ID: 1124186017

View in Genome Browser
Species Human (GRCh38)
Location 15:27530214-27530236
Sequence ACATGTCAAATGCAAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124186010_1124186017 18 Left 1124186010 15:27530173-27530195 CCTGGGGCAAGCTGTTCCAATTG 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1124186017 15:27530214-27530236 ACATGTCAAATGCAAGGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 196
1124186011_1124186017 2 Left 1124186011 15:27530189-27530211 CCAATTGCTCTGTGCCCCTTTCC 0: 1
1: 0
2: 3
3: 34
4: 331
Right 1124186017 15:27530214-27530236 ACATGTCAAATGCAAGGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124186017 Original CRISPR ACATGTCAAATGCAAGGCTG AGG Intronic
900044875 1:497853-497875 AAATGTCTAAAGTAAGGCTGTGG - Intergenic
901025920 1:6278725-6278747 ACATGTCAAAGCCAAGGGTTCGG + Intronic
905741487 1:40374544-40374566 GCATGTCACTTGCAAAGCTGGGG + Intronic
906925530 1:50111660-50111682 AAATGCCAAATGGAAGGCAGTGG - Intronic
907506942 1:54926056-54926078 ACATGGTAAAGGCAAGGCTCTGG - Intergenic
909055194 1:70812564-70812586 ACAACTGAAATGCAAGGGTGGGG - Intergenic
910628499 1:89333944-89333966 ACATGTGAACTGGAAGGCTCAGG + Intergenic
910636052 1:89409066-89409088 ACATGTGAAACACATGGCTGAGG - Intergenic
913254628 1:116942430-116942452 ACTTGTCAGCTGCATGGCTGTGG + Intronic
914206922 1:145539820-145539842 AAGTGTAAAATGCAAAGCTGAGG - Intergenic
915686635 1:157640745-157640767 ACATGTGAAAGGCAGGGCAGAGG - Intergenic
915708734 1:157872694-157872716 ATATGTCAAATACTAGGCTGTGG - Intronic
915769206 1:158401173-158401195 ACATGTTAAATGCAAGGATGAGG - Intergenic
918835535 1:189460012-189460034 AAATTTGAAAAGCAAGGCTGAGG - Intergenic
919966334 1:202530230-202530252 GCATTTCAAATGCCAGGCTCAGG - Intronic
921090535 1:211837970-211837992 AGATGTAAATAGCAAGGCTGTGG - Intergenic
921136199 1:212261411-212261433 ACATGTTAAATGCCTGGGTGTGG + Intergenic
921617202 1:217283300-217283322 ACAAGTAAGATGCAAGGCTTTGG + Intergenic
924770262 1:247073776-247073798 ACATGCCAGTTGCAAGCCTGAGG + Intronic
924919331 1:248610828-248610850 ACATGACGAATCAAAGGCTGAGG + Intergenic
1063416632 10:5878271-5878293 ACAGGCCAGATGCAGGGCTGAGG + Exonic
1064333118 10:14412511-14412533 ACAAGTCAAGGGCAAAGCTGGGG - Intronic
1064816681 10:19273239-19273261 AAATGTGAAATGCAAGGATGTGG + Intronic
1068727460 10:60319443-60319465 ACACGACAAATGCCAGCCTGGGG + Intronic
1070002735 10:72393019-72393041 ATATGTCAAGTCCAAGGATGAGG + Intronic
1070676703 10:78416770-78416792 ACATGTCTAATGTAGGGCAGTGG - Intergenic
1074229339 10:111517891-111517913 ACAAGACAAAGGCAAGCCTGGGG - Intergenic
1075446384 10:122516329-122516351 ACATGTCATATGCAACAATGTGG - Intergenic
1076265692 10:129108298-129108320 ACAAGTCAAATGTAAACCTGGGG - Intergenic
1078471838 11:11593893-11593915 AAAAGCCAAATGCAAGGCAGGGG - Intronic
1079528506 11:21419884-21419906 GCATGGCAAATGCATGGCAGTGG - Intronic
1081333524 11:41834125-41834147 CCATGTCATATGCAATCCTGTGG + Intergenic
1085755858 11:79200707-79200729 ACATTTCAAAGTCAAGGCAGGGG + Intronic
1086854084 11:91845793-91845815 ATATGTTAAATGAAAGGCTATGG - Intergenic
1087123136 11:94595562-94595584 ACATCTCAGATGAAGGGCTGTGG - Intronic
1088811438 11:113395353-113395375 AGATGACAATTGCAAAGCTGTGG - Exonic
1091354041 11:134922027-134922049 ACATGCCAGAGGCAAGGATGTGG - Intergenic
1092071288 12:5633543-5633565 AAATCTAAAATGCCAGGCTGAGG - Intronic
1092954613 12:13538221-13538243 ACCAGTCTAATGAAAGGCTGAGG - Exonic
1094371045 12:29737782-29737804 ACATGTGGAAAGCAAGGCTCCGG - Intronic
1094408464 12:30144664-30144686 ATATGCCAAATGGATGGCTGAGG + Intergenic
1097962372 12:65545244-65545266 AAATTTCAAGTGCAAGGGTGTGG - Intergenic
1098374283 12:69797206-69797228 ACATGCCCAGTGCAAGGCTTTGG + Intronic
1100433051 12:94547390-94547412 ATATGTGAAATGCAGGGCTTGGG - Intergenic
1104714288 12:131006211-131006233 ACTTGGGAACTGCAAGGCTGGGG + Intronic
1107659100 13:42620985-42621007 ACATGACAAAAGCTGGGCTGTGG - Intergenic
1112025131 13:95404672-95404694 ACATGCCAAAAGAAAGGCAGAGG + Intergenic
1112353745 13:98657513-98657535 GCAAGTGAGATGCAAGGCTGGGG + Intergenic
1113365911 13:109675694-109675716 TTATGTCAAAGGCAAGGGTGGGG + Intergenic
1115276269 14:31612794-31612816 AAATAACAAATGCAAGGATGTGG + Intronic
1119797164 14:77409146-77409168 ACATGGCAAATGTAATGCTAAGG + Intronic
1120689327 14:87575427-87575449 AGAAGAAAAATGCAAGGCTGAGG - Intergenic
1121136480 14:91503496-91503518 AGTTGATAAATGCAAGGCTGGGG - Intronic
1121186419 14:91974916-91974938 CCATCTCAAATGAAAGTCTGGGG + Intronic
1123828541 15:24108173-24108195 ACATGTCAAATCAAGGGGTGTGG - Intergenic
1123858530 15:24437967-24437989 ACATGTCAAATCAAGGGGTGTGG - Intergenic
1123863169 15:24488392-24488414 ACATGTCAAATCAAGGGGTGTGG - Intergenic
1124186017 15:27530214-27530236 ACATGTCAAATGCAAGGCTGAGG + Intronic
1127038914 15:54951680-54951702 AGATGTCAAAATCAAGTCTGTGG + Intergenic
1128779199 15:70347015-70347037 ACATTTCAAAAACAATGCTGAGG + Intergenic
1129821216 15:78603300-78603322 ACATGTCTAAGGCCAGGCAGTGG - Intronic
1130967508 15:88708276-88708298 ACATGTGAAAGGCAAGAATGTGG - Intergenic
1131786996 15:95924188-95924210 AACTGTCAACAGCAAGGCTGGGG - Intergenic
1131851912 15:96552743-96552765 ACATAGCAAATGAAAGGCTAAGG + Intergenic
1132802640 16:1761939-1761961 ACAATTCACATGCAGGGCTGGGG + Intronic
1133664078 16:7947957-7947979 AATTATCAAATTCAAGGCTGGGG - Intergenic
1137593125 16:49706081-49706103 ACACTTCAAAGGCAAGGGTGAGG + Intronic
1137595885 16:49723398-49723420 ACATGGCAAAGGCTAGGTTGAGG - Intronic
1138023699 16:53505771-53505793 ATATGTCAAATGAAAGACAGAGG - Intergenic
1139035376 16:62939705-62939727 TCATGTGAAATGCAAGACTGTGG + Intergenic
1143922774 17:10343965-10343987 GCCTGCCAAAGGCAAGGCTGAGG - Exonic
1144263386 17:13545093-13545115 GCTTGTCAAATGACAGGCTGGGG + Intronic
1146907859 17:36629591-36629613 AGATGTCAGAAGCCAGGCTGGGG + Intergenic
1148984881 17:51612720-51612742 TCATGTAAAATCCAGGGCTGAGG + Intergenic
1151081253 17:71332123-71332145 AAATGTCAAATGCAAAGCCCTGG - Intergenic
1151989319 17:77564157-77564179 AGGTCTCAAAGGCAAGGCTGAGG - Intergenic
1154218855 18:12434620-12434642 AAAGGTCAAAAGCAAGGCCGAGG + Intergenic
1155615090 18:27712939-27712961 ACATCTCAAAGGCATGGTTGTGG + Intergenic
1157710004 18:49843737-49843759 CCATGGCAAGTGGAAGGCTGAGG + Intronic
1157971851 18:52279511-52279533 CCATGTCAAATGTAAGGCCAGGG - Intergenic
1158461558 18:57650507-57650529 ACATGGCAAATGCATCACTGTGG + Intronic
1165395446 19:35561267-35561289 ACATGGGGAATGCAAGGCTTGGG - Intronic
1166864610 19:45828346-45828368 ACATGTCAAATTCAGGGCGCTGG - Intronic
1167260778 19:48456451-48456473 ACTTGACAGAGGCAAGGCTGAGG - Exonic
1202646564 1_KI270706v1_random:147338-147360 ACATGCCAATTGCAAGTCTTGGG - Intergenic
925903762 2:8527017-8527039 ACATGTAAAAGGCAAGACAGGGG + Intergenic
926303772 2:11622576-11622598 ACATGGCAAATGGAAGAGTGTGG + Intronic
926445282 2:12934374-12934396 AGAGGTCAAATGCATGGCAGAGG - Intergenic
926970008 2:18457104-18457126 ACATGTCAGATGGTAGGCAGAGG - Intergenic
933771338 2:85746327-85746349 ACAAGTCAGATGCCAGGCAGAGG + Intergenic
933899680 2:86840507-86840529 CCATGGCTAATGAAAGGCTGAGG - Intronic
934058194 2:88270068-88270090 AAATGTCAACAGGAAGGCTGAGG + Intergenic
934509714 2:94927754-94927776 ACATGCCAATTGCAAGTCTTGGG - Intergenic
935780881 2:106508719-106508741 CCATGGCTAATGAAAGGCTGAGG + Intergenic
935943409 2:108265027-108265049 AGATGTCAAATGGAACTCTGTGG + Intronic
936451559 2:112637319-112637341 AAATGCCAATTTCAAGGCTGGGG - Intergenic
937281436 2:120719949-120719971 ACATGTGAAATGCAAAGACGCGG + Intergenic
938072192 2:128314636-128314658 GCAGGTCAAAGGCGAGGCTGCGG + Intronic
938462546 2:131507274-131507296 GGCTGTCAAAAGCAAGGCTGTGG - Intergenic
939468419 2:142587855-142587877 ACATTTCAAAGGCAATGATGAGG - Intergenic
940134437 2:150420605-150420627 ACATTTCAAAGACAAGACTGAGG - Intergenic
941469828 2:165870886-165870908 ACATGTTAAATGAAAGTTTGGGG - Intronic
944867371 2:203875696-203875718 ACTTGTCACAGGCAAGACTGTGG + Intergenic
946570662 2:221020551-221020573 AAATATAAAATGCAAGGGTGAGG - Intergenic
947102126 2:226631927-226631949 AAATGTCACATGAAAGGCTCTGG + Intergenic
1169661306 20:7981480-7981502 ACATCTCAAATGAAATGTTGTGG - Exonic
1172399578 20:34638189-34638211 CCAGGTCAAATGCAAAGGTGTGG - Intronic
1175289411 20:57865039-57865061 AAATGTCAAAAGAAAGGGTGGGG - Intergenic
1177069929 21:16492169-16492191 ACATATGAATTGCAAGGCAGGGG - Intergenic
1178679463 21:34660247-34660269 ACATGCCACCTGCAAGCCTGGGG + Intergenic
1180355370 22:11835141-11835163 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1180382882 22:12157186-12157208 ACATGCCAATTGCAAGTCTTGGG - Intergenic
1182401718 22:30082965-30082987 ACATATCAAATGTAAGAGTGAGG + Intronic
1184819725 22:46900553-46900575 AGTTGTCAAGTGCAAGGGTGGGG - Intronic
949160159 3:872537-872559 AAATGCCAATTGCAAGCCTGGGG + Intergenic
951173493 3:19571775-19571797 ACATGGCAATGGCAAGGATGTGG - Intergenic
953344503 3:42163991-42164013 ACATGAAAGAAGCAAGGCTGTGG + Intronic
954052962 3:47996687-47996709 ACATGTAAAATAGTAGGCTGAGG - Intronic
954202560 3:49032781-49032803 ACAAGTAAAATGCAAGGCAGAGG + Intronic
956335406 3:68157974-68157996 ACTTGTTAAATCCAAGACTGAGG - Intronic
959116804 3:102188080-102188102 ACATTTCATATTTAAGGCTGAGG + Intronic
959230323 3:103640939-103640961 AAATGTCAAATTTAAGACTGAGG - Intergenic
959598414 3:108152485-108152507 ACTTGTAAAATGCAGTGCTGGGG + Intergenic
960521757 3:118663066-118663088 ACATCTTAAAAGCAAGGCTGTGG - Intergenic
961550312 3:127667173-127667195 CCATGGCAAATGCCAGGCTCAGG - Intronic
962300456 3:134237382-134237404 ACATCTCACAAACAAGGCTGGGG + Intronic
962446055 3:135466845-135466867 CCATTTAAATTGCAAGGCTGAGG + Intergenic
968695957 4:2026825-2026847 TCATGTCATATGCAGGGATGTGG - Intronic
968970972 4:3793702-3793724 ACATGTCAAGGGAAGGGCTGAGG - Intergenic
969667968 4:8573017-8573039 ACATGTGAAATGCACCTCTGAGG - Intronic
970249612 4:14100419-14100441 TCATCTCAGATGCAAGGGTGGGG + Intergenic
970834471 4:20385497-20385519 ACATGTTAAAGGAAAGGCAGTGG + Intronic
972723980 4:41729864-41729886 TCATGTGAAATGCAAGACTTTGG - Intergenic
972835241 4:42862547-42862569 TCATTTTAAATGCAAGGCTAGGG - Intergenic
973372797 4:49265481-49265503 ACATGCCAATTGCAAGTCTTGGG - Intergenic
973388200 4:49529582-49529604 ACATGCCAATTGCAAGTCTTGGG + Intergenic
979697122 4:123625096-123625118 AAATGGCAATTGCAAGGCTGAGG - Intergenic
985871859 5:2563484-2563506 ACATCTCTCCTGCAAGGCTGTGG + Intergenic
988057701 5:26121595-26121617 ACATGTCTAATGGATTGCTGGGG - Intergenic
991044437 5:62208398-62208420 ACATGACAAGTGCATGGCTCTGG - Intergenic
992075512 5:73189384-73189406 ACATGACAGATGCAAGGTTTTGG + Intergenic
995823114 5:116260768-116260790 ATATGACAAATTCAAGCCTGGGG - Intronic
998454308 5:142259377-142259399 ACCTGTCAATTGCAAGAATGTGG - Intergenic
1000585310 5:163090100-163090122 AGATGGCAAATGCAGGGCAGTGG + Intergenic
1002127802 5:177059915-177059937 AAAAGACAAATGCAAGACTGTGG + Intronic
1002728969 5:181321076-181321098 AAATGTCTAAAGTAAGGCTGTGG + Intergenic
1002893568 6:1359876-1359898 ACATCTGTAATCCAAGGCTGAGG + Intergenic
1003974824 6:11332513-11332535 GCATGGCACGTGCAAGGCTGTGG - Intronic
1004014828 6:11722849-11722871 AAATGTCTTATGGAAGGCTGAGG + Intronic
1004932066 6:20472186-20472208 GCATGCCATATGCAAGGCTCTGG + Intronic
1007111386 6:39315111-39315133 ACAGGTCTGAGGCAAGGCTGTGG - Exonic
1007430966 6:41776810-41776832 GCAAATCAAATGCCAGGCTGAGG - Intronic
1007800943 6:44392211-44392233 ACATATCAAATGAAAGGTTACGG + Intronic
1008061351 6:47000469-47000491 ACTTGACAAATGCAAGCCTCTGG - Intronic
1009248399 6:61268978-61269000 GCATGTCAAAAGCAATGCTTGGG - Intergenic
1010084801 6:71904560-71904582 AGATGTCCATTGCGAGGCTGGGG - Intronic
1011582153 6:88880594-88880616 ACAGGAAAAATGTAAGGCTGTGG - Intronic
1014476448 6:121878324-121878346 ACATGTGAAATGAAAGGCTATGG - Intergenic
1014596190 6:123342853-123342875 ACATATGATTTGCAAGGCTGTGG - Intronic
1017900482 6:158715148-158715170 ACATGACAAATACAAGGGGGTGG - Intronic
1019659719 7:2217385-2217407 ACATGGCAGAGGCCAGGCTGGGG + Intronic
1020973104 7:14971646-14971668 ACGTATCAAATGCAACACTGTGG + Intronic
1021968702 7:25947248-25947270 AAATTTCAAATGCAAGGGTTGGG - Intergenic
1023450566 7:40280177-40280199 ACATGACAATTGCCAGGATGTGG + Intronic
1024134115 7:46389275-46389297 TAATGTCAAATTCAAGGCTTAGG + Intergenic
1027899737 7:84096390-84096412 ACATGTCCAAAGAAAAGCTGTGG - Intronic
1029513744 7:101013108-101013130 ACATGTCAGCTGCAACGCAGTGG + Exonic
1034101990 7:148458016-148458038 ACTTGGGAAATGCAAGTCTGTGG - Intergenic
1036034949 8:5008467-5008489 ACATGTGAAGAGCAAGGCTTTGG + Intergenic
1036690513 8:10941795-10941817 ACATGTCAAATGCAACCCTTGGG + Intronic
1039536956 8:38325142-38325164 AGATGTCAGTTGCAAGTCTGGGG - Intronic
1041532173 8:58881396-58881418 ACATGTGCCATGCAAGGATGGGG - Intronic
1041887272 8:62824995-62825017 GCATGTCAAATGCAGGGGAGTGG + Intronic
1044302183 8:90597228-90597250 ACATATGAAATACAAGGCAGGGG - Intergenic
1045287815 8:100807155-100807177 ACCTGTCAAATGGAAGGAGGAGG - Intergenic
1046379499 8:113433980-113434002 TCATGTGAAATAAAAGGCTGTGG - Intronic
1046699884 8:117388331-117388353 ACATGTCAAGTGCAGGGATAGGG + Intergenic
1048173094 8:132127197-132127219 GCATGTCAAATGGAAGCCCGTGG + Exonic
1048314218 8:133350282-133350304 ACCTGACACATGGAAGGCTGAGG + Intergenic
1049016430 8:139923355-139923377 ACATGTAAAATGCCATGCCGTGG + Intronic
1049052661 8:140210801-140210823 GCATGTCTTATGCAAGCCTGTGG + Intronic
1050478266 9:6063366-6063388 ACAAGGAAGATGCAAGGCTGGGG - Intergenic
1051118772 9:13728872-13728894 AAATGTCATATTCAAGTCTGTGG - Intergenic
1051125968 9:13806273-13806295 TCACGTCAAATGAAAGCCTGGGG + Intergenic
1052358147 9:27527709-27527731 GCAAGTCAACTGCAAGGCTATGG + Intronic
1052989375 9:34510140-34510162 AGATCTCAAATGCCAGGCTGAGG + Intronic
1053655688 9:40216495-40216517 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1053906050 9:42845716-42845738 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1054352083 9:64026526-64026548 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1054528918 9:66159791-66159813 ACATGCCAATTGCAAGTCTTGGG - Intergenic
1054675424 9:67852465-67852487 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1057586884 9:96336398-96336420 ACATTTCAAGTTCAATGCTGAGG - Intronic
1058811494 9:108643908-108643930 ACATGGCATAGGCAAGGATGAGG + Intergenic
1059238171 9:112779941-112779963 ACATGTCAAAAGCATTGGTGGGG - Intronic
1059591712 9:115669418-115669440 ACAGGTCAAATGCAATGCCATGG + Intergenic
1060850109 9:126868074-126868096 TCATGTCACATTCACGGCTGAGG - Intronic
1060904435 9:127292205-127292227 ACATGTCAATGGCAAGGGTCAGG - Intronic
1061177895 9:129008482-129008504 ACAGGTCAGAAGCAGGGCTGGGG + Exonic
1061744467 9:132729353-132729375 AAATGTCAAGTGCATGGCTGAGG + Intronic
1203696514 Un_GL000214v1:103503-103525 ACATGCCAATTGCAAGTCTTGGG - Intergenic
1203552708 Un_KI270743v1:177521-177543 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1203639759 Un_KI270751v1:560-582 ACATGCCAATTGCAAGTCTTGGG + Intergenic
1185878094 X:3715394-3715416 ACCTTGGAAATGCAAGGCTGCGG + Intergenic
1192245107 X:69365526-69365548 ACATGTGAGATGCAGGACTGTGG + Intergenic
1201776160 Y:17668301-17668323 GCAAGGCAACTGCAAGGCTGAGG - Intergenic
1201825396 Y:18237691-18237713 GCAAGGCAACTGCAAGGCTGAGG + Intergenic
1202301956 Y:23426028-23426050 GCATTTCAAATGCCAGGCTCAGG - Intergenic
1202568855 Y:26244570-26244592 GCATTTCAAATGCCAGGCTCAGG + Intergenic