenic
1026365594 7:69645421-69645443 CTCCTAACCTGTAAAATGAAAGG - Intronic
1026792860 7:73346163-73346185 TCCCAAACATACCAAATGCAAGG + Intronic
1027503281 7:78982572-78982594 TTTCTTACATGTCAAAAGGAGGG - Intronic
1027810127 7:82885803-82885825 TTCCTCACATGCAAAATGCAGGG - Intronic
1027966352 7:85014937-85014959 TTACTAACATGTCCTATGGAAGG - Intronic
1029966110 7:104742650-104742672 TTCCTGGCCTGTGAAATGCAGGG + Intronic
1030405465 7:109106398-109106420 TTTCTAAAATGTCAAATAAATGG - Intergenic
1031365695 7:120898118-120898140 TTCCAAACAGGTGAAATGAATGG + Intergenic
1031534637 7:122918039-122918061 TTCCTAACATCTCAGACACAGGG - Intergenic
1032582818 7:133118826-133118848 CTCCTCACCTGTCAAATGAATGG - Intergenic
1038149111 8:24926896-24926918 TTTCTAACATGTGACATTCAAGG - Intergenic
1039218699 8:35302885-35302907 TTCCTTATTTGTAAAATGCAAGG - Intronic
1040857532 8:51963692-51963714 TACATAATATGTCATATGCATGG - Intergenic
1041887269 8:62824989-62825011 GACCAAGCATGTCAAATGCAGGG + Intronic
1045180296 8:99773783-99773805 TTCAAAACAGGTCAAATTCATGG - Intronic
1045711361 8:104988288-104988310 TTCCTAACAGGTGAAGTTCAGGG - Intronic
1045968589 8:108054698-108054720 CGCCTAGCATGTAAAATGCAAGG + Intronic
1048065038 8:130958724-130958746 ATCCTCACATGTCAAGGGCAGGG - Intronic
1048338063 8:133517730-133517752 TTCCCAACCTGTCAAATACTGGG + Intronic
1048575633 8:135687667-135687689 TTCCTCATCTGTAAAATGCATGG + Intergenic
1050854766 9:10339244-10339266 TTCCTAAAATGTCAACTGCATGG - Intronic
1052773276 9:32708823-32708845 TTCCTCACTTGTAAAATGAATGG - Intergenic
1053220486 9:36308434-36308456 TTCCGAACATGTCATATAAATGG + Intergenic
1053452226 9:38202752-38202774 TTCCTCACAGGACAAAGGCAGGG + Intergenic
1054934582 9:70673138-70673160 TTCCTAGTCTGTAAAATGCATGG + Intronic
1058010489 9:99971576-99971598 TTCCTTACTTGTAAAATGCCTGG - Intergenic
1058135395 9:101302141-101302163 TTCCTCACCTGTAAAATGTAGGG + Intronic
1058456955 9:105146768-105146790 TCTCTAACAGGTCAAATGCATGG + Intergenic
1059741995 9:117160716-117160738 TTCTTAATAAGTGAAATGCAAGG + Intronic
1060290089 9:122294133-122294155 TTCCTCACATGTCAGATGAAGGG + Intronic
1060291386 9:122306275-122306297 TTCCTCAACTGTCAAGTGCAGGG - Intronic
1060904437 9:127292211-127292233 TGGCTAACATGTCAATGGCAAGG - Intronic
1186083503 X:5959691-5959713 ATCCTGTGATGTCAAATGCACGG - Intronic
1186336211 X:8591627-8591649 TTCTTAACATGCAAATTGCAGGG - Intronic
1189452723 X:41153880-41153902 TACATAACATGTTAAATGAATGG - Intronic
1189800916 X:44691118-44691140 TTCCTTACATGTCACAGGCCTGG - Intergenic
1192247795 X:69387917-69387939 TTCCTAGCCTGTGAAATGGATGG + Intergenic
1193713358 X:84905547-84905569 AACCTAATATCTCAAATGCATGG + Intergenic
1193732649 X:85119676-85119698 TGACTTACATATCAAATGCAAGG - Intergenic
1196522936 X:116695365-116695387 TTTCTAACTTGTCTAGTGCAAGG - Intergenic
1196587132 X:117443320-117443342 TTCCTCACATGGGAAGTGCAAGG + Intergenic
1199841923 X:151657941-151657963 TTCCAAAAAAGTAAAATGCAAGG + Intronic
1200380568 X:155833371-155833393 ATCCCCACATGTCAAAGGCAGGG + Intergenic